The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Harcourt, J.
Right arrow Articles by Tripp, R. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Harcourt, J.
Right arrow Articles by Tripp, R. A.
The Journal of Immunology, 2006, 176: 1600-1608.
Copyright © 2006 by The American Association of Immunologists

Respiratory Syncytial Virus G Protein and G Protein CX3C Motif Adversely Affect CX3CR1+ T Cell Responses

Jennifer Harcourt*, Rene Alvarez{dagger}, Les P. Jones{dagger}, Christine Henderson{dagger}, Larry J. Anderson* and Ralph A. Tripp1,{dagger}

* Division of Viral and Rickettsial Diseases, Viral and Enteric Virus Branch, Centers for Disease Control and Prevention, Atlanta, GA 30333; and {dagger} Center for Disease Intervention, Department of Infectious Diseases, University of Georgia, College of Veterinary Medicine, Athens, GA 30602


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Interactions between fractalkine (CX3CL1) and its receptor, CX3CR1, mediate leukocyte adhesion, activation, and trafficking. The respiratory syncytial virus (RSV) G protein has a CX3C chemokine motif that can bind CX3CR1 and modify CXCL1-mediated responses. In this study, we show that expression of the RSV G protein or the G protein CX3C motif during infection is associated with reduced CX3CR1+ T cell trafficking to the lung, reduced frequencies of RSV-specific, MHC class I-restricted IFN-{gamma}-expressing cells, and lower numbers of IL-4- and CX3CL1-expressing cells. In addition, we show that CX3CR1+ cells constitute a major component of the cytotoxic response to RSV infection. These results suggest that G protein and the G protein CX3C motif reduce the antiviral T cell response to RSV infection.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Respiratory syncytial virus (RSV)2 is a negative sense ssRNA virus in the Paramyxovirus family that is the primary cause of morbidity and life-threatening lower respiratory tract disease in infants and young children worldwide, as well as an important pathogen of the elderly and immune compromised (1, 2, 3). RSV primarily infects cells through heparin binding domains on the G protein; however, mutant viruses lacking the G gene may infect cells and replicate in vitro and in vivo presumably by attachment through heparin binding domains on the F protein (4). The G protein is evolutionarily conserved in all strains of RSV and has a central conserved cysteine noose region that contains a CX3C chemokine motif at aa positions 182–186 (5). The G protein CX3C motif interacts with the CX3CL1-specific receptor CX3CR1, competes with CX3CL1 for binding to CX3CR1, facilitates infection, and may alter CX3CL1-mediated responses (5). Fractalkine is the only known CX3CL1 chemokine, and is unique among chemokines, functioning as both a chemoattractant and adhesion molecule (6). The membrane-anchored form of fractalkine promotes cell adhesion with CX3CR1 expressed primarily on cytotoxic cells, e.g., T cells, NK cells, and monocytes/macrophages, and the soluble form acts as a chemoattractant for CX3CR1+ cells (7). CX3CR1 is also unique among chemokine receptors. All G protein-coupled chemokine receptors, with the exception of CX3CR1, require signal transduction and integrin activation for cell adhesion to occur. CX3CL1-CX3CR1 interaction is independent of signal transduction and integrin function, allowing for cell adhesion under both static and dynamic conditions (8, 9). Although inflammatory mediators such as IFN-{gamma}, TNF-{alpha}, and IL-1 may up-regulate CX3CL1 expression at the surface of endothelial cells and human bronchoepithelial cells (10, 11, 12), both CX3CL1 and CX3CR1 are constitutively expressed on these cell types (7, 13). The importance of CX3CL1-CX3CR1 interaction in the immune response is shown by the marked inhibition of leukocyte migration and chemotaxis associated with anti-CX3CL1- or anti-CX3CR1-blocking Ab treatment (14), and by inhibition of leukocyte infiltration in the glomeruli of rats in a crescentic glomerulonephritis model (15). The RSV G protein CX3C motif was shown to be important in the development of enhanced pulmonary disease associated with Formalin-inactivated RSV vaccination, and in pulmonary expression of the proinflammatory tachykinin substance P (16), suggesting that G protein CX3C-CX3CR1 interaction may be significant to the biology of RSV infection and disease pathogenesis.

CX3CR1+ cytotoxic cells possess high levels of perforin and granzyme B (17), and interaction of these cells with CX3CL1 promotes migration toward secondary CC chemokines, such as MIP-1beta and CCL4 (17). CD4+ and CD8+ T cells expressing CX3CR1 coexpress CCR5, and less frequently CXCR3, suggesting that CX3CR1-expressing CD8+ and CD4+ T cells overlap with T cytotoxic type 1 cells and Th1, respectively (10). CX3CR1 is expressed on the majority of CD56lowCD16high NK cells, the predominant NK cell effector subset found in peripheral blood (18). Thus, CX3CL1-CX3CR1 interaction is important in recruitment of cytotoxic effector cells to sites of infection (9, 19), suggesting that RSV G protein modification of CX3C-CX3CR1 interaction may be a mechanism to subvert antiviral immunity mediated by cytotoxic cells.

Accumulating evidence indicates that RSV G protein has immune modulatory activities. During RSV infection in mice, G protein expression is associated with reduced CD11b+ and NK cell trafficking to the lung, reduced CC and CXC chemokine mRNA expression by pulmonary leukocytes, and reduced Th1- and increased Th2-type intracellular cytokine expression by pulmonary CD3+ T cells (20, 21, 22). The mechanisms that contribute to these effects are not fully understood; however, G protein may modify the response by CX3CR1+ cells by antagonizing the activities of CX3CL1 (5). The cytotoxic cell response to RSV is important in controlling infection. Studies in patients having cellular immune deficiencies have shown that cellular immunity is important in protecting from severe RSV disease and limiting virus shedding (23, 24). Studies in mice have shown that both CD4+ and CD8+ T cells are involved in terminating RSV replication, with CD8+ T cells having a dominant role (25, 26), and that the M2, F, and N proteins are the major targets for CTL (27, 28, 29). A study in mice suggested that RSV suppresses the effector activity of CD8+ T cells and the development of pulmonary CD8+ T cell memory (30), and it was shown that the impaired effector activity could be recovered by IL-2 treatment (31). These findings are consistent with RSV G protein-associated reduction of Th1-type cytokine responses (20).

In this study, we determined the effects of G protein expression or the G protein CX3C motif on CX3CR1+ cell trafficking to the lungs and mediastinal lymph nodes (MLN) of RSV-infected mice, and examined the functionality of CX3CR1+ spleen cells according to IL-4 and CX3CL1 expression; the frequency of RSV-specific, MHC class I-restricted IFN-{gamma}-expressing cells; and the CX3CR1+ cytotoxic response. The results show that G protein and the G protein CX3C motif abate the antiviral response to RSV infection by diminishing the CX3CR1+ cell response.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Viruses

rRSV derived from wild-type strain A2 (WT) and rRSV lacking the G protein gene derived from WT (dG) were gifts of P. Collins (National Institutes of Health, Bethesda, MD). RSV strain A2 point mutant having a CYS->ARG amino acid change at position 186 (dCYS) (32) was a gift of J. Melero (Instituto de Salud, Madrid, Spain). All viruses were propagated in Vero cells maintained in DMEM (Invitrogen Life Technologies) supplemented with 2% heat-inactivated (56°C) FBS (HyClone) until detectable cytopathic effect, i.e., days 5–7 postinfection (p.i.). The viruses were harvested by removal of the medium and replacement with a minimal volume of serum-free DMEM, followed by two freeze thaws at –70°C and 4°C. The contents were collected and centrifuged at 4000 x g for 20 min at 4°C, and the titer was determined by immunostaining plaque assay on Vero cells using mAbs reactive to RSV G (clone 130-2G) and F proteins (clone 131-2A) (22).

