|
|
||||||||



* Medical Research Council Human Immunology Unit, Weatherall Institute of Molecular Medicine, Oxford, United Kingdom;
Medical Research Council Rosalind Franklin Centre for Genomics Research, Wellcome Trust Genome Campus, Hinxton, Cambridge, United Kingdom;
The Neonatal Unit, Womens Centre, John Radcliffe Hospital, Oxford, United Kingdom;
University School of Medicine, Shigenobu, Ehime, Japan; and
¶ Department of Rheumatology, Division of Medicine, Imperial College London, Chelsea and Westminster Hospital, London, United Kingdom
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
In addition to TCR signals, major developmental pathways such as the WNT, Notch, and Hedgehog signaling pathways influence T cell development (2, 3, 4). Interestingly, there is recent evidence that these major developmental pathways also control the differentiation of peripheral T cells. Thus, Notch regulates the decision of CD4 T cells between the Th1 vs the Th2 fate (5), while the Hedgehog pathway can influence the proliferation and cytokine production of human peripheral CD4 T cells (6, 7). In contrast, it is currently unknown whether the WNT pathway has any role in mature T cells.
The canonical WNT signaling pathway is a critical regulator of stem cell function, e.g., it controls the maintenance and self-renewal of hemopoietic stem cells (8, 9, 10, 11). Furthermore, dysregulation of the WNT pathway commonly occurs in human cancers (11). In the absence of a WNT signal, cytoplasmic
-catenin is phosphorylated and targeted for degradation by the proteasome (3, 11). WNT signaling allows
-catenin to escape proteasomal degradation and to translocate to the nucleus. In the nucleus,
-catenin interacts with members of the lymphoid enhancer binding factor (LEF)/T cell factor (TCF) family of transcription factors (LEF1, TCF7 (TCF-1), TCF7L1 (TCF-3), and TCF7L2 (TCF-4)) to activate the transcription of WNT target genes such as c-myc and cyclin D1 (11). In the absence of WNT signaling, i.e., when not interacting with
-catenin, LEF/TCF family members act as transcriptional repressors by recruiting Groucho repressor proteins (12).
LEF1 and TCF7 (TCF-1) share common protein motifs, in particular, the C-terminal HMG domain of both proteins is responsible for DNA binding, while a
-catenin-binding domain at the N terminus mediates the interaction with
-catenin (12). Interestingly, there are multiple LEF1 and TCF7 (TCF-1) protein isoforms with distinct functional properties (13, 14, 15, 16, 17). In addition to the stimulatory full-length isoforms, there are N-terminally truncated isoforms that are without the
-catenin-binding domain (referred to as
CTNNB) but retain the ability to interact with Groucho repressors (12). Importantly, these truncated isoforms can function in a dominant-negative manner in the WNT signaling pathway as has been demonstrated for
CTNNB isoforms of LEF1 (17, 18), TCF7 (TCF-1) (19, 20), and the Xenopus homolog of LEF1/TCF7 (TCF-1) (21). Finally, there are also LEF1 and TCF7 (TCF-1) isoforms with alternative C-termini (termed tails) known as N- or B-tailed isoforms. Currently, very little is known about the different functional properties of these multiple LEF1 and TCF7 (TCF-1) isoforms in T cells.
Knockout and transgenic studies in mice have clearly shown a redundant and
-catenin-dependent role of LEF1 and TCF7 (TCF-1) in T cell development (3). TCF7 (TCF-1)/ mice have impaired T cell development with a partial block at the intermediate single-positive to double-positive transition due to reduced thymocyte proliferation and survival (22, 23, 24). Although T cell development is normal in LEF1 / mice, B cell development is impaired (25). Thymocytes from TCF7 (TCF-1)/ LEF1 / mice show a profound block at the intermediate single-positive stage with neither double-positive nor single-positive thymocytes present, and consequently no mature T cells in the periphery (26). Taken together, the WNT-
-catenin-LEF1/TCF7 (TCF-1) axis plays a pivotal role in T cell development. However, it is unknown whether LEF1, TCF7 (TCF-1), and the WNT pathway have a specific function in peripheral T cells.
Therefore, we undertook a detailed analysis of the expression of LEF1 and TCF7 (TCF-1) in human peripheral T cells. We found that both LEF1 and TCF7 (TCF-1) are expressed in mature CD8+ TN and that their expression is down-regulated following TCR or IL-15R engagement in vitro and Ag encounter in vivo. Furthermore, T cell activation changed the balance of stimulatory vs inhibitory LEF1 and TCF7 (TCF-1) isoforms. Our results suggest that the WNT pathway, in addition to its well-known role in T cell development, is likely to be involved in regulating peripheral T cell differentiation.
| Materials and Methods |
|---|
|
|
|---|
For microarray and quantitative RT-PCR (qRT-PCR) experiments, CD8 T cell subsets were isolated from healthy donors in accordance with institutional ethics approval as previously described (27). CD8 T cells were sorted into either TN (CCR7+CD45RA+) and effector memory T cells/effector memory RA T cells (TEM/EMRA; CCR7CD45RA+/) (microarray data set 1), or TN (CCR7+CD45RA+), central memory T cells (TCM; CCR7+CD45RA), TEM (CCR7CD45RA), and TEMRA (CCR7CD45RA+) populations (microarray data set 2).
Microarray gene expression analysis
RNA extraction and labeling was performed as previously described (27, 28). For microarray data set 1, total RNA was pooled from several donors (replicate pool 1: n = 10; replicate pool 2: n = 6) and hybridized to Affymetrix HG-U95Av2 arrays. Two independent microarray experiments were performed with RNA from CD8+ TN and TEM/EMRA for data set 1. For microarray data set 2 (described in Ref.27), total RNA from individual donors was used and hybridized to Affymetrix HG-U133 plus 2.0 arrays (Affymetrix). Four independent microarray experiments were performed with RNA from CD8+ TN, TCM, TEM, and TEMRA for data set 2. We used GCOS software (Affymetrix) and the software package BRB-ArrayTools for data analysis and the identification of differentially expressed genes between CD8 T cells subsets (27).
qRT-PCR analysis
qRT-PCR was conducted on cDNA from the indicated CD8 T cell populations with the 5' nuclease/TaqMan assay. Briefly, we prepared cDNA from
1 µg of DNase-treated total RNA using the SuperScript First-Strand Synthesis System (Invitrogen Life Technologies). We then performed quantitative PCR in a final volume of 25 µl with 300 nM of the forward and reverse primers and 100250 nM of the fluorogenic TaqMan probes (Eurogentec) using 2x quantitative PCR Mastermix Plus (Eurogentec). Reactions were run on an ABI Prism 7700 Sequence Detection System machine (Applied Biosciences) in triplicate (initial steps: 50°C/2 min and 95°C/10 min, followed by 40 cycles: 95°C/15 s and 60°C/1 min) The following primers and probes were used: 1) LEF1: forward, TGACAGCTGCCTACATCTGAAAC; reverse, GCTGCCTTGGCTTTGCAC; probe: FAM-TGGTGGAAAACGAAGCTCATTCCCAA-TAMRA. LEF1 primers and probes target exon 11/exon 12 and are specific for all LEF1 N-tail isoforms. 2) TCF7 (TCF-1): forward, TGCAGCTATACCCAGGCTGG; reverse, CCTCGACCGCCTCTTCTTC; probe: FAM-TCCCGTAGTTGTCCCGCGCTG-TAMRA. TCF7 (TCF-1) primers and probes target exon 7/exon 8 and are specific for all TCF7 (TCF-1) isoforms. 3) hypoxanthine phosphoribosyltransferase: forward, GACTTTGCTTTCCTTGGTCAGG; reverse, AGTCTGGCTTATATCCAACACTTCG; probe: FAM-TTTCACCAGCAAGCTTGCGACCTTGAC-TAMRA. All probes span exon-intron junctions. We applied the comparative threshold cycle method for relative quantification of mRNA expression according to the manufacturers recommendations. Validation experiments demonstrated that the amplification efficiencies of LEF1 and TCF7 (TCF-1) were equal to that of the endogenous control hypoxanthine phosphoribosyltransferase.
Intracellular FACS staining
We analyzed intracellular expression of LEF1 and TCF7 (TCF-1) in CD8 T cell subsets using the methanol permeabilization protocol as previously described (27). LEF1 and TCF7 (TCF-1) were detected by indirect staining using pretitrated mAbs REMB6 (Oncogene Research Products) and 7H3 (Upstate Biotechnology), respectively. Briefly, 2 µg of primary mAb was added to 2 x 106 cells and incubated for 1 h at room temperature. After washing, this was followed by staining with PE-conjugated rabbit anti-mouse Ab (DakoCytomation) for 1 h at room temperature. Cells were subsequently washed in blocking buffer (PBS containing 2% mouse serum) before surface staining with directly conjugated mAbs specific for CD62 ligand (CD62L), CD45RA, and CD8 (all BD Biosciences). CD62L was used instead of CCR7 as a surface marker because CCR7 staining was compromised following methanol permeabilization (27).
Stimulation of cord blood (CB) CD8 T cells in vitro
We obtained CB samples from the John Radcliffe Hospital maternity unit, upon written consent and approval by the local Medical Ethics Committee. CB CD8 T cells were isolated by immunomagnetic selection as described above. Phenotyping was conducted using mAbs specific for CCR7 (R&D Systems), CD45RA (BD Biosciences), CD8 (BD Biosciences), CD3, CD25, and HLA class II (all DakoCytomation). We stimulated CB CD8 T cells (12 x 106/ml) with either plate-bound anti-CD3 mAb OKT3 (1 µg/well), IL-15 (50 ng/ml), or TGF
1 (3 ng/ml) in 24-well plates for the indicated time points. All cytokines were from obtained R&D Systems. Cells were cultured in complete medium (RPMI 1640 supplemented with 10% FCS, 1% sodium pyruvate, 2 mM L-glutamine, 100 U/ml penicillin, and 100 µg/ml streptomycin) at 37°C in 5% CO2. Alternatively, CD8 T cells (1 x 106) were cocultured with irradiated allogeneic EBV-transformed B cells at a 1:1 ratio. From day 3 onward, CD3+ cells represented >95% of live cells in these cocultures, i.e., the stimulator B cells had practically disappeared.
Cloning of LEF1 mRNA isoforms from primary CD8 T cells
Total RNA was extracted from primary CD8 T cells using TRI Reagent (Sigma-Aldrich) and cDNA was prepared as described above for the qRT-PCR experiments. RT-PCR was performed with the following primers: forward primers, CAGCGGAGCTCAGATTACAGAG (full-length isoforms) and ACTCGAGCTCTTCCGGGTACATAATG (
CTNNB isoforms); reverse primers, CTTCGAATTCCACCATGTTTCAGATG (N-tail isoforms) and GTCAGAATTCCTTTGGCGTCGACTG (B-tail isoforms). PCR products were cloned into the vector pIRES2-EGFP (BD Clontech) followed by DNA sequencing.
Western blot analysis
We prepared protein lysates from
3 to 5 x 106 CD8 T cells by washing the cells in PBS and resuspending them in an equal volume of 2x sample buffer (100 mM Tris-HCl (pH 6.8), 4% SDS, 8% 2-ME, 0.2% bromphenol blue, and 20% glycerol). After sonication for 2 x 20 s and boiling for 510 min, protein samples were separated by SDS-PAGE and gels blotted to nitrocellulose membranes. We performed immunodetection of LEF1 and TCF7 (TCF-1) with the REMB6 mAb (Exalpha) at a 1/500 dilution and with the 7H3 mAb (Upstate Biotechnology) at a 1/1000 dilution, respectively. This was followed by incubation with secondary HRP-conjugated anti-mouse Ig (DakoCytomation) and signal detection with ECL reagent (BD Amersham). Blots were stripped by incubating the membrane at 50°C for 30 min in stripping buffer (62.5 mM Tris-HCl (pH 6.7), 2% SDS, and 100 mM 2-MEl) and reprobed with anti-
-actin mAb AC-15 at a 1/5000 dilution (Sigma-Aldrich).
Statistical analysis
A two-sample, two-tailed t test assuming unequal variances was used to determine the significance of differences in mRNA expression between two groups (
= 0.05). For multigroup comparisons, we applied one-way ANOVA with post hoc testing using Tukeys significant difference test (
= 0.05).
| Results |
|---|
|
|
|---|
We used microarray technology to screen for genes that are differentially expressed between human TN and Ag-primed CD8 T cells. Our first, exploratory, microarray data set compared gene expression in purified CD8+ TN (CCR7+CD45RA+) and CD8+ TEM/EMRA (CCR7CD45RA+/) populations using RNA pooled from several donors. We also generated a more detailed second data set that analyzed the gene expression profiles of CD8+ TN (CCR7+CD45RA+) in relation to that of CD8+ TCM (CCR7+CD45RA), TEM (CCR7CD45RA), and TEMRA (CCR7CD45RA+) subsets. Technical advances allowed us to use RNA from individual donors instead of pooled RNA and to perform a greater number of replicate experiments (four instead of two) for the second data set. Furthermore, gene chips (HG-U133 Plus 2.0 instead of HG-U95Av2) with a greater number of probes and greater coverage of the human genome were available for this data set. Using this data set, we have previously investigated the molecular relationships between TN and memory (Ag-primed) CD8 T cell subsets and the molecular basis for their different functional properties (27). We now aimed to examine selected differentially expressed genes in more detail to gain further insight into the molecular basis of CD8 T cell behavior.
We identified LEF1 as a gene highly expressed in TN, compared with Ag-primed CD8 T cell subsets. In both microarray data sets, LEF1 was found to be in the top three most differentially expressed genes when comparing the different mature CD8 T cell populations (Table I). Indeed, within data set 2, probe identifications for LEF1 accounted for two of the top three differentially expressed genes. LEF1 mRNA levels were 5- to 10-fold higher in TN, compared with the three Ag-experienced subsets, with TCM expressing LEF1 more strongly than TEM and TEMRA (Fig. 1A). Interestingly, we found that TCF7 (TCF-1) was also expressed at higher levels in TN, compared with TCM, TEM, and TEMRA (Fig. 1B).
|
|
|
We studied the regulation of LEF1 mRNA expression in peripheral CD8 T cells in vitro by qRT-PCR. We observed down-regulation of LEF1 mRNA expression in CD8 T cells in response to TCR triggering (Fig. 3A). This down-regulation was rapid (within 12 h) and persisted for >48 h. Stimulation with homeostatic cytokines, such as IL-15, also lead to a persistent decrease in LEF1 mRNA levels (Fig. 3B), with IL-2 having a similar effect (data not shown). In contrast, stimulation with TGF
1 increased LEF1 expression in CD8 T cells, compared with the medium control (Fig. 3C).
|
; Fig. 4A) and HLA class II (data not shown) in response to TCR (allogeneic) stimulation. At later time points, poststimulation CD8 T cells converted back to a resting state as shown by the absence of activation marker expression (Fig. 4A). Similar to bulk peripheral CD8 T cells, we observed down-regulation of LEF1 mRNA expression in CD8+ TN (from CB) following TCR stimulation as measured by qRT-PCR (Fig. 4B). Importantly, at the time points examined (more than day 3) allogeneic stimulator B cells had practically disappeared from the T cell-B cell cocultures. Interestingly, after the initial down-regulation, there was a progressive increase in LEF1 mRNA expression at later time points poststimulation, although it varied between donors. A further set of experiments corroborated these results: in addition to TCR triggering, homeostatic signals such as IL-15 also decreased LEF1 and TCF7 (TCF-1) mRNA expression in CD8+ TN (from CB) (Fig. 4C). The level of LEF1 down-regulation (5- to 10-fold) was similar to that observed when comparing TN and CD8 T cells primed with Ag in vivo (Fig. 1A). Thus, the signals that control mature CD8 T cell differentiation, i.e., TCR triggering and homeostatic cytokines, also regulate the expression of LEF1 and TCF7 (TCF-1) in CD8+ TN.
|
Several LEF1 and TCF7 (TCF-1) isoforms with different functional properties have been described (13, 14, 15, 16, 17, 18, 19, 20, 21), but which of these different isoforms are expressed in CD8 T cells is unknown. Therefore, we analyzed LEF1 and TCF7 (TCF-1) isoform expression in mature T cells. First, cloning of LEF1 mRNA isoforms by RT-PCR and DNA sequencing showed that peripheral CD8 T cells express both stimulatory full-length and inhibitory
CTNNB LEF1 mRNA isoforms (Fig. 5A). Furthermore, we found that CD8 T cells preferentially express N-tail LEF1 mRNA isoforms, although isoforms carrying a B-tail could also be detected (Fig. 5B). These mRNA isoforms were distinguished by the presence (N-tail isoforms) or absence (B-tail isoforms) of exon 11 (16). The predominance of N-tail isoforms applied to both full-length and
CTNNB LEF1 mRNA isoforms (Fig. 5B).
|
CTNNB LEF1 isoform that has a dominant-negative function in the WNT signaling pathway (17, 18). The predominance of inhibitory LEF1 protein isoforms also applied to resting CD8+ TN (from CB; Fig. 6B, lane 1). In line with our mRNA expression results (Fig. 4), there was an overall down-regulation of LEF1 protein expression following TCR triggering or stimulation with IL-15 in vitro (Fig. 6B, lanes 2 and 3).
|
CTNNB (2632 kDa) TCF7 (TCF-1) isoforms (14, 15) was about equal in resting (Fig. 7A) and CD8+ TN (from CB; Fig. 7B, lane 1). Clevers and colleagues (15) have previously demonstrated that the 26- to 32-kDa bands correspond to
CTNNB TCF7 (TCF-1) isoforms that have a dominant-negative function (19, 20). Interestingly, TCR and IL-15 stimulation of CD8+ TN (from CB) lead to preferential down-regulation of the inhibitory TCF7 (TCF-1)
CTNNB isoforms (Fig. 7B, lanes 2 and 3). Thus, the TCF7 (TCF-1) protein isoform balance in CD8 T cells changed in favor of the stimulatory isoforms following activation. In conclusion, our data suggest that the negative effects of inhibitory LEF1 and TCF7 (TCF-1) isoforms prevail in resting CD8 T cells. In activated cells this negative effect seems to be relieved by down-regulation of overall LEF1 protein expression and by specific down-regulation of inhibitory TCF7 (TCF-1) isoform expression.
|
| Discussion |
|---|
|
|
|---|
The differential expression of these molecules in the different CD8 T cell subsets proved to be consistent and robust; it was confirmed at the level of mRNA using qRT-PCR and at the level of protein using intracellular staining in many different donors. Furthermore, in a longitudinal study in an in vitro system, we were able to show that stimulation of TN, by alloantigen, led to a down-regulation of LEF1 and TCF7 (TCF-1).
The importance of these two transcription factors in regulating thymocyte development is accepted. Their possible role in regulating peripheral T cell function has not been considered previously. TN can be regarded as peripheral stem cells, while TEM and TEMRA are differentiated cells with effector function. The idea that expression of LEF1 and TCF7 (TCF-1) may be relevant to maintaining the TN stem cell population is in line with the known role of the WNT-
-catenin-LEF1/TCF7 (TCF-1) pathway in the maintenance of hemopoietic stem cells (8, 9, 10, 11). The observation that peripheral T cells from TCF7 (TCF-1)/ mice have a spontaneously activated phenotype (CD44highCD62Llow) that is characteristic of Ag-primed cells is also in line with this notion (23).
Our results are most consistent with the idea that LEF1 and TCF7 (TCF-1) might control T cell quiescence. Similar to TCR signals, we observed that other pro-proliferative signals such as the cytokines IL-2 and IL-15 inhibit LEF1 and TCF7 (TCF-1) expression. Interestingly, it has been shown that IL-15 and TCR stimulation induce very similar changes in gene expression in human CD8 T cells (30). This would suggest that IL-15 and TCR stimulation probably activate common signaling pathways, and this could also apply to the regulation of LEF1/TCF7 (TCF-1) expression in CD8 T cells. Furthermore, one recent study reported that another IL-2 family member, IL-7, can also inhibit LEF1 and TCF7 (TCF-1) expression (31). In contrast, we found that TGF
1, which is known to inhibit T cell differentiation and maintain T cell quiescence (32), increased LEF1 expression. Interestingly, we noted a partial recovery of LEF1 expression in CD8 T cells in vitro when the cells converted back to a resting state following Ag stimulation. Similarly, one murine microarray study demonstrated initial down-regulation/partial recovery of LEF1 expression upon naive
effector
memory CD8 T cell differentiation in vivo (33).
The observed correlations between expression of LEF1 and TCF7 (TCF-1) and T cell naivety and quiescence were not consistent with published data showing that LEF1 and TCF7 (TCF-1) are able to drive cellular proliferation. However, this paradox was resolved by additional experiments that analyzed the expression of the different LEF1 and TCF7 (TCF-1) isoforms. Our work shows that, compared with Jurkat cells, resting CD8 T cells express relatively more of the inhibitory LEF1 and TCF7 (TCF-1) protein isoforms. T cell stimulation results in down-regulation of this inhibitory isoform. Importantly, it has previously been shown that although stimulatory full-length LEF1 and TCF7 (TCF-1) isoforms drive the proliferation of Jurkat T cells, dominant-negative
CTNNB isoforms inhibit proliferation (20). Furthermore, colon cancer cells predominantly express full-length LEF1 isoforms while down-regulating the expression of
CTNNB isoforms (17). Finally, inhibitory
CTNNB isoforms are the most abundant TCF7 (TCF-1) isoforms in the intestine and TCF7 (TCF-1)/ mice develop intestinal and mammary adenomas (19). Thus, it is been suggested that the balance between stimulatory and inhibitory LEF1 and TCF7 (TCF-1) is a checkpoint for cellular proliferation in the context of malignancy.
In a conceptually similar way, the experiments we describe lead us to formulate the hypothesis that the balance between stimulatory and inhibitory LEF1 and TCF7 (TCF-1) isoforms represent a checkpoint for the quiescence of peripheral T cells. Direct evidence for this will require future studies, in which expression of individual LEF1 and TCF7 (TCF-1) isoforms or combinations of individual isoforms is manipulated in primary mature T cells. The functional redundancy between LEF1 and TCF7 (TCF-1) and the presence of numerous isoforms will make such experiments difficult to design and perform. Consistent with this, in preliminary experiments, we did not find a clear phenotype when knocking down total LEF1 (i.e., all isoforms) by RNA interference in human peripheral T cells. Studies in knockout and transgenic mice are probably more suited to address the role of the WNT pathway in mature T cells, although the conditional knockout of individual LEF1 and TCF7 (TCF-1) isoforms will be challenging.
In conclusion, our study identifies LEF1 as the most differentially expressed transcription factor between TN and Ag-experienced CD8 T cells. It shows that, compared with a Jurkat cell line, CD8+ TN express more of the inhibitory isoform of this and another (TCF7 (TCF-1)) member of the WNT signaling pathway. We provide evidence that down-regulation of these inhibitory isoforms is associated with T cell stimulation. Our results suggest that the WNT pathway may have a specific function not only in immature, but also in mature T cells and provide a strong rationale for further molecular studies aimed at directly investigating the functional importance of individual isoforms of members of the WNT-LEF1/TCF7 (TCF-1) signaling pathway in peripheral T cell differentiation.
| Acknowledgments |
|---|
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported by Grants from the Medical Research Council (U.K.) and Leukaemia Research Fund. T.W. is a Medical Research Council Clinical Research Fellow, and M.F.C.C. is a Medical Research Council Senior Clinical Fellow. ![]()
2 Address correspondence and reprint requests to Dr. Tim Willinger, Medical Research Council Human Immunology Unit, Weatherall Institute of Molecular Medicine, John Radcliffe, Oxford, U.K. E-mail address: TimW{at}hammer.imm.ox.ac.uk ![]()
3 Abbreviations used in this paper: TN, naive T cell; CB, cord blood; LEF1, lymphoid enhancer binding factor 1; qRT-PCR, quantitative RT-PCR; TCF7 (TCF-1), transcription factor 7 (T cell factor 1); TCM, central memory T cell; TEM, effector memory T cell; TEMRA, effector memory RA T cell; CD62L, CD62 ligand. ![]()
Received for publication August 31, 2005. Accepted for publication November 14, 2005.
| References |
|---|
|
|
|---|
-catenin-sensitive isoforms of lymphoid enhancer factor-1 are selectively expressed in colon cancer. Nat. Genet. 28: 53-57. [Medline]
-catenin with the transcription factor LEF-1. Nature 382: 638-642. [Medline]
-catenin-Tcf4 target Tcf1. Science 285: 1923-1926.
-catenin. Blood 100: 982-990.
-catenin-induced axis formation in Xenopus embryos. Cell 86: 391-399. [Medline]
-catenin-TCF-1 pathway ensures CD4+CD8+ thymocyte survival. Nat. Immunol. 2: 691-697. [Medline]
gene expression by the transcription factors LEF-1 and TCF-1. Immunity 8: 11-20. [Medline]
t: impact on thymocyte development. J. Exp. Med. 200: 797-803.
in T-cell biology. Nat. Rev. Immunol. 2: 46-53. [Medline]This article has been cited by other articles:
![]() |
F. K. Noubissi, S. Goswami, N. A. Sanek, K. Kawakami, T. Minamoto, A. Moser, Y. Grinblat, and V. S. Spiegelman Wnt Signaling Stimulates Transcriptional Outcome of the Hedgehog Pathway by Stabilizing GLI1 mRNA Cancer Res., November 15, 2009; 69(22): 8572 - 8578. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. C. Pang, M. E. Dinger, T. R. Mercer, L. Malquori, S. M. Grimmond, W. Chen, and J. S. Mattick Genome-Wide Identification of Long Noncoding RNAs in CD8+ T Cells J. Immunol., June 15, 2009; 182(12): 7738 - 7748. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Hebenstreit, M. Giaisi, M. K. Treiber, X.-B. Zhang, H.-F. Mi, J. Horejs-Hoeck, K. G. Andersen, P. H. Krammer, A. Duschl, and M. Li-Weber LEF-1 Negatively Controls Interleukin-4 Expression through a Proximal Promoter Regulatory Element J. Biol. Chem., August 15, 2008; 283(33): 22490 - 22497. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Z. Hossain, Q. Yu, M. Xu, and J. M. Sen ICAT expression disrupts {beta}-catenin-TCF interactions and impairs survival of thymocytes and activated mature T cells Int. Immunol., July 1, 2008; 20(7): 925 - 935. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. S. Hinrichs, R. Spolski, C. M. Paulos, L. Gattinoni, K. W. Kerstann, D. C. Palmer, C. A. Klebanoff, S. A. Rosenberg, W. J. Leonard, and N. P. Restifo IL-2 and IL-21 confer opposing differentiation programs to CD8+ T cells for adoptive immunotherapy Blood, June 1, 2008; 111(11): 5326 - 5333. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Zhou, W. Mak, Y. Zheng, C. R. Dunstan, and M. J. Seibel Osteoblasts Directly Control Lineage Commitment of Mesenchymal Progenitor Cells through Wnt Signaling J. Biol. Chem., January 25, 2008; 283(4): 1936 - 1945. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Shin, S. Monti, D. J. Aires, M. Duvic, T. Golub, D. A. Jones, and T. S. Kupper Lesional gene expression profiling in cutaneous T-cell lymphoma reveals natural clusters associated with disease outcome Blood, October 15, 2007; 110(8): 3015 - 3027. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Hoppler and C. L. Kavanagh Wnt signalling: variety at the core J. Cell Sci., February 1, 2007; 120(3): 385 - 393. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |