|
|
||||||||



* Institut National de la Santé et de la Recherche Médicale Unité 563, Institut Fédératif de recherche 30, and Université Paul Sabatier, Hôpital Purpan, Toulouse, France;
Institut National de la Santé et de la Médicale Unité 643 and Institut de Transplantation et de Recherche en Transplantation, Centre Hospitalier Universitaire Hôtel-Dieu, Nantes, France; and
Laboratoires Fournier, Daix, France
| Abstract |
|---|
|
|
|---|
8.2 encephalitogenic T cells. In contrast, this drug favors the differentiation of MBP-specific CD4 T cells into Foxp3-expressing regulatory T cells that, upon adoptive transfer in syngeneic recipients, prevent the development of actively induced EAE. Finally, we demonstrate that the tolerance induced by LF 15-0195 treatment is not dependent on the presence of TGF-
. Together, these data demonstrate that short-term treatment with LF 15-0195 prevents MBP-immunized LEW rats from EAE by favoring the development of Foxp-3-expressing regulatory CD4 T cells. | Introduction |
|---|
|
|
|---|
and -
variable gene segments. In Lewis (LEW) rats immunized with myelin basic protein (MBP), encephalitogenic T cells respond to the immunodominant MBP6888 epitope and mainly use the V
8.2 chain of the TCR (6, 7). The clinical course of EAE varies according to the animal model and to the protocol used to induce the disease. In LEW rats, acute EAE is followed by a permanent remission and resistance to further disease induction (3, 5, 8). In other models of EAE, the remission may be transient and followed by relapses and remissions. The mechanisms responsible for the spontaneous recovery and resistance to disease reinduction, which may be similar to those responsible for spontaneous remissions seen in patients with relapsing-remitting MS, are still poorly understood. The ability to control the aggressive phase of disease without hindering the development of such immunoregulatory mechanisms would provide an attractive therapeutic approach for human immunological disorders such as MS. LF 15-0195 is a potent and less toxic analog of the immunosuppressant 15-deoxyspergualine. LF 15-0195 has demonstrated therapeutic efficacy in animal models of allotransplantion (9, 10, 11, 12), xenotransplantation (13, 14), and autoimmune diseases (15, 16, 17). In EAE, we previously demonstrated that LF 15-0195 inhibits the effector phase of EAE by reducing the encephalitogenicity of MBP-specific CD4 T cells (17). This phenomenon is stable and long-lasting. Indeed, neither IL-12 nor repeated stimulation with naive APC and MBP in vitro rendered MBP-specific CD4 T cells from protected rats encephalitogenic. However, the mechanisms underlying this effect remain unknown and were investigated in the present study.
In this study, we show that MBP-immunized LEW rats protected from CNS autoimmunity by a 30-day course of LF 15-0195 treatment benefit from a long-lasting tolerance since they did not develop signs of disease 4 mo after treatment withdrawal. These protected rats are also refractory to second immunization with MBP in CFA, indicating that this immunosuppressive drug not only prevents LEW rats from EAE but also preserves their refractory phase. Finally, we show that this short-term treatment with LF 15-0195 does not delete the MBP-specific encephalitogenic T cells but favors the differentiation of MBP-specific Foxp3-expressing regulatory T cells.
| Materials and Methods |
|---|
|
|
|---|
Eight- to 10 wk-old male LEW rats were used in this study. These animals were obtained from the Centre dElevage R. Janvier (Le Genest St. Isle, France) and maintained in our animal house facility under specific pathogen-free conditions. All procedures were in accordance with national regulations on animal experimentation.
Induction, treatment, and clinical evaluation of EAE
To induce active EAE, LEW rats were injected in the hind footpads with 10 µg of guinea pig MBP emulsified in CFA containing 4 mg/ml heat-killed Mycobacterium tuberculosis H37Ra (Difco). MBP was prepared in our laboratory as previously described (18). A total of 100 µl of MBP-CFA was divided equally between the rear footpads. To induce passive EAE, MBP-specific T cell lines were derived from lymph node cells obtained from MBP-immunized donors and were adoptively transferred into naive syngeneic recipients. In some experiments, the recipients were lightly irradiated (250 rad). LF 15-0195 (Fournier Laboratories) was prepared in saline solution, adjusted at pH 7.2, and 300 µl was administered s.c. using a protocol previously shown to fully prevent EAE (17). The animals were injected daily with LF 15-0195 at 1 mg/kg for 30 days, starting the day of immunization. Control rats received either LF 15-0195 or saline without immunization with MBP, or were immunized with OVA and treated with LF 15-0195 as described before, or were immunized with MBP without LF 15-0195 treatment. Animals were scored daily for clinical signs of disease on a severity scale ranging from 0 to 6: 0, normal; 1, limp tail; 2, hind limb weakness; 3, unilateral hind limb paralysis; 4, bilateral hind limb paralysis; 5, bilateral hind limb paralysis and incontinence and 6, moribund. Clinical signs determined to be between any of these stages were given an intermediate score. The results are presented as the mean maximal score and/or as the mean cumulative score, calculated as the sum of daily disease scores of each individual animal.
Antibodies
The mAbs used for flow cytometry and for cell purification were as follows: W3/25 (anti-rat CD4), OX22 (anti-rat CD45RC), OX39 (anti-rat CD25), OX40 (anti-rat CD134), OX50 (anti-rat H-CAM), OX85 (anti-rat L selectin), R73 (anti-rat TCR-
), and R78 (anti-rat TCR V
8.2). The hybridomas OX22, OX39, OX40, OX50, OX85, and W3/25 were provided by Dr. D. Mason (Sir William Dunn School of Pathology, Oxford, U.K.). FITC-conjugated OX22 and R73 mAbs and biotinylated W3/25, OX39, OX40, and OX85 mAbs were prepared in our laboratory according to standard protocols. PE-conjugated R73 and FITC-conjugated R78 are commercially available (BD Pharmingen). The anti-TGF-
mAb (2G7) was injected i.v. as indicated in Results. 2G7 recognizes both the active and latent forms of TGF-
1, TGF-
2, and TGF-
3 (19).
Generation of T cell lines and adoptive transfer of protection
Preparation and maintenance of T cell lines were performed as described elsewhere (20), with some modifications. Briefly, LEW rats immunized with MBP and treated or not daily with LF 15-0195 at a dose of 1 mg/kg for 12 days, starting the day of immunization with MBP. Rats were then killed and their popliteal lymph nodes were collected. Lymph node cells were resuspended at 4 x 106 viable cells/ml in complete medium containing 1% normal rat serum and 20 µg/ml MBP. The complete culture medium was RPMI 1640 (Invitrogen Life Technologies), 1% sodium pyruvate, 1% nonessential amino acids, 1% L-glutamine, 1% penicillin-streptomycin, and 2 x 105 M 2-ME. After 3 days, viable cells were separated using Ficoll-Hypaque and resuspended at 5 x 105/ml in complete medium containing 10% FCS and 10 U/ml rat IL-2. After 7 days of resting, the viable cells were recovered and resuspended at 5 x 105 cells/ml in complete medium with MBP (10 µg/ml) and irradiated syngeneic splenocytes (1.5 x 106 cells/ml) as a source of APC. After this second round of Ag stimulation, the same procedure was repeated for at least three cycles. Before the adoptive transfer, the T cell lines were stimulated with MBP at 2 µg/ml for 3 days. To analyze the ability of MBP-specific T cells generated from MBP-immunized LF15-0195-treated rats to prevent EAE, the T cell lines (obtained after four rounds of stimulation) were transferred into irradiated LEW rats 1 day before immunization with MBP (active EAE) or cotransferred with encephalitogenic "MBP lines" the same day (passive EAE).
Isolation of V
8.2+ and V
8.2 T cell subsets
MBP-specific T cell lines were separated into V
8.2+ and V
8.2 T cell subpopulations by positive and negative selection using magnetic beads. Viable MBP-specific CD4 T cells were incubated with FITC-anti-TCR V
8.2 mAb and selected using anti-FITC magnetic beads (Automacs; Miltenyi Biotec). Purity of the sorted cells was assessed by flow cytometry using an XL Coulter flow cytometer (Coultronics) and was always higher than 90% (see Fig. 2A).
|
For proliferation and cytokine profile studies, MBP lines, "LFMBP lines" obtained after at least two cycles of stimulation or purified V
8.2+ and V
8.2 MBP-specific T cells, were resuspended at 2.5 x 105 cells/well in complete medium with MBP (10 µg/ml) and irradiated syngeneic splenocytes (105/well) in 96-well culture plates (Costar). Proliferation was measured by [3H]thymidine incorporation during the last 18 h of a 60-h culture period. Supernatants were removed after 36 and 60 h of culture and stored at 20°C for cytokine determination. IL-2, IFN-
, and IL-10 proteins in the supernatants were measured by specific ELISA (21).
Real-time quantitative RT-PCR
Total RNAs from MBP-specific T cells (13 x 106 cells) were extracted by the TRIzol procedure (Invitrogen Life Technologies). Genomic DNA was removed by DNase treatment (Turbo DNA-free; Ambion), and mRNAs were reverse transcribed. Real-time quantitative PCRs were performed in a ABI Prism 7700 Sequence Detection System (Applied Biosystems) using SYBR Green PCR Core Reagents (Applied Biosystems) as previously described (22). Primers used in this study were either previously published (23) or as follows: rat CCR1: forward, CAGGTGACTGAAGTGATTGCCT, reverse, AGCGGTATAGCCACATGCCT; rat CCR3: forward, GTCTGCTTTCCACAGCACATTT, reverse, CGCCAGGAAGGAATGAAATATA; rat CCR4: forward, GTTTGTGCTGTCTCTCCCGTT, reverse, AGCCCACCAGGTACATCCAT; rat CCR5: forward, TCAACCCTGTCATCTATGCCTT, reverse, GATCAGGATTGACTTGCTGGAA; and rat CX3CR1: forward, TGTCCTGAACTCACCAAGGGT, reverse, GGATGAGGAGTCAGCATGGAG. Data were normalized to hypoxanthine phosphoribosyltransferase (HPRT) levels and expressed as to 2(
Ct gene CtC
), where the 
Ct = (Ctgene CtHPRT)sample/(Ctgene CtHPRT)reference. Data were further expressed in arbitrary units (AU), in reference to the mean of "MBP line" samples (value = 1 AU).
TCR-V
repertoire analysis
The TCR-V
repertoire of MBP-specific T cell lines was analyzed both quantitatively and qualitatively using the TcLand technology. For the quantitative analysis, real-time quantitative PCRs were performed in a GenAmp 7700 Sequence Detection System using a C
primer and 1 of the 21 V
specific primers described previously (24). Data were expressed as the ratio of V
transcripts levels to HPRT. For the qualitative analysis, TCR-V
-CDR3 spectratyping was performed as previously described (25). Briefly, amplification product was submitted to a five-cycle elongation reaction using a dye-labeled C
primer, then heat-denatured, loaded onto a 6% acrylamide-8 M urea gel, and electrophoresed using an ABI-377 DNA Sequencer (Applied Biosystems). The Immunoscope software (Institut Pasteur, Paris, France) resolved the raw data of DNA sequencing gel into sets of peaks separated by three nucleotides, including size and area of peaks representing the TCR-CDR3 length distribution profiles. The MatLab software was used to compute and display data as a conventional tridimensional TcLanscape profile. Percentage of CDR3-length distribution (LD) alteration (color scale) was calculated in reference to the Gaussian V
profile exhibited by splenocytes and PBL from normal rats (n = 11) (green background depicted no alteration).
Statistical analysis
Results are expressed as mean ± SD and overall differences between variables were evaluated using the Mann-Whitney U test. Analysis of severity score solely included animals developing EAE.
| Results |
|---|
|
|
|---|
It is well documented that LEW rats immunized with MBP develop an acute EAE from which they fully recover and become resistant to further induction of disease (3, 5, 8). We previously reported that both clinical and histological manifestations of EAE were significantly suppressed by s.c. administration of LF 15-0195 to MBP-immunized LEW rats (17). In this study, we investigated the effect of this treatment on the resistance phase of EAE (Table I). All 25 LEW rats immunized with MBP-CFA (group 1) developed a severe clinical EAE that killed 48% of the animals. As expected, the surviving rats were however resistant to a second induction of active EAE. Indeed, the seven convalescent rats that were challenged with MBP 49 days after the primary sensitization developed a significantly less severe EAE than MBP-immunized age-matched control rats (group 1 vs group 5; p = 0.006). LEW rats sensitized with MBP-CFA and treated with a daily dose of 1 mg/kg LF 15-0195 for 30 days, starting the day of immunization, displayed a significant reduction of prevalence and severity of clinical EAE (group 2). Indeed, only 14 animals among 41 developed a delayed (22.2 ± 0.9 vs 11.5 ± 1.1, p = 0.0001) and milder (1.3 ± 0.8 vs 5.1 ± 1.3, p = 0.0001) clinical EAE as compared with the MBP-immunized rats (group 1). Among the 27 rats that were fully protected from EAE ("LF-protected rats"), 6 rats were followed for 4 mo after treatment withdrawal and none developed clinical signs of EAE. The remaining 21 LF-protected rats were challenged with MBP-CFA 7 wk after the primary immunization. Thirteen rats were totally resistant to reinduction of active EAE, while the remaining 8 rats developed a milder disease than age-matched control rats (group 2 vs group 5, p = 0.04). LEW rats that were treated with LF 15-0195 and immunized (group 3) or not (group 4) with an irrelevant Ag, OVA, did not show any degree of protection after immunization with MBP 49 days after the initiation of LF 15-0195 administration. They were as susceptible to EAE as age-matched control rats (group 5). Collectively, these data show that short treatment with LF 15-0195 is sufficient to induce a long-lasting tolerance since the LF-protected rats did not develop signs of disease 4 mo after treatment was ceased. Interestingly, LF-protected rats are refractory to a second induction of an active EAE, demonstrating that this treatment not only prevents LEW rats from EAE but preserves their refractory phase. This effect is Ag driven since it requires priming by the autoantigen during drug administration.
|
8.2+ and V
8.2 MBP-specific CD4 T cells from LF 15-0195-treated rats have a diminished capacity to transfer EAE
In accordance with our previous report, MBP-specific CD4 T cell lines generated from lymph nodes of MBP-immunized LF 15-0195-treated animals (LFMBP lines) have a significantly reduced ability to transfer EAE to syngeneic recipients (Fig. 1A, p = 0.03) as compared with those generated from MBP-immunized untreated rats (MBP lines). Since LEW MBP-specific encephalitogenic T cells mainly use V
8.2 (6, 7), we first analyzed the effect of LF 15-0195 treatment on the T cell repertoire using TcLand technology. We analyzed the T cell repertoire of MBP-specific CD4 T cell lines generated from MBP-immunized LEW rats, treated or not with LF 15-0195, after six (Fig. 1B) or four rounds of stimulation (data not shown). As expected, the TCR repertoire of the MBP lines (Fig. 1B, left panel) was clearly dominated by the V
8.2 family. The V
8.2 transcripts were strongly accumulated, as revealed by the peak height, and highly altered, as depicted by the red color associated with a short CDR3 length of five amino acids. We showed that, although MBP-specific CD4 T cells from LF 15-0195-treated rats were modestly encephalitogenic, they nevertheless expressed the V
8.2 gene product (Fig. 1B, right panel), which was accumulated and altered (CDR3 length, five to six amino acids) to the same extent as in the MBP lines. These results raised two hypotheses: either the V
8.2+ cells in the LFMBP lines are less potent to transfer EAE or the V
8.2+ cells from the LFMBP lines are fully potent, but regulated by other T cells (V
8.2). To test these hypotheses, we purified V
8.2+ and V
8.2 CD4 T cells from T cell lines generated from MBP-immunized rats, treated or not with LF 15-0195 (Fig. 2A), and compared their ability to transfer EAE to syngeneic recipients. All LEW rats injected either with V
8.2+ CD4 T cells purified from MBP lines (0.5 x 106 cells/rat, n = 7, Fig. 2B) or high numbers of V
8.2 cells (3 x 106 cells/rat, n = 4, Fig. 2D) developed a classical EAE with a maximal clinical score around day 6 after transfer, followed by spontaneous recovery from disease. In contrast, similar numbers of MBP-specific V
8.2+ or V
8.2 T cells purified from LFMBP lines have a very reduced capacity to transfer EAE; the six LEW rats injected with 0.5 x 106 V
8.2+ cells (Fig. 2B) and the four LEW rats injected with 3 x 106 V
8.2 cells (Fig. 2D) purified from LFMBP lines developed a very mild form of the disease (p = 0.001 and p = 0.03, respectively), which appeared later than in controls injected with MBP lines.
|
8.2+ encephalitogenic CD4 T cells, but rather from its ability to reduce the encephalitogenicity of both V
8.2+ and V
8.2 MBP-specific CD4 T cells. Non-encephalitogenic MBP-specific CD4 T cells from LF 15-0195-treated rats prevent the development of actively, but not of passively, induced EAE
We previously demonstrated that the reduced ability of MBP-specific CD4 T cells from LF 15-0195-treated rats to transfer EAE is a stable phenomenon and could not be explained by a difference in cytokine production (17). Indeed, LFMBP lines generated in the presence of IL-12 have a cytokine profile comparable to encephalitogenic MBP lines but are nevertheless incapable of transferring EAE. We therefore tested for the presence of regulatory cells in LF-protected rats by transferring protection with LFMBP lines into naive syngeneic LEW rats that were slightly irradiated (250 rad) 1 day prior to the transfer. The recipients were immunized with MBP-CFA on the day of cell transfer. As shown in Table II, the adoptive transfer of 2.5 x 106 (group 4) or 5 x 106 (group5) MBP-primed LFMBP lines significantly reduced the severity and lethality of EAE induced by immunization with MBP. Indeed, all recipients developed a mild form of EAE as compared with MBP-immunized rats that were injected with PBS (group 1 vs group 4, p = 0.04; group 1 vs group 5, p = 0.003) or with MBP lines (group 3 vs group 4, p = 0.02; group 3 vs group 5, p = 0.01). We also showed that the administration of a high number of lymph node cells (60 x 106, Table II, group 2) or spleen cells (200 x 106, data not shown) from naive rats did not prevent active EAE. In contrast, these regulatory LFMBP lines are incapable of suppressing adoptively transferred EAE (Table II, group 8). Indeed, the animals transferred with 106 MBP lines associated with 106 LFMBP lines still developed severe clinical EAE. Altogether these data exclude the involvement of deletion, anergy, or ignorance, three passive mechanisms that are not consistent with results showing transfer of protection against active EAE in syngeneic recipients. In contrast, these data favor the implication of active tolerance mechanism mediated by regulatory CD4 T cells. These regulatory T cells are efficient at preventing active but not passive EAE, suggesting that these cells function at the inductive rather than the effector phase of EAE.
|
To better characterize the MBP-specific CD4 regulatory T cells from LF 15-0195-treated rats, we analyzed their state of activation, their cytokine profiles, and their expression of regulatory molecules and chemokine receptors. By flow cytometry analysis, we showed that the LFMBP lines and MBP lines were CD4+TCR
+ and expressed similar levels of activation markers (CD45RC, CD134, L-selectin, CD25, CD44) (data not shown). In response to MBP stimulation, the LFMBP lines proliferated equally well (Fig. 3A) and produced a similar amount of proinflammatory cytokine, IFN-
(Fig. 3B), but a lower amount of IL-10 (Fig. 3C) and IL-2 (Fig. 3D) than the MBP lines. We analyzed by quantitative RT-PCR the level of mRNA expression of Foxp3, CTLA-4, and GITR as markers of regulatory CD4 T cells. We showed that only Foxp3 was expressed at higher amounts (6-fold) in LFMBP lines as compared with MBP lines (Fig. 4A, p = 0.0008). This high expression of Foxp3 is unlikely the results of in vitro repeated stimulations since we have shown that the in vitro activation of naive rat CD4+CD25 T cells, using anti-TCR and anti-CD28 mAbs, does not induce the expression of Foxp3 (Ref.26 and our unpublished data). In addition, the difference in Foxp3 expression between the MBP lines and LFMBP lines is a stable phenomenon and is not influenced by stimulation cycles (stimulation II: the difference is 7-fold higher, mean of five to six lines; stimulation IV: the difference is 6-fold higher, mean of three lines). CTLA-4 and GITR mRNA expression did not differ between the LFMBP lines and MBP lines. We also analyzed the expression of chemokine receptors and showed that the LFMBP lines expressed similar mRNA amounts of CCR3 and CCR4, but higher amounts of CCR1 (5-fold, p = 0.002), CCR5 (4-fold, not significant), and CX3CR1 (29-fold, p = 0.002) than the MBP lines (Fig. 4B). Similar results were obtained when purified V
8.2+ and V
8.2 CD4 T cells were analyzed for the expression of these markers (data not shown). Taken together, these data demonstrate that MBP-specific CD4 T cells from LF 15-0195-treated animals express a particular pattern of chemokine receptors and contain Foxp3-expressing regulatory T cells.
|
|
does not abrogate the protection and the resistance to reinduction of EAE in LF-protected rats
TGF-
plays an essential role in the generation and maintenance of regulatory T cell numbers and function and in the induction of Foxp3 expression (27, 28, 29, 30). To evaluate the potential involvement of this cytokine in LF 15-0195-mediated tolerance, we neutralized endogenous TGF-
. The rats were injected i.v. seven times with the anti-TGF-
mAb (2G7) at a dose of 2 mg/injection on days 2, 0, 2, 4, 7, 9, and 11 after the primary or the secondary MBP sensitization. This protocol has been shown to efficiently neutralize TGF-
in the context of several models of autoimmunity, including EAE (31, 32). We showed that endogenous TGF-
production was dispensable for LF 15-0195 to mediate protection. Indeed, MBP-immunized rats treated daily with LF 15-0195 at 1 mg/kg for 30 days were still protected from EAE despite neutralization of endogenous TGF-
(Fig. 5A). Moreover, we showed that TGF-
did not play a role in the resistance of LF-protected rats to develop EAE after the second MBP immunization. Indeed, LF-protected rats, that were reimmunized with MBP and injected with anti-TGF-
mAb using the protocol described before, were still resistant to reinduction of EAE by MBP immunization (Fig. 5B). Taken together, these results suggest that LF 15-0195-mediated tolerance is not dependent on endogenous TGF-
.
|
| Discussion |
|---|
|
|
|---|
Several mechanisms have been proposed to explain the therapeutic effect of LF 15-0195. In bone marrow transplantation, LF 15-0195 has been shown to sensitize T cells to activation-induced cell death by increasing caspase activation at the DISC level in response to CD95 engagement (37). EAE induced in LEW rats by immunization with MBP lead to the generation of encephalitogenic T cells that use mainly the V
8.2 chain of the TCR and respond to the immunodominant MBP6888 peptide (6, 7). Therefore, we analyzed the effect of LF 15-0195 on the generation and pathogenic properties of these cells. Our data demonstrate that LF 15-0195 treatment does not delete MBP-specific V
8.2+ CD4 T cells but reduces the encephalitogenicity of MBP-specific CD4 T cells without affecting their state of activation and their in vitro response to whole MBP (Fig. 3) or to the immunodominant peptide (our unpublished data). This phenomenon is stable since it is maintained after several cycles of stimulation with MBP and is not reversible by the addition of IL-12 in vitro (17).
Our data are in agreement with observations reported in allograft transplantation (10) showing that: 1) LF 15-0195 treatment induces a permanent acceptance of a fully mismatched heart allograft only when the graft contains donor APCs and therefore when the recipient immune system is stimulated by direct presentation of alloantigens during the treatment and 2) this tolerance is mediated by donor-specific CD4 regulatory lymphocytes that are able to transfer protection to second syngeneic recipients which however reject a third-party allograft (10). In our model of autoimmunity, the tolerance induced by LF 15-0195 treatment requires also priming by the autoantigen during drug injections. Indeed, LEW rats immunized with OVA and treated with LF 15-0195, or treated with LF 15-0195 in the absence of MBP-immunization, are still susceptible to active EAE 4 wk after treatment withdrawal. These data suggest that, in both allotransplantation and autoimmunity, the tolerance induced by LF 15-0195 treatment is mediated by Ag-specific CD4 regulatory T cells that share several features in their generation and possibly in their functions. However, we have yet to characterize the mechanisms by which the LF 15-0195 favors the development of regulatory T cells.
Immune regulation of autoimmune disease can function at two sites: at lymphoid organs or in the target organ itself. As it has recently been suggested for a new regulatory T cell type with effector/memory phenotype (38), our results provide evidence that "LFMBP" regulatory T cells may preferentially migrate to the inflamed CNS to mediate regulation from an active disease process. Indeed, MBP-specific T cells from LF 15-0195-reated animals express high mRNA levels of the chemokine receptors CCR1 and CCR5, whose ligands (MIP-1
, MIP-1
,and RANTES) are produced in the inflamed CNS during EAE. These chemokines were shown to recruit encephalitogenic T cells (39), but also CD4+CD25+ regulatory T cells (40). In agreement with this hypothesis, it has been demonstrated recently that CD4 CD25+ regulatory cells contribute to natural recovery and protection from EAE within the CNS (41). LFMBP regulatory T cells also express high mRNA levels for the fractalkine receptor CX3CR1. Little is known about the expression pattern of CX3CR1 on functionally distinct T cells. A study on HIV-infected patients described CX3CR1 expression on a subset of CD8 T cells with inhibitory properties (42). Our data suggest that CX3CR1 is expressed on CD4 regulatory T cells involved in the control of EAE.
The tolerance induced by several drugs, including LF 15-0195, often results from their effect on the maturation of dendritic cells (43, 44, 45). Immature dendritic cells could indeed favor Ag-specific peripheral tolerance not only by decreasing the activation of effector cells but also by inducing the differentiation of T regulatory cells (46, 47). It is therefore possible that LF 15-0195 promotes regulatory T cells by affecting the maturation and function of dendritic cells as shown recently in a MHC-mismatched murine model of cardiac transplantation (45, 48). Alternatively, LF 15-0195 might act directly on T cells, since it has been shown recently that LF 15-0195 (11) as well as deoxyspergualin (49) inhibit the production of effector cytokines by T cells stimulated in vitro in the absence of APCs. Whether this effect is associated with the differentiation of T cells into regulatory T cells has not been tested.
TGF-
is one of the key factors contributing to peripheral tolerance. There is a large body of evidence suggesting that TGF-
is involved in the development and/or amplification of regulatory T cells via a mechanism other than direct suppression of responder cells. Indeed, TGF-
has been shown to induce Foxp3 expression by both murine and human CD25 CD4 T cells and to promote the acquisition of regulatory properties (27, 28, 29, 30). Importantly, the induction of Foxp3 by TGF-
requires stimulation through the TCR, suggesting that Ag-specific activation is required to induce such regulatory T cell responses. In the present study, we excluded the possibility that LF 15-0195 treatment favors the development of Foxp3-expressing regulatory T cells by inducing TGF-
production. Indeed, neutralization of endogenous TGF-
during LF 15-0195 treatment did not alter the beneficial effect of the drug. Consistent with this result, lymph node cells from protected rats failed to produce detectable levels of TGF-
after stimulation with MBP in vitro and expressed similar levels of TGF-
mRNA as control MBP-immunized nontolerant rats (our unpublished data). Furthermore, the neutralization of endogenous TGF-
in LF-protected rats also failed to affect the resistance to the second induction of active EAE. These results demonstrate that TGF-
is not required for either prevention or resistance to reinduction of EAE after LF 15-0195 treatment. The mode of action by which these LFMBP regulatory cells can regulate EAE remains an issue for further investigation.
As previously described, MBP-immunized LEW rats develop an acute monophasic illness from which they fully recover. Following recovery from this clinical episode, the rats develop a long-term resistance to further induction of disease (8, 50, 51). Despite numerous studies, the regulatory mechanisms that determine both the recovery process and the subsequent protection against reinduction of active EAE are not fully understood. In this study, we show that unlike convalescent LEW rats, the LF 15-0195-treated MBP-immunized LEW rats are resistant to the reinduction of active disease without having succumbed to a previous episode of EAE. It has been demonstrated that convalescent LEW rats also produce regulatory T cells, which inhibit the development of active EAE when transferred to syngeneic recipients (50, 52, 53). It is tempting to speculate that LF 15-0195 may inhibit the effector phase of EAE without affecting the regulatory phase of disease as it has demonstrated when animals were immunized with MBP in IFA. Alternatively, since LF 15-0195 promotes the generation of Foxp3-expressing regulatory T cells, it is conceivable that the regulatory T cells generated after LF 15-0195 treatment might be different from those generated in rats that spontaneously recovered from EAE. This hypothesis is under investigation.
Ideally, treatment of autoimmune diseases would require the induction of a long-lasting and Ag-specific tolerance. In the present study, we demonstrate that LF 15-0195, which can be used as preventive and curative treatment in experimental autoimmunity, induces a stable state of tolerance that is mediated by regulatory CD4 T cells. This tolerance is specific for Ags that have been presented to the immune system during LF 15-0195 treatment. Furthermore, continuous injections of this compound is not necessary, since rats injected with LF 15-0195 for 30 days are still free of clinical symptoms of EAE several months after treatment withdrawal. In that respect, the LF 15-0195 compound appears to be a promising molecule for the treatment of human autoimmune diseases.
| Acknowledgments |
|---|
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported by Fournier Laboratories, Institut National de la Santé et de la Médicale, French MS Society (Association pour la Recherche sur la Sclérose en Plaques), and European Community (QLG1-CT2001-01918). A.S. is supported by the Centre National de la Recherche Scientifique and V.D. by Fournier Laboratories. ![]()
2 V.D. and G.B. contributed equally to this work. ![]()
3 Address correspondence and reprint requests to Dr. Abdelhadi Saoudi, Institut National de la Santé et de la Médicale Unité 563, Hôpital Purpan, place du Dr Baylac, 31059 Toulouse, Cedex, France. E-mail address: asaoudi{at}toulouse.inserm.fr ![]()
4 Abbreviations used in this paper: EAE, experimental autoimmune encephalomyelitis; LD, length distribution; Foxp3: Forkhead/winged helix transcription factor; GITR, glucocorticoid-induced TNFR; MBP, myelin basic protein; HPRT, hypoxanthine phosphoribosyltransferase; Ct, cycle threshold; AU, arbitrary unit. ![]()
Received for publication April 19, 2005. Accepted for publication November 5, 2005.
| References |
|---|
|
|
|---|
8.2 segment. Eur. J. Immunol. 25: 1960-1964. [Medline]
and V
chain genes even though the major histocompatibility complex and encephalitogenic determinants being recognized are different. J. Exp. Med. 169: 27-39.
1 during lymphocyte activation: a study with a monoclonal antibody-based ELISA. J. Immunol. 145: 1415-1422. [Abstract]
B interaction in acute allograft rejection and CD40L-independent chronic allograft rejection. J. Immunol. 172: 1619-1629.
rearrangement in heart allografts. J. Immunol. 157: 1250-1260. [Abstract]
TCR transcripts during early acute allograft rejection and tolerance induction. J. Immunol. 168: 5088-5095.
7-TCR rearrangements in tolerated allografts. Transplantation. In press.
induction of transcription factor Foxp3. J. Exp. Med. 198: 1875-1886.
induces a regulatory phenotype in CD4+CD25 T cells through Foxp3 induction and down-regulation of Smad7. J. Immunol. 172: 5149-5153.
. J. Immunol. 174: 1446-1455.
1 maintains suppressor function and Foxp3 expression in CD4+CD25+ regulatory T cells. J. Exp. Med. 201: 1061-1067.
(TGF-
)-dependent inhibition of T helper cell (Th2)-induced autoimmunity by self-major histocompatibility (MHC) class II-specific, regulatory T cell lines. J. Exp. Med. 185: 1769-1775.
in the natural resistance to experimental allergic encephalomyelitis in rats. Eur. J. Immunol. 31: 1132-1140. [Medline]
,25-dihydroxyvitamin D3 and mycophenolate mofetil treatment mediate transplantation tolerance. J. Immunol. 167: 1945-1953.
B signaling through inhibition of IKK activity. J. Leukocyte Biol. 74: 438-447.
secretion during experimental allergic encephalomyelitis in Lewis rats. J. Neuroimmunol. 31: 165-177. [Medline]This article has been cited by other articles:
![]() |
R. A. O'Connor, K. H. Malpass, and S. M. Anderton The Inflamed Central Nervous System Drives the Activation and Rapid Proliferation of Foxp3+ Regulatory T Cells J. Immunol., July 15, 2007; 179(2): 958 - 966. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||