Virus infection and cell collection

Four- to 6-wk-old specific pathogen-free female BALB/c mice were purchased from The Jackson Laboratory. The mice were housed in microisolator cages and fed sterilized water and food ad libitum. The mice were intranasally (i.n.) challenged with 5 x 105 PFU of WT, dG, or dCYS viruses diluted in PBS (Invitrogen Life Technologies). At days 0, 6, or 12 p.i., mice were anesthetized and exsanguinated by severing the right caudal artery, and the bronchoalveolar leukocytes (BAL) from 6 to 10 mice/treatment were collected by lavage of the lungs three times with 1 ml of PBS. The MLN and spleen were removed, dissociated into a single cell suspension, washed in PBS containing 1% BSA (Sigma-Aldrich), and resuspended in DMEM (Life Technologies) containing 10% FBS (tissue culture media (TCM); HyClone). No significant differences (p < 0.05) in lung virus titers were detected at day 6 p.i. following infection with WT, dG, or dCYS viruses (range, 600-1100 PFU/g lung tissue), and no virus was detected at day 12 p.i. for any virus infection.

CX3CR1+ cell enrichment

Immunomagnetic separation of CX3CR1+ cells from BAL, MLN, or spleen was performed using sheep anti-rabbit Ab-conjugated Dynabeads (Dynal Biotech) and rabbit anti-mouse CX3CR1 Ab (Cell Sciences), according to the manufacturer’s directions. Briefly, BAL, spleen, or MLN cell suspensions were prepared and incubated with anti-mouse CX3CR1 Ab (4 mg/106 cells) in PBS containing 1% BSA for 45 min at 4°C, washed with PBS containing 1% BSA, and resuspended in TCM. A total of 5 x 106 BAL cells/ml or 1 x 107 MLN or spleen cells/ml was added to Dynabeads (108 beads/ml) previously washed with PBS, and incubated for 45 min at 4°C with gentle rocking. The Dynabead-cell mixture was placed in a Dynal magnetic device for 3 min, and the supernatant containing the CX3CR1 cells was collected. The procedure was repeated three times with the separated cell subpopulations to remove contaminating cells. The Dynabeads were removed from CX3CR1+ cells by resuspending the positively selected cells in TCM, incubating at 37°C for 4 h, placing the mixture in the magnetic device, and collecting the nonmagnetic cells. CX3CR1 or CX3CR1+ cells were separated to ≥95% purity, as determined by flow cytometry using anti-CX3CR1 mAb (clone 2A9-1; MBL) and FITC goat anti-mouse Ab (BD Pharmingen).

To determine the level of CX3CR1 mRNA expressed in CX3CR1+ and CX3CR1 purified cell populations, RT-PCR was performed. RT-PCR products were generated from total RNA isolated from intact mouse spleen cells and CX3CR1+ and CX3CR1 purified cells, and levels of expression were determined using mouse CX3CR1 primers (TTGGAACCATCTTCCTGTCC/ACGCCCAGACTAATGGTGAC) or mouse GAPDH primers (GGGTGGAGCCAACGGGTC/GGAGTTGCTGTTGAAGTCGCA).

Flow cytometry for phenotype analysis and cellular cytotoxicity

The percentage of positive CD3, CD4, CD8, and NK cell subsets was determined for intact BAL, MLN, or SPL cells, and enriched CX3CR1+ or CX3CR1 cells by flow cytometry. Cells were blocked with 10% normal mouse sera (The Jackson Laboratory) in PBS, and then stained with the appropriate combinations of FITC- or PE-labeled anti-CD3 (2C11), anti-CD4 (RM4-5), anti-CD8 (53-6.7), anti-pan NK cell (DX5), mouse isotype Ab control (all from BD Pharmingen), or anti-CX3CR1 mAb (clone 2A9-1; MBL), or rat IgG2b isotype control (clone A905-1; BD Pharmingen), and FITC goat anti-mouse Ab (BD Pharmingen), as previously described (22). Stained cells were analyzed in two-color mode on a FACScan or BD LSR II with CellQuest or FACSDiva software, respectively (BD Biosciences), from >10,000 lymphocyte gated events.

A single cell-based, fluorogenic cytotoxicity assay (CyToxiLux) was used to measure target cell death mediated by cytotoxic cells. This assay has several advantages over traditional cytotoxicity assays (51Cr release), as cytotoxicity is measured by cleavage of a fluorogenic caspase substrate, the assay is rapid, cell death is measured exclusively in the target cell population, and the assay can be combined with phenotypic analysis of effector cytotoxic cells. The assay was performed according to the manufacturer’s instructions. Briefly, four target cell populations were prepared using MHC class I+II, H-2Kd-restricted P815 target cells: 1) uninfected P815 cells, 2) WT virus-infected P815 cells, 3) RSV M2 peptide-sensitized P815 cells, and 4) anti-CD3 Ab-coated P815 cells. WT virus-infected target cells were prepared by infecting P815 cells with WT virus at a multiplicity of infection (MOI) = 1 in serum-free DMEM for 2 h at 37°C. RSV M2 peptide-sensitized target cells were prepared by coincubating P815 cells with an immunodominant Kd-restricted CTL epitope consisting of aa residues 82–90 (SYIGSINNI) in the M protein of RSV (33). Anti-CD3 Ab-coated P815 cells were prepared by coincubating P815 cells with anti-CD3 mAb (2C11; 1 mg/106 cells). The anti-CD3 Ab-coated target cells were used to measure maximal cellular cytotoxicity in a redirected cytolysis assay, which involves cross-linking effector and target cells (34). The four target cell populations were individually labeled with a red spectrum (FL2 channel) proprietary dye (CyToxiLux). Cytotoxic effector cell-to-target cell ratios of 30:1, 15:1, or 7:1 were prepared using labeled target cells in 96-well round-bottom plates (Corning Costar) and incubated for 2.5 h at 37°C, and a proprietary fluorogenic caspase substrate (FL1 channel) was added for 45 min at 37°C. Target cells incubated with the fluorogenic caspase substrate, but without effector cells, were used as a negative control. After incubation, the cells were transferred to flow cytometry tubes and analyzed by flow cytometry (BD Biosciences). Twenty thousand events were collected and analyzed with CellQuest software (BD Biosciences). Cytotoxicity was determined from ungated events by analyzing the upper left quadrant representing viable target cells (FL2+) and the upper right quadrant representing dying/dead (FL1+, FL2+) target cells. The effector cytotoxic cells occupied both the lower left and right quadrants. The percentage of live and dead target cells was calculated as: (upper left quadrant)/(upper left quadrant + upper right quadrant) x 100. For statistical evaluation, a t test for unpaired samples was used comparing cytotoxicity of intact, CX3CR1+, or CX3CR1 cells. Values with p < 0.05 were considered significant.

IFN-{gamma} ELISPOT analysis

Intact leukocytes and CX3CR1+ or CX3CR1 cells were isolated from the spleens of naive, WT, dG, or dCYS virus-infected mice at days 6 or 12 p.i. using rabbit anti-mouse CX3CR1 Ab (Cell Sciences) and magnetic bead separation, according to the manufacturer’s protocol (Dynal Biotech), to >95% purity. The cell populations were cultured in triplicate at 2 x 105 cells/well in multiscreen polyvinylidene difluoride nitrocellulose plates (Millipore) coated with 4 mg/ml anti-mouse IFN-{gamma} Ab (clone R4-6A2; BD Pharmingen). The purity of the CX3CR1-positive or -negative populations was typically ≥95% determined by flow cytometry. Uninfected and WT virus-infected P815 cells (MOI = 1 for 48 h) were mitomycin C inactivated (200 mg/ml for 3 h at 37°C), washed five times in DMEM, resuspended in TCM, and cocultured with the leukocyte populations at 105 cells/well. Control wells contained unstimulated intact, CX3CR1, or CX3CR1+ cells only. The cultures were incubated at 37°C for 48 h, and the cells were removed by 1x washing with PBS, followed by 5x washings with PBS/0.05% Tween 20 (PBS/T). Captured IFN-{gamma}-expressing cells were detected using 1 mg/ml biotinylated anti-mouse IFN-{gamma} mAb (clone AN-18; BD Pharmingen) diluted in PBS/0.5% BSA incubated for 1 h at 37°C. Subsequently, the wells were washed six times with PBS/T, followed by addition of streptavidin-alkaline phosphatase (1/3000; Sigma-Aldrich) diluted in PBS/T/0.5% BSA, and incubation for 1 h at room temperature. Unbound complex was removed by washing six times with PBS/T. Peroxidase staining was performed using Vector Blue substrate (Vector Laboratories) incubated in the wells for 20 min at room temperature, and the reaction was stopped by rinsing the plates under running tap water. ELISPOTs were enumerated using an inverted microscope (Olympus CK-2) at x40. RSV-specific ELISPOT numbers were determined from triplicate wells/cell population by subtracting the mean number of IFN-{gamma} ELISPOTs in cultures stimulated with uninfected P815 cells from the mean number of IFN-{gamma} ELISPOTs in cultures stimulated with WT virus-infected P815 cells. For statistical evaluation, a t test for unpaired samples was used to compare the number of RSV-specific IFN-{gamma} ELISPOTs with the number of IFN-{gamma} ELISPOTs induced by uninfected P815 cells. Values of p < 0.05 were considered significant.

IL-4 and CX3CL1 ELISPOT analysis

Spleen cells were isolated from naive, WT, or dG virus-infected mice at days 6 or 12 p.i., and cultured in triplicate at 1 x 106 cells/well in multiscreen polyvinylidene difluoride nitrocellulose plates (Millipore) coated with 4 mg/ml anti-mouse IL-4 Ab (clone 11B11; BD Pharmingen) or 4 mg/ml anti-mouse CX3CL1 (clone MAB581; R&D Systems). Cells were stimulated with 1000 nM purified, endotoxin-free RSV G protein (5), WT virus (106 PFU), Con A (25 mg/ml; Sigma-Aldrich), cell-free uninfected Vero cell lysate (VCL, 106 PFU equivalent), or medium alone (DMEM + 10% FBS). The cultures were incubated at 37°C for 48 h, and the wells were washed once with PBS, followed by 5x washings with PBS/T. ELISPOTs were enumerated, as described above. Briefly, captured IL-4 was detected with biotinylated anti-mouse IL-4 Ab (clone BVD6-24G2; BD Pharmingen), and captured CX3CL1 was detected with biotinylated anti-mouse CX3CL1 (clone BAF472; R&D Systems). ELISPOTs were enumerated using an inverted microscope (Olympus CK-2) at x40.

Peptide stimulation and IFN-{gamma} analysis

Spleen cells were isolated from mice infected with WT, dG, or dCYS viruses between days 17 and 21 p.i. and dissociated, and 2 x 106 cells were individually stimulated with 10 µM peptides, 1 ng/ml PMA, or TCM for 48 h at 37°C before staining for flow cytometry. The following 12-mer overlapping peptides spanning the G protein CX3C motif (aa positions 182–186) (5) and a G protein CD4+ T cell epitope (aa positions 184–198) (35) were used for in vitro stimulation: 1) VPCSICSNNPTC (pep171–182); 2) TCWAICKRIPNK (underline = CX3C motif; pep181–192); 3) NKKPGKKTTTKP (pep191–202); or 4) SYIGSINNI (an H-2Kd-restricted RSV strain A2 M2 peptide control (36). The percentage of positive CD3+, CD4+, and CD8+ cell subsets was determined following in vitro stimulation by flow cytometry. Cells were blocked with 10% normal mouse sera (The Jackson Laboratory) in PBS, and then stained with the appropriate combinations of FITC- or PE-labeled anti-CD3 (2C11), anti-CD4 (RM4-5), anti-CD8 (53-6.7), or mouse isotype Ab control (all from BD Pharmingen). For intracellular IFN-{gamma} staining, cells were subjected to intracellular cytokine staining using the cytofix/cytoperm kit, according to the manufacturer’s instructions (BD Pharmingen), and PE-labeled anti-IFN-{gamma} (XMG1.2), or with an isotype control Ab (clone R3-43), and analyzed in two-color mode on a BD LSR II with FACSDiva software (BD Biosciences) from 10,000 lymphocyte gated events.

Statistics

For statistical evaluation, a t test for unpaired samples was used: 1) for comparing cytotoxicity of intact, CX3CR1+, or CX3CR1 cells; 2) to compare the number of RSV-specific IFN-{gamma} ELISPOTs with the number of IFN-{gamma} ELISPOTs induced by uninfected P815 cells; and 3) to compare the percentage of cells trafficking to lung or MLN. Values with p < 0.05 were considered significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
CX3CR1 is expressed on CD4+ and CD8+ T cells

In one study of CX3CR1 expression in mice with targeted deletion and GFP reporter gene insertion, i.e., CX3CR1+/GFP mice, it was reported that CX3CR1 expression occurred on peripheral blood monocytes, subsets of NK and dendritic cells, and brain microglia, but not on T cells (37). These results are in conflict with our previous findings showing CX3CR1+ T cell chemotaxis toward fractalkine or G protein by mouse lymphocytes (5). To confirm that murine T cells express CX3CR1, the percentage of CX3CR1+ CD4+ and CD8+ T cells in BAL, MLN, and spleen cells isolated from uninfected and RSV strain A2-infected mice was determined at day 0 or 5 p.i. (Fig. 1). Flow cytometry showed that CD4+ and CD8+ T cells from the BAL, MLN, or spleens of naive and RSV-immune mice express CX3CR1 relative to the rat IgG2b isotype control (clone A905-1; data not shown). The percentage of CX3CR1 expression on naive (A) or RSV-immune (B) CD4+ T cells from BAL ranged between 5 and 8%, and for naive (C) or RSV-immune (D) CD8+ T cells ranged between 6 and 13%. The percentage of CX3CR1+ expression on naive (E) or RSV-immune (F) CD4+ T cells from MLN ranged between 11 and 13%, and the for naive (G) or RSV-immune (H) CD8+ T cells ranged between 4 and 10%. The percentage of CX3CR1+ CD4+ and CD8+ T cells in the MLN was similar to the spleen (data not shown). Similar percentages of CX3CR1+ CD4+ cells were evident in BAL (Fig. 1, A and B) or MLN (Fig. 1, E and F) in naive or RSV-immune mice; however, there were ~50% fewer CX3CR1+ CD8+ cells in the lungs of RSV-immune mice (Fig. 1D) compared with naive mice (Fig. 1C). It is possible that CX3CR1+ CD4 T cell migration appears unaffected by G protein expression at this time point, or that G protein may preferentially inhibit CD8+ T cell trafficking at this time point, because CX3CR1+ cytotoxic cells have been shown to preferentially exhibit chemotaxis toward the CX3C chemokine fractalkine (17). RT-PCR analysis of CX3CR1 mRNA expression in purified CX3CR1+ and CX3CR1 cells indicated that both populations express CX3CR1 mRNA, with the level of CX3CR1 mRNA expression slightly higher in CX3CR1+ cells (data not shown).


Figure 1
View larger version (49K):
[in this window]
[in a new window]
 
FIGURE 1. CD4+ and CD8+ T cells from the lungs or MLN of uninfected and RSV-infected mice express CX3CR1 at day 0 or 5 p.i. Flow cytometry was used to determine the percentage of CD4+ and CD8+ T cells from the lungs (A–D) and MLN (E–H) of naive (A, C, E, and G) or RSV-infected (B, D, F, and H) mice that coexpressed CX3CR1. The percentage of cells costaining positive for CD4+ or CD8+ and CX3CR1+ is indicated in the upper right quadrants of the dot plots.

 
Expression of the G protein or the G protein CX3C motif is associated with reduced numbers of pulmonary CD4+ and CD8+ T cells expressing CX3CR1+

We have previously shown that RSV G protein expression has a marked impact on pulmonary leukocyte trafficking during the primary immune response to RSV infection, and is linked to reduced intracellular Th1-type cytokine expression and CC and CXC chemokine mRNA expression by these cell types (20). DX5+ cells and T cells express CX3CR1 and rely on CX3CL1-CX3CR1 interaction to mediate both cell adhesion and cell migration, and soluble CX3CL1 preferentially induces migration of cytotoxic effector lymphocytes (7, 10, 38). Because the RSV G protein CX3C motif can compete with CX3CL1 for binding to CX3CR1 and modify chemotaxis of CX3CR1+ cells (5), we determined whether G protein expression or the G protein CX3C motif affected CX3CR1+ cells responding to RSV infection (Fig. 2). The total number of CX3CR1+ CD4+ T cells was higher at day 6 or 12 p.i. compared with naive mice for any virus infection (Fig. 2A), and the total number of CX3CR1+ CD4+ and CD8+ T cells was significantly higher (p < 0.05) at day 12 p.i. in mice infected with RSV mutant viruses lacking the G gene (dG) or G protein CX3C motif (dCYS) (Fig. 2, A and B), compared with WT infected mice. The total number of CX3CR1+ CD4+ T cells in the MLN was significantly higher (p < 0.05) at day 6 or 12 p.i. following infection with any virus (Fig. 2C), and total number of CX3CR1+ CD8+ cells was substantially higher in mice infected with any virus compared with naive mice. These results indicate that RSV G protein expression or the G protein CX3C motif reduces CX3CR1+ CD4+ and CD8+ T cell trafficking to the lung at day 12 p.i.


Figure 2
View larger version (35K):
[in this window]
[in a new window]
 
FIGURE 2. Expression of G protein and the G protein CX3C motif is associated with reduced pulmonary trafficking of CD4+ and CD8+ T cells expressing CX3CR1+. Mice were i.n. challenged with 5 x 105 PFU of rRSV derived from WT, rRSV lacking the G protein gene derived from WT (dG), or an RSV strain A2 point mutant having a CYS->ARG amino acid change at position 186 (dCYS) (32 ). At days 6 and 12 p.i., the percentage of CX3CR1+ cells expressing CD4+, CD8+, or DX5+ from the total cell population was determined. CD4+ cells in the BAL (A) or MLN (C), CD8+ cells in the BAL (B) or MLN (D), or DX5+ cells in the BAL (E) or MLN (F) were determined by flow cytometry using ≥10,000 gated (CD4+ and CD8+ cells) or ungated (DX5+ cells) events. The data are presented as the mean ± SE of the total percentage of positive cells/lung (A, B, and E) or total percentage of positive cells/MLN (C, D, and F) from three experiments using three mice/infection/experiment.

 
A higher percentage of CX3CR1+ DX5+ cells trafficked to lungs of dG or dCYS virus-infected mice compared with WT virus-infected mice at day 6 p.i. (Fig. 1E). This finding is consistent with a previous study showing that RSV G protein expression is associated with reduced numbers of DX5+ BAL cells in WT virus-infected mice compared with mice infected with an RSV mutant lacking the G and SH genes (22). No significant difference in the percentage of CX3CR1+ DX5+ cells in the MLN was evident following infection with any virus (Fig. 2F); however, there was a trend toward increased DX5+ cells in virally infected mice compared with naive mice.

Expression of G protein or the G protein CX3C motif is associated with reduced frequencies of RSV-specific CX3CR1+ cells expressing IFN-{gamma}

To determine whether expression of G protein or the G protein CX3C motif affected the antiviral response linked to IFN-{gamma} expression, the frequencies of MHC class I-restricted, RSV-specific IFN-{gamma}-expressing cells (IFN-{gamma} ELISPOTs) were determined for intact and CX3CR1+- or CX3CR1-enriched spleen cells from naive, WT, dG, or dCYS virus-infected mice (Fig. 3). The frequency of RSV-specific IFN-{gamma} ELISPOTs was determined by in vitro stimulation with MHC class I+II P815 cells infected with WT virus (+) (MOI = 1) or with uninfected P815 cells (–). At days 6 and 12 p.i., the frequency of IFN-{gamma} ELISPOTs was significantly higher (p < 0.05) for RSV-stimulated intact CX3CR1+ cells compared with intact unstimulated CX3CR1+ cells, and no substantial IFN-{gamma} response was detected for CX3CR1 cells. The frequency of RSV-specific IFN-{gamma} ELISPOTs was higher in CX3CR1+ cells from dG and dCYS virus-infected mice at days 6 and 12 p.i. compared with CX3CR1+ cells from WT virus-infected mice. These results suggest that expression of G protein or the G protein CX3C motif reduces the frequency of RSV-specific IFN-{gamma}-responding cells during primary RSV infection. It is possible that stimulation in the presence of G protein or the G protein motif may impede IFN-{gamma} expression, as G protein expression has been linked to modified cytokine and chemokine expression (20, 21, 22). Further study is needed to determine whether this effect is related to cell trafficking or alteration of cytokine regulation.


Figure 3
View larger version (31K):
[in this window]
[in a new window]
 
FIGURE 3. Expression of G protein or the G protein CX3C motif is associated with reduced frequencies of RSV-specific CX3CR1+ cells expressing IFN-{gamma}. Mice were i.n. challenged with 5 x 105 PFU WT, dG, or dCYS virus. At days 6 p.i. (A) and 12 p.i. (B), the frequency of IFN-{gamma} ELISPOTs in CX3CR1+, CX3CR1, or intact cells was determined following stimulation with WT virus-infected, MHC class I+II P815 cells (+) or uninfected P815 cells (–) using ELISPOT analysis. Data are presented as the mean ± SD determined from three experiments using three mice/infection/experiment.

 
IFN-{gamma} response by CD4+ T cells following peptide stimulation

The RSV G protein contains a single region comprising aa 184–198 that induce both Th1- and Th2-type CD4+ T cell response (35) with a single I-Ed-restricted CD4+ T cell epitope mapping to aa 185–193 (39). To determine whether differences in IFN-{gamma} expression by RSV-specific CX3CR1+ cells were associated with loss of the CD4+ T cell epitope in dG or dCYS viruses, the IFN-{gamma} response by CD4+ and CD8+ T cells from the spleen of WT, dG, or dCYS virus-infected mice was determined following in vitro stimulation with 12-mer overlapping peptides spanning the G protein CX3C motif (aa positions 182–186) and the G protein CD4+ T cell epitope (aa positions 184–198). Spleen cells were stimulated with VPCSICSNNPTC (pep171–182), TCWAICKRIPNK (pep181–192), NKKPGKKTTTKP (pep191–202), an H-2Kd-restricted control M2 peptide (SYIGSINNI) (40), PMA, or TCM alone, and the level of intracellular IFN-{gamma} was determined (Fig. 4). As expected, stimulation with TCM had no effect, PMA stimulated IFN-{gamma} expression by CD4+ and CD8+ T cells, and CD8+ T cells expressed substantial IFN-{gamma} following M2 peptide stimulation (Fig. 4A). Notably, CD4+ T cells from the spleens of WT, dG, or dCYS virus-infected mice expressed similar levels of IFN-{gamma} following stimulation with pep171–182, pep181–192, or pep191–202 (Fig. 4B), suggesting that the disruption of the CD4+ T cell epitope in dG or dCYS virus-infected mice does not fully account for the nature of the pulmonary immune response to dG and dCYS viruses characterized by pulmonary trafficking of CX3CR1+ cells (Figs. 1 and 2) and increased frequencies of RSV-specific IFN-{gamma} ELISPOTs by CX3CR1+ cells (Fig. 3).


Figure 4
View larger version (32K):
[in this window]
[in a new window]
 
FIGURE 4. Differences in IFN-{gamma} expression by RSV-specific CX3CR1+ cells are not associated with loss of a CD4+ T cell epitope in dG or dCYS viruses. The percentage of IFN-{gamma} expression by CD4+ or CD8+ T cells from the spleens of WT, dG, or dCYS virus-infected mice was determined following in vitro stimulation with 12-mer overlapping peptides spanning the G protein CX3C motif and the G protein CD4+ T cell epitope (aa positions 184–198). Cells were stimulated with 10 µM peptides VPCSICSNNPTC (pep171–182), TCWAICKRIPNK (pep181–192), or NKKPGKKTTTKP (pep191–202) (B) or an H-2Kd-restricted control M2 peptide (SYIGSINNI) (A) (40 ), with 1 ng/ml PMA or TCM for 48 h at 37°C before staining for flow cytometry. Data are presented as the mean ± SD determined from three experiments using three mice/infection/experiment.

 
CX3CR1+ cells are a principal cytotoxic population

CX3CR1+ cells had the highest frequency of class I-restricted, RSV-specific IFN-{gamma} ELISPOTs (Fig. 3), suggesting that this population may represent a major cytotoxic component responding to RSV infection. To evaluate this possibility, the cytotoxic response by CX3CR1+ and CX3CR1 BAL cells (Fig. 5) and spleen cells (Fig. 6) from WT virus-infected mice was determined. The target cells included MHC class I+II P815 cells infected with WT virus (MOI = 1), RSV M2 peptide-pulsed targets, P815 cells treated with anti-CD3 Ab, or uninfected P815 cells. CX3CR1+ BAL cells isolated from mice at day 6 (Fig. 5A) or day 12 (Fig. 5C) p.i. were cytotoxic for WT virus-infected P815 target cells (RSV), RSV M2 peptide-pulsed P815 cells (M2 peptide), and P815 cells treated with anti-CD3 Ab to measure redirected cytolysis (anti-CD3), but were not cytotoxic for uninfected P815 cells (uninfected). The highest level of cytotoxicity by CX3CR1+ BAL cells was at day 6 p.i. (Fig. 5A); however, substantial cytotoxicity was also observed at day 12 p.i. (Fig. 5C), a time at which RSV is cleared in the lungs (20, 22). Similar levels of cytotoxicity and target cell specificity were observed for intact unseparated BAL cells (data not shown). No substantial RSV-specific cytotoxic response was detected by CX3CR1 BAL cells at day 6 p.i. (Fig. 5B) or day 12 p.i. (Fig. 5D), and only a weak cytotoxic response was detected at day 6 p.i. by redirected cytolysis of anti-CD3-treated P815 cells, suggesting that CX3CR1+ cells are a principal cytotoxic population in the lung.


Figure 5
View larger version (27K):
[in this window]
[in a new window]
 
FIGURE 5. CX3CR1+ cells are a principal cytotoxic population in the lung. Mice were i.n. challenged with 5 x 105 PFU WT virus at day 6 p.i. (A and B) or day 12 p.i. (C and D). The cytotoxic response of CX3CR1+ (A and C) or CX3CR1 (B and D) BAL cells was determined to RSV-infected, MHC class I+II P815 cells (RSV), M2 peptide-pulsed P815 cells (M2 peptide), anti-CD3 Ab-coated P815 cells (anti-CD3), and uninfected, untreated P815 cells (uninfected) using a caspase-based fluorogenic cytotoxicity assay and flow cytometry. The percentage of specific lysis was calculated from the number of viable target cells over the number of viable and dead or dying target cells x 100. Data are presented as the mean ± SD determined from four experiments using three mice/infection/experiment.

 

Figure 6
View larger version (29K):
[in this window]
[in a new window]
 
FIGURE 6. Both CX3CR1+ and CX3CR1 cells are cytotoxic in the spleen. Mice were i.n. challenged with 5 x 105 PFU WT virus, and at day 6 p.i. (A and B) or day 12 p.i. (C and D). The cytotoxic response of CX3CR1+ (A and C) and CX3CR1 (B and D) spleen cells to WT virus-infected, MHC class I+II P815 cells (RSV), M2 peptide-pulsed P815 cells (M2 peptide), anti-CD3 Ab-coated P815 cells (anti-CD3), and uninfected, untreated P815 cells (uninfected) was determined using a caspase-based fluorogenic cytotoxicity assay and flow cytometry. The percentage of specific lysis was calculated from the number of viable target cells over the number of viable and dead or dying target cells x 100. Data are presented as the mean ± SD determined from three experiments using three mice/infection/experiment.

 
Similarly, CX3CR1+ and CX3CR1 spleen cells from WT virus-infected mice were examined for their cytotoxic response (Fig. 6). At days 6 and 12 p.i., cytotoxic cells were present in CX3CR1+ and CX3CR1 cell populations, as indicated by redirected cytolysis of anti-CD3-treated P815 cells; however, no substantial RSV-specific cytotoxic response was detected for CX3CR1+ or CX3CR1 cells at day 6 p.i. (Fig. 6, A and B, respectively). Distinct from the cytotoxic response by BAL cells (Fig. 5), CX3CR1+ and CX3CR1 spleen cells were cytotoxic for WT virus-infected and M2 peptide-pulsed P815 target cells at day 12 p.i. (Fig. 6, A and B, respectively), although CX3CR1+ cells mediated a slightly higher response. The difference in the cytotoxic response by CX3CR1+ and CX3CR1 cells from the BAL and spleen suggests that CX3CR1+ cytotoxic cells may be preferentially recruited to the lung during RSV infection.

IL-4 and CX3CL1 ELISPOTs associated with G protein expression

The lower frequencies of IFN-{gamma} ELISPOTs in intact and CX3CR1+ cells from WT infected mice compared with dG- or dCYS-infected mice suggest that G protein expression or the G protein CX3C motif reduces the antiviral response linked to IFN-{gamma} expression (Fig. 3). To determine whether G protein expression affected the frequencies of cells expressing IL-4 or CX3CL1 ELISPOTs, spleen cells from naive, WT, or dG virus-infected mice at days 6 or 12 p.i. were stimulated through in vitro stimulation with purified G protein (G, 1000 nM), WT virus (RSV, 106 PFU/ml), Con A (25 mg/ml), cell-free uninfected VCL (106 PFU/ml equivalent), or medium alone (Fig. 7). A high level of IL-4 ELISPOTs was evident at day 6 p.i. (Fig. 7A) and day 12 p.i. (Fig. 7B) in cells from naive, WT, or dG virus-infected mice stimulated in vitro with G, RSV, or Con A compared with VCL or medium cultures. There was a trend toward higher frequencies of IL-4 ELISPOTs in cells from WT virus-infected mice stimulated with G or RSV at days 6 or 12 p.i. compared with similarly treated dG cells, and a significant difference (p < 0.05) in higher IL-4 ELISPOTs from WT cells stimulated with G compared with dG cells at day 12 p.i. (Fig. 7B). Interestingly, naive cells stimulated with G, RSV, or Con A expressed similarly high levels of IL-4 ELISPOTs at days 6 and 12 p.i., and few IL-4 ELISPOTs following stimulation with VCL or medium, suggesting that RSV or soluble G protein may directly induce Th2-type cytokine expression.


Figure 7
View larger version (47K):
[in this window]
[in a new window]
 
FIGURE 7. G protein affects the number of IL-4- and CX3CL1-expressing cells. Mice were i.n. challenged with 5 x 105 PFU of WT or dG virus. At days 6 p.i. (A and C) and 12 p.i. (B and D), spleen cells were stimulated in vitro with purified G protein (G, 1000 nM), WT virus (RSV, 106 PFU), Con A (25 mg/ml), cell-free uninfected VCL (106 PFU equivalent), or medium alone, and the number of IL-4 (A and B)- or CX3CL1 (C and D)-expressing cells (ELISPOTs) was determined. The data are presented as the mean ± SD of the number of ELISPOTs/106 spleen cells from three experiments using three mice/infection/experiment.

 
A high level of CX3CL1 ELISPOTs was detected at day 6 p.i. (Fig. 7C) and day 12 p.i. (Fig. 7D) in cells from naive, WT, or dG virus-infected mice stimulated in vitro with G, RSV, or Con A compared with VCL or medium cultures. There was a trend toward higher CX3CL1 ELISPOTs in dG cells stimulated with G or RSV compared with similarly treated WT cells at day 6 p.i., and significantly higher (p < 0.05) CX3CL1 ELISPOTs from dG cells stimulated with G compared with WT cells at day 12 p.i. (Fig. 7D). As was observed for IL-4 ELISPOTs (Fig. 7, A and B), naive cells stimulated with G, RSV, or Con A expressed high levels of CX3CL1 ELISPOTs at days 6 and 12 p.i., but fewer CX3CL1 ELISPOTs following stimulation with VCL or medium. These results suggest that G protein expression during RSV infection may directly increase the frequency of IL-4 or CX3CL1 ELISPOTs in naive cells, an effect that may modify cell activation and recruitment of the Th1/Th2 cell repertoire.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
In this study, we show that expression of G protein or the G protein CX3C motif during RSV infection is associated with reduced pulmonary trafficking of CX3CR1+ cells; a lower frequency of RSV-specific, MHC class I-restricted IFN-{gamma} ELISPOTs; and increased number of IL-4 ELISPOTs and reduced number of CX3CL1 ELISPOTs. In addition, we show that CX3CR1+ cells are an important cytotoxic population in the lungs of mice infected with RSV, and that CX3CR1+ cells mediate RSV-specific cytotoxicity toward RSV-infected target cells and target cells expressing an immunodominant Kd-restricted RSV M2 peptide. These results are consistent with our previous findings showing G protein CX3C chemokine mimicry and impairment of CX3CL1-mediated responses (5), and G protein-associated reduction of pulmonary immune cell trafficking and exaggerated Th2-type cytokine expression by pulmonary leukocytes in RSV-infected mice (22), supporting the hypothesis that one ancillary function of G protein expression may be to modify the CX3CR1+ cellular immune response to RSV infection.

In this study, lower numbers of CD4+, CD8+, and DX5+ cells coexpressing CX3CR1+ were associated with WT virus infection compared with dG or dCYS virus-infected mice. Previous studies have shown that the G protein can perturb the composition of the T cell compartment and drive Th2-type cytokine expression (20, 41, 42, 43, 44). In this study, G protein expression or the G protein CX3C motif was associated with decreased frequencies of RSV-specific IFN-{gamma} ELISPOTs and increased numbers of IL-4 ELISPOTs. In addition, RSV or G protein stimulation of naive spleen cells induced substantial numbers of IL-4 and CX3CL1 ELISPOTs, suggesting that G protein expression during RSV infection may directly influence the cytokine or chemokine profile. The mechanism(s) contributing to this activity is unknown, but may be associated with signals mediated by G protein heparin binding domain interaction with cell surface glycosaminoglycans (45, 46), and/or G protein CX3C-CX3CR1 interaction (5), as heparin binding domain-glycosaminoglycans interactions at the cell surface and in the extracellular matrix are known to activate cell function and cytokine and chemokine expression (47).

The lower frequency of RSV-specific, MHC class I-restricted IFN-{gamma} ELISPOTs in cells from WT compared with dG- or dCYS-infected mice is suggestive that the CD8+ T cell response is modified by expression of G protein or the G protein CX3C motif. These findings are important, as RSV-specific CD8+ T cells regulate the Th2-type CD4+ T cell response that is linked to altered immunity and disease pathogenesis (48), and RSV-specific CD8+ T cells are important in virus clearance (49, 50). Because CX3CR1+ cytotoxic cells possess high levels of perforin and granzyme B and preferentially exhibit chemotaxis toward CX3CL1 (17), it is possible that G protein alters CX3CL1-CX3CR1 interaction affecting activation and trafficking of CX3CR1+ CD8+ T cells.

Several aspects of T cell immunity are contingent on CX3CR1 expression, as CX3CR1 is both a chemotactic and adhesion receptor for CX3CL1, and CX3CR1 participates in the regulation of T cell function (9). CX3CR1 has been shown to define peripheral blood cytotoxic effector lymphocytes and terminally differentiated CD8+ T cells (17), and CX3CR1+ T cells coexpress CCR5 and CXCR3 chemokine receptors known to be highly selective for Th1 cells (10).

The results of this study show RSV G protein and G protein CX3C motif affect the CX3CR1+ T cell response, and suggest that G protein expression during RSV infection may have the adjunct property of reducing the antiviral response to promote RSV infection or replication.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Address correspondence and reprint requests to Dr. Ralph A. Tripp, Center for Disease Intervention, Department of Infectious Diseases, College of Veterinary Medicine, University of Georgia, Athens, GA 30602. E-mail address: rtripp{at}vet.uga.edu Back

2 Abbreviations used in this paper: RSV, respiratory syncytial virus; BAL, bronchoalveolar leukocyte; i.n., intranasal; MLN, mediastinal lymph node; MOI, multiplicity of infection; p.i., postinfection; TCM, tissue culture media; VCL, Vero cell lysate; WT, wild type. Back

Received for publication July 19, 2005. Accepted for publication November 14, 2005.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Ogra, P. L.. 2004. Respiratory syncytial virus: the virus, the disease and the immune response. Paediatr. Respir. Rev. 5: (Suppl. A):S119-S126.
  2. Falsey, A. R., P. A. Hennessey, M. A. Formica, C. Cox, E. E. Walsh. 2005. Respiratory syncytial virus infection in elderly and high-risk adults. N. Engl. J. Med. 352: 1749-1759. [Abstract/Free Full Text]
  3. Ebbert, J. O., A. H. Limper. 2005. Respiratory syncytial virus pneumonitis in immunocompromised adults: clinical features and outcome. Respiration 72: 263-269. [Medline]
  4. Karron, R. A., D. A. Buonagurio, A. F. Georgiu, S. S. Whitehead, J. E. Adamus, M. L. Clements-Mann, D. O. Harris, V. B. Randolph, S. A. Udem, B. R. Murphy, M. S. Sidhu. 1997. Respiratory syncytial virus (RSV) SH and G proteins are not essential for viral replication in vitro: clinical evaluation and molecular characterization of a cold-passaged, attenuated RSV subgroup B mutant. Proc. Natl. Acad. Sci. USA 94: 13961-13966. [Abstract/Free Full Text]
  5. Tripp, R. A., L. P. Jones, L. M. Haynes, H. Zheng, P. M. Murphy, L. J. Anderson. 2001. CX3C chemokine mimicry by respiratory syncytial virus G glycoprotein. Nat. Immunol. 2: 732-738. [Medline]
  6. Fong, A. M., L. A. Robinson, D. A. Steeber, T. F. Tedder, O. Yoshie, T. Imai, D. D. Patel. 1998. Fractalkine and CX3CR1 mediate a novel mechanism of leukocyte capture, firm adhesion, and activation under physiologic flow. J. Exp. Med. 188: 1413-1419. [Abstract/Free Full Text]
  7. Stievano, L., E. Piovan, A. Amadori. 2004. C and CX3C chemokines: cell sources and physiopathological implications. Crit. Rev. Immunol. 24: 205-228. [Medline]
  8. Haskell, C. A., M. D. Cleary, I. F. Charo. 1999. Molecular uncoupling of fractalkine-mediated cell adhesion and signal transduction: rapid flow arrest of CX3CR1-expressing cells is independent of G-protein activation. J. Biol. Chem. 274: 10053-10058. [Abstract/Free Full Text]
  9. Imai, T., K. Hieshima, C. Haskell, M. Baba, M. Nagira, M. Nishimura, M. Kakizaki, S. Takagi, H. Nomiyama, T. J. Schall, O. Yoshie. 1997. Identification and molecular characterization of fractalkine receptor CX3CR1, which mediates both leukocyte migration and adhesion. Cell 91: 521-530. [Medline]
  10. Fraticelli, P., M. Sironi, G. Bianchi, D. D’Ambrosio, C. Albanesi, A. Stoppacciaro, M. Chieppa, P. Allavena, L. Ruco, G. Girolomoni, et al 2001. Fractalkine (CX3CL1) as an amplification circuit of polarized Th1 responses. J. Clin. Invest. 107: 1173-1181. [Medline]
  11. Fujimoto, K., T. Imaizumi, H. Yoshida, S. Takanashi, K. Okumura, K. Satoh. 2001. Interferon-{gamma} stimulates fractalkine expression in human bronchial epithelial cells and regulates mononuclear cell adherence. Am. J. Respir. Cell Mol. Biol. 25: 233-238. [Abstract/Free Full Text]
  12. Imaizumi, T., T. Matsumiya, K. Fujimoto, K. Okamoto, X. Cui, U. Ohtaki, H. Yoshida, K. Satoh. 2000. Interferon-{gamma} stimulates the expression of CX3CL1/fractalkine in cultured human endothelial cells. Tohoku J. Exp. Med. 192: 127-139. [Medline]
  13. Lucas, A. D., N. Chadwick, B. F. Warren, D. P. Jewell, S. Gordon, F. Powrie, D. R. Greaves. 2001. The transmembrane form of the CX3CL1 chemokine fractalkine is expressed predominantly by epithelial cells in vivo. Am. J. Pathol. 158: 855-866. [Abstract/Free Full Text]
  14. Robinson, L. A., C. Nataraj, D. W. Thomas, D. N. Howell, R. Griffiths, V. Bautch, D. D. Patel, L. Feng, T. M. Coffman. 2000. A role for fractalkine and its receptor (CX3CR1) in cardiac allograft rejection. J. Immunol. 165: 6067-6072. [Abstract/Free Full Text]
  15. Feng, L., S. Chen, G. E. Garcia, Y. Xia, M. A. Siani, P. Botti, C. B. Wilson, J. K. Harrison, K. B. Bacon. 1999. Prevention of crescentic glomerulonephritis by immunoneutralization of the fractalkine receptor CX3CR1 rapid communication. Kidney Int. 56: 612-620. [Medline]
  16. Haynes, L. M., L. P. Jones, A. Barskey, L. J. Anderson, R. A. Tripp. 2003. Enhanced disease and pulmonary eosinophilia associated with Formalin-inactivated respiratory syncytial virus vaccination are linked to G glycoprotein CX3C-CX3CR1 interaction and expression of substance P. J. Virol. 77: 9831-9844. [Abstract/Free Full Text]
  17. Nishimura, M., H. Umehara, T. Nakayama, O. Yoneda, K. Hieshima, M. Kakizaki, N. Dohmae, O. Yoshie, T. Imai. 2002. Dual functions of fractalkine/CX3C ligand 1 in trafficking of perforin+/granzyme B+ cytotoxic effector lymphocytes that are defined by CX3CR1 expression. J. Immunol. 168: 6173-6180. [Abstract/Free Full Text]
  18. Campbell, J. J., S. Qin, D. Unutmaz, D. Soler, K. E. Murphy, M. R. Hodge, L. Wu, E. C. Butcher. 2001. Unique subpopulations of CD56+ NK and NK-T peripheral blood lymphocytes identified by chemokine receptor expression repertoire. J. Immunol. 166: 6477-6482. [Abstract/Free Full Text]
  19. Yoneda, O., T. Imai, S. Goda, H. Inoue, A. Yamauchi, T. Okazaki, H. Imai, O. Yoshie, E. T. Bloom, N. Domae, H. Umehara. 2000. Fractalkine-mediated endothelial cell injury by NK cells. J. Immunol. 164: 4055-4062. [Abstract/Free Full Text]
  20. Tripp, R. A.. 2004. Pathogenesis of respiratory syncytial virus infection. Viral Immunol. 17: 165-181. [Medline]
  21. Tripp, R. A., L. Jones, L. J. Anderson. 2000. Respiratory syncytial virus G and/or SH glycoproteins modify CC and CXC chemokine mRNA expression in the BALB/c mouse. J. Virol. 74: 6227-6229. [Abstract/Free Full Text]
  22. Tripp, R. A., D. Moore, L. Jones, W. Sullender, J. Winter, L. J. Anderson. 1999. Respiratory syncytial virus G and/or SH protein alters Th1 cytokines, natural killer cells, and neutrophils responding to pulmonary infection in BALB/c mice. J. Virol. 73: 7099-7107. [Abstract/Free Full Text]
  23. Chandwani, S., W. Borkowsky, K. Krasinski, R. Lawrence, R. Welliver. 1990. Respiratory syncytial virus infection in human immunodeficiency virus-infected children. J. Pediatr. 117: 251-254. [Medline]
  24. Fishaut, M., D. Tubergen, K. McIntosh. 1980. Cellular response to respiratory viruses with particular reference to children with disorders of cell-mediated immunity. J. Pediatr. 96: 179-186. [Medline]
  25. Varga, S. M., T. J. Braciale. 2002. RSV-induced immunopathology: dynamic interplay between the virus and host immune response. Virology 295: 203-207. [Medline]
  26. Graham, B. S., J. A. Rutigliano, T. R. Johnson. 2002. Respiratory syncytial virus immunobiology and pathogenesis. Virology 297: 1-7. [Medline]
  27. Openshaw, P. J., K. Anderson, G. W. Wertz, B. A. Askonas. 1990. The 22,000-kilodalton protein of respiratory syncytial virus is a major target for Kd-restricted cytotoxic T lymphocytes from mice primed by infection. J. Virol. 64: 1683-1689. [Abstract/Free Full Text]
  28. Nicholas, J. A., K. L. Rubino, M. E. Levely, E. G. Adams, P. L. Collins. 1990. Cytolytic T-lymphocyte responses to respiratory syncytial virus: effector cell phenotype and target proteins. J. Virol. 64: 4232-4241. [Abstract/Free Full Text]
  29. Openshaw, P. J.. 1995. Immunopathological mechanisms in respiratory syncytial virus disease. Springer Semin. Immunopathol. 17: 187-201. [Medline]
  30. Chang, J., T. J. Braciale. 2002. Respiratory syncytial virus infection suppresses lung CD8+ T-cell effector activity and peripheral CD8+ T-cell memory in the respiratory tract. Nat. Med. 8: 54-60. [Medline]
  31. Chang, J., S. Y. Choi, H. T. Jin, Y. C. Sung, T. J. Braciale. 2004. Improved effector activity and memory CD8 T cell development by IL-2 expression during experimental respiratory syncytial virus infection. J. Immunol. 172: 503-508. [Abstract/Free Full Text]
  32. Rueda, P., B. Garcia-Barreno, J. A. Melero. 1994. Loss of conserved cysteine residues in the attachment (G) glycoprotein of two human respiratory syncytial virus escape mutants that contain multiple A-G substitutions (hypermutations). Virology 198: 653-662. [Medline]
  33. Kulkarni, A. B., P. L. Collins, I. Bacik, J. W. Yewdell, J. R. Bennink, J. E. Crowe, Jr, B. R. Murphy. 1995. Cytotoxic T cells specific for a single peptide on the M2 protein of respiratory syncytial virus are the sole mediators of resistance induced by immunization with M2 encoded by a recombinant vaccinia virus. J. Virol. 69: 1261-1264. [Abstract]
  34. Lake, J. P., C. W. Pierce, J. D. Kennedy. 1991. CD8+ {alpha}/beta or {gamma}/{delta} T cell receptor-bearing T cells from athymic nude mice are cytolytically active in vivo. J. Immunol. 147: 1121-1126. [Abstract]
  35. Tebbey, P. W., M. Hagen, G. E. Hancock. 1998. Atypical pulmonary eosinophilia is mediated by a specific amino acid sequence of the attachment (G) protein of respiratory syncytial virus. J. Exp. Med. 188: 1967-1972. [Abstract/Free Full Text]
  36. Kulkarni, A. B., H. C. Morse, III, J. R. Bennink, J. W. Yewdell, B. R. Murphy. 1993. Immunization of mice with vaccinia virus-M2 recombinant induces epitope-specific and cross-reactive Kd-restricted CD8+ cytotoxic T cells. J. Virol. 67: 4086-4092. [Abstract/Free Full Text]
  37. Jung, S., J. Aliberti, P. Graemmel, M. J. Sunshine, G. W. Kreutzberg, A. Sher, D. R. Littman. 2000. Analysis of fractalkine receptor CX(3)CR1 function by targeted deletion and green fluorescent protein reporter gene insertion. Mol. Cell. Biol. 20: 4106-4111. [Abstract/Free Full Text]
  38. Morris, M. A., K. Ley. 2004. Trafficking of natural killer cells. Curr. Mol. Med. 4: 431-438. [Medline]
  39. Varga, S. M., E. L. Wissinger, T. J. Braciale. 2000. The attachment (G) glycoprotein of respiratory syncytial virus contains a single immunodominant epitope that elicits both Th1 and Th2 CD4+ T cell responses. J. Immunol. 165: 6487-6495. [Abstract/Free Full Text]
  40. Connors, M., A. B. Kulkarni, P. L. Collins, C. Y. Firestone, K. L. Holmes, H. C. Morse, III, B. R. Murphy. 1992. Resistance to respiratory syncytial virus (RSV) challenge induced by infection with a vaccinia virus recombinant expressing the RSV M2 protein (Vac-M2) is mediated by CD8+ T cells, while that induced by Vac-F or Vac-G recombinants is mediated by antibodies. J. Virol. 66: 1277-1281. [Abstract/Free Full Text]
  41. Srikiatkhachorn, A., T. J. Braciale. 1997. Virus-specific memory and effector T lymphocytes exhibit different cytokine responses to antigens during experimental murine respiratory syncytial virus infection. J. Virol. 71: 678-685. [Abstract]
  42. Hussell, T., C. J. Baldwin, A. O’Garra, P. J. Openshaw. 1997. CD8+ T cells control Th2-driven pathology during pulmonary respiratory syncytial virus infection. Eur. J. Immunol. 27: 3341-3349. [Medline]
  43. Johnson, T. R., B. S. Graham. 1999. Secreted respiratory syncytial virus G glycoprotein induces interleukin-5 (IL-5), IL-13, and eosinophilia by an IL-4-independent mechanism. J. Virol. 73: 8485-8495. [Abstract/Free Full Text]
  44. Graham, B. S., T. R. Johnson, R. S. Peebles. 2000. Immune-mediated disease pathogenesis in respiratory syncytial virus infection. Immunopharmacology 48: 237-247. [Medline]
  45. Krusat, T., H. J. Streckert. 1997. Heparin-dependent attachment of respiratory syncytial virus (RSV) to host cells. Arch. Virol. 142: 1247-1254. [Medline]
  46. Feldman, S. A., R. M. Hendry, J. A. Beeler. 1999. Identification of a linear heparin binding domain for human respiratory syncytial virus attachment glycoprotein G. J. Virol. 73: 6610-6617. [Abstract/Free Full Text]
  47. McFadden, G., D. Kelvin. 1997. New strategies for chemokine inhibition and modulation: you take the high road and I’ll take the low road. Biochem. Pharmacol. 54: 1271-1280. [Medline]
  48. Srikiatkhachorn, A., T. J. Braciale. 1997. Virus-specific CD8+ T lymphocytes down-regulate T helper cell type 2 cytokine secretion and pulmonary eosinophilia during experimental murine respiratory syncytial virus infection. J. Exp. Med. 186: 421-432. [Abstract/Free Full Text]
  49. Cannon, M. J., P. J. Openshaw, B. A. Askonas. 1988. Cytotoxic T cells clear virus but augment lung pathology in mice infected with respiratory syncytial virus. J. Exp. Med. 168: 1163-1168. [Abstract/Free Full Text]
  50. Graham, B. S., L. A. Bunton, P. F. Wright, D. T. Karzon. 1991. Role of T lymphocyte subsets in the pathogenesis of primary infection and rechallenge with respiratory syncytial virus in mice. J. Clin. Invest. 88: 1026-1033. [Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
E. J. Collarini, F. E.-H. Lee, O. Foord, M. Park, G. Sperinde, H. Wu, W. D. Harriman, S. F. Carroll, S. L. Ellsworth, L. J. Anderson, et al.
Potent High-Affinity Antibodies for Treatment and Prophylaxis of Respiratory Syncytial Virus Derived from B Cells of Infected Patients
J. Immunol., November 15, 2009; 183(10): 6338 - 6345.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
Y. Liu, D. L. Haas, S. Poore, S. Isakovic, M. Gahan, S. Mahalingam, Z. F. Fu, and R. A. Tripp
Human Metapneumovirus Establishes Persistent Infection in the Lungs of Mice and Is Reactivated by Glucocorticoid Treatment
J. Virol., July 1, 2009; 83(13): 6837 - 6848.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
M. L. Moore, M. H. Chi, C. Luongo, N. W. Lukacs, V. V. Polosukhin, M. M. Huckabee, D. C. Newcomb, U. J. Buchholz, J. E. Crowe Jr., K. Goleniewska, et al.
A Chimeric A2 Strain of Respiratory Syncytial Virus (RSV) with the Fusion Protein of RSV Strain Line 19 Exhibits Enhanced Viral Load, Mucus, and Airway Dysfunction
J. Virol., May 1, 2009; 83(9): 4185 - 4194.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
C. Miao, G. U. Radu, H. Caidi, R. A. Tripp, L. J. Anderson, and L. M. Haynes
Treatment with respiratory syncytial virus G glycoprotein monoclonal antibody or F(ab')2 components mediates reduced pulmonary inflammation in mice
J. Gen. Virol., May 1, 2009; 90(5): 1119 - 1123.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
W. Zhang and R. A. Tripp
RNA Interference Inhibits Respiratory Syncytial Virus Replication and Disease Pathogenesis without Inhibiting Priming of the Memory Immune Response
J. Virol., December 15, 2008; 82(24): 12221 - 12231.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
A. Bukreyev, L. Yang, J. Fricke, L. Cheng, J. M. Ward, B. R. Murphy, and P. L. Collins
The Secreted Form of Respiratory Syncytial Virus G Glycoprotein Helps the Virus Evade Antibody-Mediated Restriction of Replication by Acting as an Antigen Decoy and through Effects on Fc Receptor-Bearing Leukocytes
J. Virol., December 15, 2008; 82(24): 12191 - 12204.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. R. Pallandre, K. Krzewski, R. Bedel, B. Ryffel, A. Caignard, P. S. Rohrlich, X. Pivot, P. Tiberghien, L. Zitvogel, J. L. Strominger, et al.
Dendritic cell and natural killer cell cross-talk: a pivotal role of CX3CL1 in NK cytoskeleton organization and activation
Blood, December 1, 2008; 112(12): 4420 - 4424.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
S. Munir, C. Le Nouen, C. Luongo, U. J. Buchholz, P. L. Collins, and A. Bukreyev
Nonstructural Proteins 1 and 2 of Respiratory Syncytial Virus Suppress Maturation of Human Dendritic Cells
J. Virol., September 1, 2008; 82(17): 8780 - 8796.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
T. M. Ward, V. Traina-Dorge, K. A. Davis, and W. L. Gray
Recombinant simian varicella viruses expressing respiratory syncytial virus antigens are immunogenic
J. Gen. Virol., March 1, 2008; 89(3): 741 - 750.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
P. L. Collins and B. S. Graham
Viral and Host Factors in Human Respiratory Syncytial Virus Pathogenesis
J. Virol., March 1, 2008; 82(5): 2040 - 2055.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Harcourt, J.
Right arrow Articles by Tripp, R. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Harcourt, J.
Right arrow Articles by Tripp, R. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS