The JI Acurri Cytometers
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Duplan, V.
Right arrow Articles by Saoudi, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Duplan, V.
Right arrow Articles by Saoudi, A.
Right arrowPubmed/NCBI databases
*Substance via MeSH
The Journal of Immunology, 2006, 176: 839-847.
Copyright © 2006 by The American Association of Immunologists

LF 15-0195 Treatment Protects against Central Nervous System Autoimmunity by Favoring the Development of Foxp3-Expressing Regulatory CD4 T Cells1

Valérie Duplan2,*, Gaëlle Beriou2,{dagger}, Jean-Marie Heslan{dagger}, Corinne Bruand*, Patrick Dutartre, Lennart T. Mars*, Roland S. Liblau*, Maria-Cristina Cuturi{dagger} and Abdelhadi Saoudi3,*

* Institut National de la Santé et de la Recherche Médicale Unité 563, Institut Fédératif de recherche 30, and Université Paul Sabatier, Hôpital Purpan, Toulouse, France; {dagger} Institut National de la Santé et de la Médicale Unité 643 and Institut de Transplantation et de Recherche en Transplantation, Centre Hospitalier Universitaire Hôtel-Dieu, Nantes, France; and {ddagger} Laboratoires Fournier, Daix, France


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Experimental autoimmune encephalomyelitis (EAE) is an instructive model for the human demyelinating disease multiple sclerosis. Lewis (LEW) rats immunized with myelin-basic protein (MBP) develop EAE characterized by a single episode of paralysis, from which they recover spontaneously and become refractory to a second induction of disease. LF 15-0195 is a novel molecule that has potent immunosuppressive effects in several immune-mediated pathological manifestations, including EAE. In the present study, we show that a 30-day course of LF 15-0195 treatment not only prevents MBP-immunized LEW rats from developing EAE but also preserves their refractory phase to reinduction of disease. This effect is Ag driven since it requires priming by the autoantigen during the drug administration. In contrast to other immunosuppressive drugs, short-term treatment with this drug induces a persistent tolerance with no rebound of EAE up to 4 mo after treatment withdrawal. This beneficial effect of LF 15-0195 on EAE does not result from the deletion of MBP-specific V{beta}8.2 encephalitogenic T cells. In contrast, this drug favors the differentiation of MBP-specific CD4 T cells into Foxp3-expressing regulatory T cells that, upon adoptive transfer in syngeneic recipients, prevent the development of actively induced EAE. Finally, we demonstrate that the tolerance induced by LF 15-0195 treatment is not dependent on the presence of TGF-{beta}. Together, these data demonstrate that short-term treatment with LF 15-0195 prevents MBP-immunized LEW rats from EAE by favoring the development of Foxp-3-expressing regulatory CD4 T cells.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Experimental autoimmune encephalomyelitis (EAE)4 is a T cell-mediated autoimmune disease of the CNS that serves as model for the human demyelinating disease, multiple sclerosis (MS) (1, 2, 3, 4). EAE arises as a consequence of the breakdown of self-tolerance induced by the immunization of susceptible animals with myelin-derived Ags emulsified in CFA, or following adoptive transfer of T cell lines or clones specific for various myelin proteins (2, 3, 5). Encephalitogenic T cells use a limited number of TCR-{alpha} and -{beta} variable gene segments. In Lewis (LEW) rats immunized with myelin basic protein (MBP), encephalitogenic T cells respond to the immunodominant MBP68–88 epitope and mainly use the V{beta}8.2 chain of the TCR (6, 7). The clinical course of EAE varies according to the animal model and to the protocol used to induce the disease. In LEW rats, acute EAE is followed by a permanent remission and resistance to further disease induction (3, 5, 8). In other models of EAE, the remission may be transient and followed by relapses and remissions. The mechanisms responsible for the spontaneous recovery and resistance to disease reinduction, which may be similar to those responsible for spontaneous remissions seen in patients with relapsing-remitting MS, are still poorly understood. The ability to control the aggressive phase of disease without hindering the development of such immunoregulatory mechanisms would provide an attractive therapeutic approach for human immunological disorders such as MS.

LF 15-0195 is a potent and less toxic analog of the immunosuppressant 15-deoxyspergualine. LF 15-0195 has demonstrated therapeutic efficacy in animal models of allotransplantion (9, 10, 11, 12), xenotransplantation (13, 14), and autoimmune diseases (15, 16, 17). In EAE, we previously demonstrated that LF 15-0195 inhibits the effector phase of EAE by reducing the encephalitogenicity of MBP-specific CD4 T cells (17). This phenomenon is stable and long-lasting. Indeed, neither IL-12 nor repeated stimulation with naive APC and MBP in vitro rendered MBP-specific CD4 T cells from protected rats encephalitogenic. However, the mechanisms underlying this effect remain unknown and were investigated in the present study.

In this study, we show that MBP-immunized LEW rats protected from CNS autoimmunity by a 30-day course of LF 15-0195 treatment benefit from a long-lasting tolerance since they did not develop signs of disease 4 mo after treatment withdrawal. These protected rats are also refractory to second immunization with MBP in CFA, indicating that this immunosuppressive drug not only prevents LEW rats from EAE but also preserves their refractory phase. Finally, we show that this short-term treatment with LF 15-0195 does not delete the MBP-specific encephalitogenic T cells but favors the differentiation of MBP-specific Foxp3-expressing regulatory T cells.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Rats

Eight- to 10 wk-old male LEW rats were used in this study. These animals were obtained from the Centre d’Elevage R. Janvier (Le Genest St. Isle, France) and maintained in our animal house facility under specific pathogen-free conditions. All procedures were in accordance with national regulations on animal experimentation.

Induction, treatment, and clinical evaluation of EAE

To induce active EAE, LEW rats were injected in the hind footpads with 10 µg of guinea pig MBP emulsified in CFA containing 4 mg/ml heat-killed Mycobacterium tuberculosis H37Ra (Difco). MBP was prepared in our laboratory as previously described (18). A total of 100 µl of MBP-CFA was divided equally between the rear footpads. To induce passive EAE, MBP-specific T cell lines were derived from lymph node cells obtained from MBP-immunized donors and were adoptively transferred into naive syngeneic recipients. In some experiments, the recipients were lightly irradiated (250 rad). LF 15-0195 (Fournier Laboratories) was prepared in saline solution, adjusted at pH 7.2, and 300 µl was administered s.c. using a protocol previously shown to fully prevent EAE (17). The animals were injected daily with LF 15-0195 at 1 mg/kg for 30 days, starting the day of immunization. Control rats received either LF 15-0195 or saline without immunization with MBP, or were immunized with OVA and treated with LF 15-0195 as described before, or were immunized with MBP without LF 15-0195 treatment. Animals were scored daily for clinical signs of disease on a severity scale ranging from 0 to 6: 0, normal; 1, limp tail; 2, hind limb weakness; 3, unilateral hind limb paralysis; 4, bilateral hind limb paralysis; 5, bilateral hind limb paralysis and incontinence and 6, moribund. Clinical signs determined to be between any of these stages were given an intermediate score. The results are presented as the mean maximal score and/or as the mean cumulative score, calculated as the sum of daily disease scores of each individual animal.

Antibodies

The mAbs used for flow cytometry and for cell purification were as follows: W3/25 (anti-rat CD4), OX22 (anti-rat CD45RC), OX39 (anti-rat CD25), OX40 (anti-rat CD134), OX50 (anti-rat H-CAM), OX85 (anti-rat L selectin), R73 (anti-rat TCR-{alpha}{beta}), and R78 (anti-rat TCR V{beta}8.2). The hybridomas OX22, OX39, OX40, OX50, OX85, and W3/25 were provided by Dr. D. Mason (Sir William Dunn School of Pathology, Oxford, U.K.). FITC-conjugated OX22 and R73 mAbs and biotinylated W3/25, OX39, OX40, and OX85 mAbs were prepared in our laboratory according to standard protocols. PE-conjugated R73 and FITC-conjugated R78 are commercially available (BD Pharmingen). The anti-TGF-{beta} mAb (2G7) was injected i.v. as indicated in Results. 2G7 recognizes both the active and latent forms of TGF-{beta}1, TGF-{beta}2, and TGF-{beta}3 (19).

Generation of T cell lines and adoptive transfer of protection

Preparation and maintenance of T cell lines were performed as described elsewhere (20), with some modifications. Briefly, LEW rats immunized with MBP and treated or not daily with LF 15-0195 at a dose of 1 mg/kg for 12 days, starting the day of immunization with MBP. Rats were then killed and their popliteal lymph nodes were collected. Lymph node cells were resuspended at 4 x 106 viable cells/ml in complete medium containing 1% normal rat serum and 20 µg/ml MBP. The complete culture medium was RPMI 1640 (Invitrogen Life Technologies), 1% sodium pyruvate, 1% nonessential amino acids, 1% L-glutamine, 1% penicillin-streptomycin, and 2 x 10–5 M 2-ME. After 3 days, viable cells were separated using Ficoll-Hypaque and resuspended at 5 x 105/ml in complete medium containing 10% FCS and 10 U/ml rat IL-2. After 7 days of resting, the viable cells were recovered and resuspended at 5 x 105 cells/ml in complete medium with MBP (10 µg/ml) and irradiated syngeneic splenocytes (1.5 x 106 cells/ml) as a source of APC. After this second round of Ag stimulation, the same procedure was repeated for at least three cycles. Before the adoptive transfer, the T cell lines were stimulated with MBP at 2 µg/ml for 3 days. To analyze the ability of MBP-specific T cells generated from MBP-immunized LF15-0195-treated rats to prevent EAE, the T cell lines (obtained after four rounds of stimulation) were transferred into irradiated LEW rats 1 day before immunization with MBP (active EAE) or cotransferred with encephalitogenic "MBP lines" the same day (passive EAE).

Isolation of V{beta}8.2+ and V{beta}8.2 T cell subsets

MBP-specific T cell lines were separated into V{beta}8.2+ and V{beta}8.2 T cell subpopulations by positive and negative selection using magnetic beads. Viable MBP-specific CD4 T cells were incubated with FITC-anti-TCR V{beta}8.2 mAb and selected using anti-FITC magnetic beads (Automacs; Miltenyi Biotec). Purity of the sorted cells was assessed by flow cytometry using an XL Coulter flow cytometer (Coultronics) and was always higher than 90% (see Fig. 2A).



View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 2. Both V{beta} 8.2+ and V{beta} 8.2 MBP-specific CD4 T cells from LF-protected rats have a reduced ability to transfer EAE. MBP-specific T cell lines were generated from MBP-immunized and LF 15-0195-treated rats (LFMBP lines) or from control, MBP-immunized, untreated rats (MBP lines) after two rounds of stimulation with MBP, APCs, and rat IL-2. T cells among these lines were separated according to their expression of V{beta}8.2 TCR using FITC-conjugated R78 mAb and anti-FITC magnetic beads. A, The results are depicted as histograms of V{beta}8.2 expression by a representative MBP-specific line before (left panel) and after fractionation into V{beta}8.2+ (middle panel) and V{beta}8.2 (right panel) T cells. The percentage of V{beta}8.2+ T cell subsets is indicated and represents the purity of each cell population. B–D, Naive syngeneic LEW recipients were i.v. injected with 0.5 x 106 viable V{beta}8.2+ T cells (B, n = 7 for MBP lines and n = 6 for LFMBP lines) or with 0.5 x 106 (C, n = 4) or 3 x 106 (D, n = 4) V{beta}8.2 T cells purified from the LFMBP lines ({square}) or MBP lines ({blacksquare}). The results are expressed as the mean daily clinical score of each experimental group (upper panels) and as the mean cumulative disease score of each experimental group (lower panels). Results represent the pooled data of two independent experiments. *, p < 0.05; **, p < 0.01.

 
T cell stimulation and analysis of T cell proliferation and cytokine production

For proliferation and cytokine profile studies, MBP lines, "LFMBP lines" obtained after at least two cycles of stimulation or purified V{beta}8.2+ and V{beta}8.2 MBP-specific T cells, were resuspended at 2.5 x 105 cells/well in complete medium with MBP (10 µg/ml) and irradiated syngeneic splenocytes (105/well) in 96-well culture plates (Costar). Proliferation was measured by [3H]thymidine incorporation during the last 18 h of a 60-h culture period. Supernatants were removed after 36 and 60 h of culture and stored at –20°C for cytokine determination. IL-2, IFN-{gamma}, and IL-10 proteins in the supernatants were measured by specific ELISA (21).

Real-time quantitative RT-PCR

Total RNAs from MBP-specific T cells (1–3 x 106 cells) were extracted by the TRIzol procedure (Invitrogen Life Technologies). Genomic DNA was removed by DNase treatment (Turbo DNA-free; Ambion), and mRNAs were reverse transcribed. Real-time quantitative PCRs were performed in a ABI Prism 7700 Sequence Detection System (Applied Biosystems) using SYBR Green PCR Core Reagents (Applied Biosystems) as previously described (22). Primers used in this study were either previously published (23) or as follows: rat CCR1: forward, CAGGTGACTGAAGTGATTGCCT, reverse, AGCGGTATAGCCACATGCCT; rat CCR3: forward, GTCTGCTTTCCACAGCACATTT, reverse, CGCCAGGAAGGAATGAAATATA; rat CCR4: forward, GTTTGTGCTGTCTCTCCCGTT, reverse, AGCCCACCAGGTACATCCAT; rat CCR5: forward, TCAACCCTGTCATCTATGCCTT, reverse, GATCAGGATTGACTTGCTGGAA; and rat CX3CR1: forward, TGTCCTGAACTCACCAAGGGT, reverse, GGATGAGGAGTCAGCATGGAG. Data were normalized to hypoxanthine phosphoribosyltransferase (HPRT) levels and expressed as to 2–({Delta}{Delta}Ct gene – CtC{beta}), where the {Delta}{Delta}Ct = (Ctgene – CtHPRT)sample/(Ctgene CtHPRT)reference. Data were further expressed in arbitrary units (AU), in reference to the mean of "MBP line" samples (value = 1 AU).

TCR-V{beta} repertoire analysis

The TCR-V{beta} repertoire of MBP-specific T cell lines was analyzed both quantitatively and qualitatively using the TcLand technology. For the quantitative analysis, real-time quantitative PCRs were performed in a GenAmp 7700 Sequence Detection System using a C{beta} primer and 1 of the 21 V{beta} specific primers described previously (24). Data were expressed as the ratio of V{beta} transcripts levels to HPRT. For the qualitative analysis, TCR-V{beta}-CDR3 spectratyping was performed as previously described (25). Briefly, amplification product was submitted to a five-cycle elongation reaction using a dye-labeled C{beta} primer, then heat-denatured, loaded onto a 6% acrylamide-8 M urea gel, and electrophoresed using an ABI-377 DNA Sequencer (Applied Biosystems). The Immunoscope software (Institut Pasteur, Paris, France) resolved the raw data of DNA sequencing gel into sets of peaks separated by three nucleotides, including size and area of peaks representing the TCR-CDR3 length distribution profiles. The MatLab software was used to compute and display data as a conventional tridimensional TcLanscape profile. Percentage of CDR3-length distribution (LD) alteration (color scale) was calculated in reference to the Gaussian V{beta} profile exhibited by splenocytes and PBL from normal rats (n = 11) (green background depicted no alteration).

Statistical analysis

Results are expressed as mean ± SD and overall differences between variables were evaluated using the Mann-Whitney U test. Analysis of severity score solely included animals developing EAE.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
LEW rats protected from active EAE by LF 15-0195 treatment are also resistant to further induction of EAE after LF 15-0195 withdrawal

It is well documented that LEW rats immunized with MBP develop an acute EAE from which they fully recover and become resistant to further induction of disease (3, 5, 8). We previously reported that both clinical and histological manifestations of EAE were significantly suppressed by s.c. administration of LF 15-0195 to MBP-immunized LEW rats (17). In this study, we investigated the effect of this treatment on the resistance phase of EAE (Table I). All 25 LEW rats immunized with MBP-CFA (group 1) developed a severe clinical EAE that killed 48% of the animals. As expected, the surviving rats were however resistant to a second induction of active EAE. Indeed, the seven convalescent rats that were challenged with MBP 49 days after the primary sensitization developed a significantly less severe EAE than MBP-immunized age-matched control rats (group 1 vs group 5; p = 0.006). LEW rats sensitized with MBP-CFA and treated with a daily dose of 1 mg/kg LF 15-0195 for 30 days, starting the day of immunization, displayed a significant reduction of prevalence and severity of clinical EAE (group 2). Indeed, only 14 animals among 41 developed a delayed (22.2 ± 0.9 vs 11.5 ± 1.1, p = 0.0001) and milder (1.3 ± 0.8 vs 5.1 ± 1.3, p = 0.0001) clinical EAE as compared with the MBP-immunized rats (group 1). Among the 27 rats that were fully protected from EAE ("LF-protected rats"), 6 rats were followed for 4 mo after treatment withdrawal and none developed clinical signs of EAE. The remaining 21 LF-protected rats were challenged with MBP-CFA 7 wk after the primary immunization. Thirteen rats were totally resistant to reinduction of active EAE, while the remaining 8 rats developed a milder disease than age-matched control rats (group 2 vs group 5, p = 0.04). LEW rats that were treated with LF 15-0195 and immunized (group 3) or not (group 4) with an irrelevant Ag, OVA, did not show any degree of protection after immunization with MBP 49 days after the initiation of LF 15-0195 administration. They were as susceptible to EAE as age-matched control rats (group 5). Collectively, these data show that short treatment with LF 15-0195 is sufficient to induce a long-lasting tolerance since the LF-protected rats did not develop signs of disease 4 mo after treatment was ceased. Interestingly, LF-protected rats are refractory to a second induction of an active EAE, demonstrating that this treatment not only prevents LEW rats from EAE but preserves their refractory phase. This effect is Ag driven since it requires priming by the autoantigen during drug administration.


View this table:
[in this window]
[in a new window]
 
Table I. LEW rats protected from active EAE by LF 15–0195 treatment are resistant to a second induction of active EAE

 
Both V{beta}8.2+ and V{beta}8.2 MBP-specific CD4 T cells from LF 15-0195-treated rats have a diminished capacity to transfer EAE

In accordance with our previous report, MBP-specific CD4 T cell lines generated from lymph nodes of MBP-immunized LF 15-0195-treated animals (LFMBP lines) have a significantly reduced ability to transfer EAE to syngeneic recipients (Fig. 1A, p = 0.03) as compared with those generated from MBP-immunized untreated rats (MBP lines). Since LEW MBP-specific encephalitogenic T cells mainly use V{beta}8.2 (6, 7), we first analyzed the effect of LF 15-0195 treatment on the T cell repertoire using TcLand technology. We analyzed the T cell repertoire of MBP-specific CD4 T cell lines generated from MBP-immunized LEW rats, treated or not with LF 15-0195, after six (Fig. 1B) or four rounds of stimulation (data not shown). As expected, the TCR repertoire of the MBP lines (Fig. 1B, left panel) was clearly dominated by the V{beta}8.2 family. The V{beta}8.2 transcripts were strongly accumulated, as revealed by the peak height, and highly altered, as depicted by the red color associated with a short CDR3 length of five amino acids. We showed that, although MBP-specific CD4 T cells from LF 15-0195-treated rats were modestly encephalitogenic, they nevertheless expressed the V{beta}8.2 gene product (Fig. 1B, right panel), which was accumulated and altered (CDR3 length, five to six amino acids) to the same extent as in the MBP lines. These results raised two hypotheses: either the V{beta}8.2+ cells in the LFMBP lines are less potent to transfer EAE or the V{beta}8.2+ cells from the LFMBP lines are fully potent, but regulated by other T cells (V{beta}8.2). To test these hypotheses, we purified V{beta}8.2+ and V{beta}8.2 CD4 T cells from T cell lines generated from MBP-immunized rats, treated or not with LF 15-0195 (Fig. 2A), and compared their ability to transfer EAE to syngeneic recipients. All LEW rats injected either with V{beta}8.2+ CD4 T cells purified from MBP lines (0.5 x 106 cells/rat, n = 7, Fig. 2B) or high numbers of V{beta}8.2 cells (3 x 106 cells/rat, n = 4, Fig. 2D) developed a classical EAE with a maximal clinical score around day 6 after transfer, followed by spontaneous recovery from disease. In contrast, similar numbers of MBP-specific V{beta}8.2+ or V{beta}8.2 T cells purified from LFMBP lines have a very reduced capacity to transfer EAE; the six LEW rats injected with 0.5 x 106 V{beta}8.2+ cells (Fig. 2B) and the four LEW rats injected with 3 x 106 V{beta}8.2 cells (Fig. 2D) purified from LFMBP lines developed a very mild form of the disease (p = 0.001 and p = 0.03, respectively), which appeared later than in controls injected with MBP lines.



View larger version (40K):
[in this window]
[in a new window]
 
FIGURE 1. CD4 T cells from LF-protected rats have a reduced ability to transfer EAE but still express V{beta}8.2 chain of the TCR. A, Adoptive transfer of EAE with MBP-specific T cell lines generated after four rounds of stimulation with MBP, APCs, and rat IL-2 as described in Materials and Methods. Naive syngeneic LEW rats were injected i.v. with 106 viable T cells generated from lymph nodes of MBP-immunized and LF 15-0195-treated rats (LFMBP lines, {square}, n = 4) or from MBP-immunized, untreated rats (MBP lines, {blacksquare}, n = 4). The results are expressed as the mean daily clinical scores of each experimental group (left panel) and as the mean cumulative disease score of each experimental group, calculated as the sum of the daily disease score for each individual animal (right panel). Results are representative of two independent experiments. *, p < 0.05 using the Mann-Whitney U test. B, The TCR repertoires of both T cell lines were analyzed by the TcLand technology as described in Materials and Methods. One representative TcLandscape profile of MBP lines (n = 4, left panel) and LFMBP lines (n = 4, right panel), harvested after six rounds of stimulation with MBP, APCs, and IL-2, are shown: the x-axis displays the 21 rat TCR V{beta} families, the y-axis gives the V{beta}/HPRT transcript ratios, and the z-axis gives the 13 possible CDR3 lengths. The color scale represents the percentage of CDR3-LD alteration, ranging from deep blue (value ≤50% of CDR3-LD alteration) to dark red (>50% of CDR3-LD alteration), with green representing unaltered (Gaussian) CDR3-LD. TcLandscape profiles depicted the strong accumulation of the V{beta}8.2 transcripts in both the MBP lines (left panel) and LF-MBP lines (right panel), as well as the restricted TCR-CDR3-LD (red color and Immunoscope profile inlet).

 
Together, these data demonstrate that the beneficial effect of LF 15-0195 treatment does not result from the deletion of V{beta}8.2+ encephalitogenic CD4 T cells, but rather from its ability to reduce the encephalitogenicity of both V{beta}8.2+ and V{beta}8.2 MBP-specific CD4 T cells.

Non-encephalitogenic MBP-specific CD4 T cells from LF 15-0195-treated rats prevent the development of actively, but not of passively, induced EAE

We previously demonstrated that the reduced ability of MBP-specific CD4 T cells from LF 15-0195-treated rats to transfer EAE is a stable phenomenon and could not be explained by a difference in cytokine production (17). Indeed, LFMBP lines generated in the presence of IL-12 have a cytokine profile comparable to encephalitogenic MBP lines but are nevertheless incapable of transferring EAE. We therefore tested for the presence of regulatory cells in LF-protected rats by transferring protection with LFMBP lines into naive syngeneic LEW rats that were slightly irradiated (250 rad) 1 day prior to the transfer. The recipients were immunized with MBP-CFA on the day of cell transfer. As shown in Table II, the adoptive transfer of 2.5 x 106 (group 4) or 5 x 106 (group5) MBP-primed LFMBP lines significantly reduced the severity and lethality of EAE induced by immunization with MBP. Indeed, all recipients developed a mild form of EAE as compared with MBP-immunized rats that were injected with PBS (group 1 vs group 4, p = 0.04; group 1 vs group 5, p = 0.003) or with MBP lines (group 3 vs group 4, p = 0.02; group 3 vs group 5, p = 0.01). We also showed that the administration of a high number of lymph node cells (60 x 106, Table II, group 2) or spleen cells (200 x 106, data not shown) from naive rats did not prevent active EAE. In contrast, these regulatory LFMBP lines are incapable of suppressing adoptively transferred EAE (Table II, group 8). Indeed, the animals transferred with 106 MBP lines associated with 106 LFMBP lines still developed severe clinical EAE. Altogether these data exclude the involvement of deletion, anergy, or ignorance, three passive mechanisms that are not consistent with results showing transfer of protection against active EAE in syngeneic recipients. In contrast, these data favor the implication of active tolerance mechanism mediated by regulatory CD4 T cells. These regulatory T cells are efficient at preventing active but not passive EAE, suggesting that these cells function at the inductive rather than the effector phase of EAE.


View this table:
[in this window]
[in a new window]
 
Table II. MBP-specific CD4 T cells from LF-protected rats prevent from actively but not from passively induced EAE

 
Non-encephalitogenic MBP-specific CD4 T cell lines from LF 15-0195-treated rats overexpress Foxp3 and have a particular chemokine-receptor pattern

To better characterize the MBP-specific CD4 regulatory T cells from LF 15-0195-treated rats, we analyzed their state of activation, their cytokine profiles, and their expression of regulatory molecules and chemokine receptors. By flow cytometry analysis, we showed that the LFMBP lines and MBP lines were CD4+TCR{alpha}{beta}+ and expressed similar levels of activation markers (CD45RC, CD134, L-selectin, CD25, CD44) (data not shown). In response to MBP stimulation, the LFMBP lines proliferated equally well (Fig. 3A) and produced a similar amount of proinflammatory cytokine, IFN-{gamma} (Fig. 3B), but a lower amount of IL-10 (Fig. 3C) and IL-2 (Fig. 3D) than the MBP lines. We analyzed by quantitative RT-PCR the level of mRNA expression of Foxp3, CTLA-4, and GITR as markers of regulatory CD4 T cells. We showed that only Foxp3 was expressed at higher amounts (6-fold) in LFMBP lines as compared with MBP lines (Fig. 4A, p = 0.0008). This high expression of Foxp3 is unlikely the results of in vitro repeated stimulations since we have shown that the in vitro activation of naive rat CD4+CD25 T cells, using anti-TCR and anti-CD28 mAbs, does not induce the expression of Foxp3 (Ref.26 and our unpublished data). In addition, the difference in Foxp3 expression between the MBP lines and LFMBP lines is a stable phenomenon and is not influenced by stimulation cycles (stimulation II: the difference is 7-fold higher, mean of five to six lines; stimulation IV: the difference is 6-fold higher, mean of three lines). CTLA-4 and GITR mRNA expression did not differ between the LFMBP lines and MBP lines. We also analyzed the expression of chemokine receptors and showed that the LFMBP lines expressed similar mRNA amounts of CCR3 and CCR4, but higher amounts of CCR1 (5-fold, p = 0.002), CCR5 (4-fold, not significant), and CX3CR1 (29-fold, p = 0.002) than the MBP lines (Fig. 4B). Similar results were obtained when purified V{beta}8.2+ and V{beta}8.2 CD4 T cells were analyzed for the expression of these markers (data not shown). Taken together, these data demonstrate that MBP-specific CD4 T cells from LF 15-0195-treated animals express a particular pattern of chemokine receptors and contain Foxp3-expressing regulatory T cells.



View larger version (14K):
[in this window]
[in a new window]
 
FIGURE 3. Proliferation and cytokine profile of MBP-specific CD4 T cells from LF-protected rats. LFMBP lines ({square}, n = 3) and MBP lines ({blacksquare}, n = 3) were generated after four rounds of stimulation with MBP, APCs, and IL-2. These lines were stimulated in vitro with 10 µg/ml MBP and irradiated spleen cells. A, Proliferation was assessed with an 18-h [3H]thymidine pulse added after 42 h of culture. Tissue culture supernatants collected 60 h after MBP stimulation were assayed for IFN-{gamma} (B) and IL-10 (C) proteins using capture ELISA. IL-2 production (D) was tested 36 h after MBP stimulation. The results are from three independent experiments. To pool these independent experiments, the results were normalized. In each experiment, the results are expressed as AU by considering MBP lines + LFMBP line = 100 AU.

 


View larger version (13K):
[in this window]
[in a new window]
 
FIGURE 4. MBP-specific CD4 T cells from LF-protected rats overexpress Foxp3 and have a particular pattern of chemokine receptors. MBP-specific T cell lines were generated from MBP-immunized and LF 15-0195-treated rats (LFMBP lines, n = 3, {square}) or from control, MBP-immunized, untreated rats (MBP lines, n = 3, {blacksquare}) rats after four rounds of stimulation with MBP, APCs, and rat IL-2 as described in Materials and Methods. Both cell lines were tested for expression of regulatory T cell markers (A) and chemokine receptors (B) by quantitative RT-PCR. The results are relative to HPRT and expressed in AU, where the 1 value represents the mean of the MBP lines. Results are representative of three independent experiments. **, p < 0.01

 
Neutralization of endogenous TGF-{beta} does not abrogate the protection and the resistance to reinduction of EAE in LF-protected rats

TGF-{beta} plays an essential role in the generation and maintenance of regulatory T cell numbers and function and in the induction of Foxp3 expression (27, 28, 29, 30). To evaluate the potential involvement of this cytokine in LF 15-0195-mediated tolerance, we neutralized endogenous TGF-{beta}. The rats were injected i.v. seven times with the anti-TGF-{beta} mAb (2G7) at a dose of 2 mg/injection on days –2, 0, 2, 4, 7, 9, and 11 after the primary or the secondary MBP sensitization. This protocol has been shown to efficiently neutralize TGF-{beta} in the context of several models of autoimmunity, including EAE (31, 32). We showed that endogenous TGF-{beta} production was dispensable for LF 15-0195 to mediate protection. Indeed, MBP-immunized rats treated daily with LF 15-0195 at 1 mg/kg for 30 days were still protected from EAE despite neutralization of endogenous TGF-{beta} (Fig. 5A). Moreover, we showed that TGF-{beta} did not play a role in the resistance of LF-protected rats to develop EAE after the second MBP immunization. Indeed, LF-protected rats, that were reimmunized with MBP and injected with anti-TGF-{beta} mAb using the protocol described before, were still resistant to reinduction of EAE by MBP immunization (Fig. 5B). Taken together, these results suggest that LF 15-0195-mediated tolerance is not dependent on endogenous TGF-{beta}.



View larger version (12K):
[in this window]
[in a new window]
 
FIGURE 5. Neutralization of endogenous TGF-{beta} does not abrogate the protective effect of LF 15-0195 treatment. A, LEW rats were immunized with MBP and treated with LF 15-0195 daily at 1 mg/kg for 30 days, starting from the day of immunization, and were treated ({cjs2108}, n = 5) or not ({square}, n = 15) with anti-TGF-{beta} mAb. The anti-TGF-{beta} mAb (2 mg/injection) was i.v. injected seven times on days –2, 0, 2, 4, 7, 9, and 11 after MBP sensitization. The control rats were LEW rats immunized with MBP in CFA {blacksquare}, n = 5). B, LF-protected rats were reimmunized with MBP-CFA 3 wk after treatment withdrawal and were injected ({cjs2108}, n = 5) or not ({square}, n = 5) with anti-TGF-{beta} mAb as indicated above, starting at the second MBP immunization. The control rats were age-matched naive rats that were immunized with MBP-CFA ({blacksquare}, n = 4). The results are expressed as the mean cumulative disease scores of each experimental group.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The deoxyspergualin derivative LF 15-0195 has demonstrated therapeutic efficacy in animal models of immune-mediated disorders including autoimmune diseases (17). In the present study, we show that LF 15-0195 treatment induces a persistent tolerance in MBP-immunized LEW rats since, and in contrast to other immunosuppressive drugs such as cyclosporin A (33), the EAE-protected rats did not develop a rebound of EAE 4 mo after treatment withdrawal. We also demonstrate that LF 15-0195 treatment, not only reduces the encephalitogenicity of autoantigen-specific CD4 T cells, but induces active tolerance mechanism mediated by regulatory or suppressor CD4 T cells. Indeed, 1) after their adoptive transfer, MBP-specific CD4 T cells from LF 15-0195-treated rats prevent syngeneic recipients from lethal EAE induced by MBP immunization (Table II) and 2) MBP-specific CD4 T cells from LF-treated rats express high levels of Foxp3, currently the best molecular marker of rodent T cells with immune-suppressive functions (34, 35, 36). These data also exclude the involvement of deletion, anergy, and ignorance, passive mechanisms that are not consistent with data showing transfer of tolerance to syngeneic recipients.

Several mechanisms have been proposed to explain the therapeutic effect of LF 15-0195. In bone marrow transplantation, LF 15-0195 has been shown to sensitize T cells to activation-induced cell death by increasing caspase activation at the DISC level in response to CD95 engagement (37). EAE induced in LEW rats by immunization with MBP lead to the generation of encephalitogenic T cells that use mainly the V{beta}8.2 chain of the TCR and respond to the immunodominant MBP68–88 peptide (6, 7). Therefore, we analyzed the effect of LF 15-0195 on the generation and pathogenic properties of these cells. Our data demonstrate that LF 15-0195 treatment does not delete MBP-specific V{beta}8.2+ CD4 T cells but reduces the encephalitogenicity of MBP-specific CD4 T cells without affecting their state of activation and their in vitro response to whole MBP (Fig. 3) or to the immunodominant peptide (our unpublished data). This phenomenon is stable since it is maintained after several cycles of stimulation with MBP and is not reversible by the addition of IL-12 in vitro (17).

Our data are in agreement with observations reported in allograft transplantation (10) showing that: 1) LF 15-0195 treatment induces a permanent acceptance of a fully mismatched heart allograft only when the graft contains donor APCs and therefore when the recipient immune system is stimulated by direct presentation of alloantigens during the treatment and 2) this tolerance is mediated by donor-specific CD4 regulatory lymphocytes that are able to transfer protection to second syngeneic recipients which however reject a third-party allograft (10). In our model of autoimmunity, the tolerance induced by LF 15-0195 treatment requires also priming by the autoantigen during drug injections. Indeed, LEW rats immunized with OVA and treated with LF 15-0195, or treated with LF 15-0195 in the absence of MBP-immunization, are still susceptible to active EAE 4 wk after treatment withdrawal. These data suggest that, in both allotransplantation and autoimmunity, the tolerance induced by LF 15-0195 treatment is mediated by Ag-specific CD4 regulatory T cells that share several features in their generation and possibly in their functions. However, we have yet to characterize the mechanisms by which the LF 15-0195 favors the development of regulatory T cells.

Immune regulation of autoimmune disease can function at two sites: at lymphoid organs or in the target organ itself. As it has recently been suggested for a new regulatory T cell type with effector/memory phenotype (38), our results provide evidence that "LFMBP" regulatory T cells may preferentially migrate to the inflamed CNS to mediate regulation from an active disease process. Indeed, MBP-specific T cells from LF 15-0195-reated animals express high mRNA levels of the chemokine receptors CCR1 and CCR5, whose ligands (MIP-1{alpha}, MIP-1{beta},and RANTES) are produced in the inflamed CNS during EAE. These chemokines were shown to recruit encephalitogenic T cells (39), but also CD4+CD25+ regulatory T cells (40). In agreement with this hypothesis, it has been demonstrated recently that CD4 CD25+ regulatory cells contribute to natural recovery and protection from EAE within the CNS (41). LFMBP regulatory T cells also express high mRNA levels for the fractalkine receptor CX3CR1. Little is known about the expression pattern of CX3CR1 on functionally distinct T cells. A study on HIV-infected patients described CX3CR1 expression on a subset of CD8 T cells with inhibitory properties (42). Our data suggest that CX3CR1 is expressed on CD4 regulatory T cells involved in the control of EAE.

The tolerance induced by several drugs, including LF 15-0195, often results from their effect on the maturation of dendritic cells (43, 44, 45). Immature dendritic cells could indeed favor Ag-specific peripheral tolerance not only by decreasing the activation of effector cells but also by inducing the differentiation of T regulatory cells (46, 47). It is therefore possible that LF 15-0195 promotes regulatory T cells by affecting the maturation and function of dendritic cells as shown recently in a MHC-mismatched murine model of cardiac transplantation (45, 48). Alternatively, LF 15-0195 might act directly on T cells, since it has been shown recently that LF 15-0195 (11) as well as deoxyspergualin (49) inhibit the production of effector cytokines by T cells stimulated in vitro in the absence of APCs. Whether this effect is associated with the differentiation of T cells into regulatory T cells has not been tested.

TGF-{beta} is one of the key factors contributing to peripheral tolerance. There is a large body of evidence suggesting that TGF-{beta} is involved in the development and/or amplification of regulatory T cells via a mechanism other than direct suppression of responder cells. Indeed, TGF-{beta} has been shown to induce Foxp3 expression by both murine and human CD25 CD4 T cells and to promote the acquisition of regulatory properties (27, 28, 29, 30). Importantly, the induction of Foxp3 by TGF-{beta} requires stimulation through the TCR, suggesting that Ag-specific activation is required to induce such regulatory T cell responses. In the present study, we excluded the possibility that LF 15-0195 treatment favors the development of Foxp3-expressing regulatory T cells by inducing TGF-{beta} production. Indeed, neutralization of endogenous TGF-{beta} during LF 15-0195 treatment did not alter the beneficial effect of the drug. Consistent with this result, lymph node cells from protected rats failed to produce detectable levels of TGF-{beta} after stimulation with MBP in vitro and expressed similar levels of TGF-{beta} mRNA as control MBP-immunized nontolerant rats (our unpublished data). Furthermore, the neutralization of endogenous TGF-{beta} in LF-protected rats also failed to affect the resistance to the second induction of active EAE. These results demonstrate that TGF-{beta} is not required for either prevention or resistance to reinduction of EAE after LF 15-0195 treatment. The mode of action by which these LFMBP regulatory cells can regulate EAE remains an issue for further investigation.

As previously described, MBP-immunized LEW rats develop an acute monophasic illness from which they fully recover. Following recovery from this clinical episode, the rats develop a long-term resistance to further induction of disease (8, 50, 51). Despite numerous studies, the regulatory mechanisms that determine both the recovery process and the subsequent protection against reinduction of active EAE are not fully understood. In this study, we show that unlike convalescent LEW rats, the LF 15-0195-treated MBP-immunized LEW rats are resistant to the reinduction of active disease without having succumbed to a previous episode of EAE. It has been demonstrated that convalescent LEW rats also produce regulatory T cells, which inhibit the development of active EAE when transferred to syngeneic recipients (50, 52, 53). It is tempting to speculate that LF 15-0195 may inhibit the effector phase of EAE without affecting the regulatory phase of disease as it has demonstrated when animals were immunized with MBP in IFA. Alternatively, since LF 15-0195 promotes the generation of Foxp3-expressing regulatory T cells, it is conceivable that the regulatory T cells generated after LF 15-0195 treatment might be different from those generated in rats that spontaneously recovered from EAE. This hypothesis is under investigation.

Ideally, treatment of autoimmune diseases would require the induction of a long-lasting and Ag-specific tolerance. In the present study, we demonstrate that LF 15-0195, which can be used as preventive and curative treatment in experimental autoimmunity, induces a stable state of tolerance that is mediated by regulatory CD4 T cells. This tolerance is specific for Ags that have been presented to the immune system during LF 15-0195 treatment. Furthermore, continuous injections of this compound is not necessary, since rats injected with LF 15-0195 for 30 days are still free of clinical symptoms of EAE several months after treatment withdrawal. In that respect, the LF 15-0195 compound appears to be a promising molecule for the treatment of human autoimmune diseases.


    Acknowledgments
 
We thank Dr. Daniel Gonzalez-Dunia for critically reading this manuscript, Isabelle Bernard for excellent technical assistance, and Maryline Calise, Patrick Aregui, and Audry Boyer (Institut Fedératif de Recherche 30, Toulouse, France) for taking care of the animal house.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by Fournier Laboratories, Institut National de la Santé et de la Médicale, French MS Society (Association pour la Recherche sur la Sclérose en Plaques), and European Community (QLG1-CT2001-01918). A.S. is supported by the Centre National de la Recherche Scientifique and V.D. by Fournier Laboratories. Back

2 V.D. and G.B. contributed equally to this work. Back

3 Address correspondence and reprint requests to Dr. Abdelhadi Saoudi, Institut National de la Santé et de la Médicale Unité 563, Hôpital Purpan, place du Dr Baylac, 31059 Toulouse, Cedex, France. E-mail address: asaoudi{at}toulouse.inserm.fr Back

4 Abbreviations used in this paper: EAE, experimental autoimmune encephalomyelitis; LD, length distribution; Foxp3: Forkhead/winged helix transcription factor; GITR, glucocorticoid-induced TNFR; MBP, myelin basic protein; HPRT, hypoxanthine phosphoribosyltransferase; Ct, cycle threshold; AU, arbitrary unit. Back

Received for publication April 19, 2005. Accepted for publication November 5, 2005.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Steinman, L.. 1996. Multiple sclerosis: a coordinated immunological attack against myelin in the central nervous system. Cell 95: 299-302.
  2. Raine, C. S.. 1984. Analysis of autoimmune demyelination: its impact upon multiple sclerosis. Lab. Invest. 50: 608-635. [Medline]
  3. Swanborg, R.. 1995. Experimental autoimmune encephalomyelitis in rodents as a model for human demyelinating disease. Clin. Immunol. Immunopathol. 77: 4-13. [Medline]
  4. Storch, M. K., A. Stefferl, U. Brehm, R. Weissert, E. Wallstrom, M. Kerschensteiner, T. Olsson, C. Linington, H. Lassmann. 1998. Autoimmunity to myelin oligodendrocyte glycoprotein in rats mimics the spectrum of multiple sclerosis pathology. Brain Pathol. 8: 681-694. [Medline]
  5. Mason, D.. 1991. Genetic variation in the stress response: susceptibility to experimental allergic encephalomyelitis and implications for human inflammatory disease. Immunol. Today 12: 57-60. [Medline]
  6. Imrich, H., C. Kugler, N. Torres-Nagel, R. Dorries, T. Hunig. 1995. Prevention and treatment of Lewis rat experimental allergic encephalomyelitis with a monoclonal antibody to the T cell receptor V{beta}8.2 segment. Eur. J. Immunol. 25: 1960-1964. [Medline]
  7. Burns, F. R., X. B. Li, N. Shen, H. Offner, Y. K. Chou, A. A. Vandenbark, E. Heber-Katz. 1989. Both rat and mouse T cell receptors specific for the encephalitogenic determinant of myelin basic protein use similar V{alpha} and V{beta} chain genes even though the major histocompatibility complex and encephalitogenic determinants being recognized are different. J. Exp. Med. 169: 27-39. [Abstract/Free Full Text]
  8. MacPhee, I. A., D. W. Mason. 1990. Studies on the refractoriness to reinduction of experimental allergic encephalomyelitis in Lewis rats that have recovered from one episode of the disease. J. Neuroimmunol. 27: 9-19. [Medline]
  9. Zhou, D., C. O’Brien, J. Shum, B. Garcia, W. Min, A. M. Jevnikar, P. Dutartre, R. Zhong. 2003. LF 15-0195, a novel immunosuppressive agent prevents rejection and induces operational tolerance in a mouse cardiac allograft model. Transplantation 76: 644-650. [Medline]
  10. Chiffoleau, E., G. Beriou, P. Dutartre, C. Usal, J. P. Soulillou, M. C. Cuturi. 2002. Role for thymic and splenic regulatory CD4+ T cells induced by donor dendritic cells in allograft tolerance by LF15-0195 treatment. J. Immunol. 168: 5058-5069. [Abstract/Free Full Text]
  11. Chiffoleau, E., G. Beriou, P. Dutartre, C. Usal, J. P. Soulillou, M. C. Cuturi. 2002. Induction of donor-specific allograft tolerance by short-term treatment with LF15-0195 after transplantation: evidence for a direct effect on T-cell differentiation. Am. J. Transplant. 2: 745-757. [Medline]
  12. Yang, H., G. Chen, N. Kanai, J. Shum, B. Garcia, X. Huang, W. Min, Y. Luo, P. Dutartre, R. Zhong. 2003. Monotherapy with LF 15-0195, an analogue of 15-deoxyspergualin, significantly prolongs renal allograft survival in monkeys. Transplantation 75: 1166-1171. [Medline]
  13. Wang, H., K. A. Hosiawa, B. Garcia, J. B. Shum, P. Dutartre, D. J. Kelvin, R. Zhong. 2003. Treatment with a short course of LF 15-0195 and continuous cyclosporin A attenuates acute xenograft rejection in a rat-to-mouse cardiac transplantation model. Xenotransplantation 10: 325-336. [Medline]
  14. Wang, H., K. A. Hosiawa, B. Garcia, J. B. Shum, P. Dutartre, D. J. Kelvin, R. Zhong. 2003. Attenuation of acute xenograft rejection by short-term treatment with LF15-0195 and monoclonal antibody against CD45RB in a rat-to-mouse cardiac transplantation model. Transplantation 75: 1475-1481. [Medline]
  15. Ducoroy, P., D. de Fornel, F. Chirade, P. Fontet, P. Dutartre. 2001. The immunosuppressant LF-150195 inhibits the progression of established collagen-induced arthritis by blockage of anticollagen IgG2a production. Transplant. Proc. 33: 2281-2283. [Medline]
  16. Duplan, V., P. Dutartre, P. Druet, A. Saoudi. 2002. LF 15-0195 prevents from the development and inhibits the progression of rat experimental autoimmune myasthenia gravis. J. Neuroimmunol. 129: 115-124. [Medline]
  17. Duplan, V., P. Dutartre, L. T. Mars, R. S. Liblau, P. Druet, A. Saoudi. 2003. LF 15-0195 inhibits the development of rat central nervous system autoimmunity by inducing long-lasting tolerance in autoreactive CD4 T cells. J. Immunol. 170: 2179-2185. [Abstract/Free Full Text]
  18. Brostoff, S. W., D. W. Mason. 1984. Experimental allergic encephalomyelitis: successful treatment in vivo with a monoclonal antibody that recognizes T helper cells. J. Immunol. 133: 1938-1942. [Abstract]
  19. Lucas, C., L. N. Bald, B. M. Fendly, M. Mora-Worms, I. S. Figari, E. J. Patzer, M. A. Palladino. 1990. The autocrine production of transforming growth factor-{beta}1 during lymphocyte activation: a study with a monoclonal antibody-based ELISA. J. Immunol. 145: 1415-1422. [Abstract]
  20. Ben-Nun, A., H. Wekerle, I. R. Cohen. 1981. Vaccination against autoimmune encephalomyelitis with T-lymphocyte line cells reactive against myelin basic protein. Nature 292: 60-61. [Medline]
  21. Cautain, B., J. Damoiseaux, I. Bernard, E. Xystrakis, E. Fournie, P. van Breda Vriesman, P. Druet, A. Saoudi. 2002. The CD8 T cell compartment plays a dominant role in the deficiency of Brown-Norway rats to mount a proper type 1 immune response. J. Immunol. 168: 162-170. [Abstract/Free Full Text]
  22. Guillonneau, C., C. Louvet, K. Renaudin, J. M. Heslan, M. Heslan, L. Tesson, C. Vignes, C. Guillot, Y. Choi, L. A. Turka, M. C. Cuturi, I. Anegon, R. Josien. 2004. The role of TNF-related activation-induced cytokine-receptor activating NF-{kappa}B interaction in acute allograft rejection and CD40L-independent chronic allograft rejection. J. Immunol. 172: 1619-1629. [Abstract/Free Full Text]
  23. Xystrakis, E., A. S. Dejean, I. Bernard, P. Druet, R. Liblau, D. Gonzalez-Dunia, A. Saoudi. 2004. Identification of a novel natural regulatory CD8 T-cell subset and analysis of its mechanism of regulation. Blood 104: 3294-3301. [Abstract/Free Full Text]
  24. Douillard, P., C. Pannetier, R. Josien, S. Menoret, P. Kourilsky, J. P. Soulillou, M. C. Cuturi. 1996. Donor-specific blood transfusion-induced tolerance in adult rats with a dominant TCR-V{beta} rearrangement in heart allografts. J. Immunol. 157: 1250-1260. [Abstract]
  25. Guillet, M., S. Brouard, K. Gagne, F. Sebille, M. C. Cuturi, M. A. Delsuc, J. P. Soulillou. 2002. Different qualitative and quantitative regulation of V{beta} TCR transcripts during early acute allograft rejection and tolerance induction. J. Immunol. 168: 5088-5095. [Abstract/Free Full Text]
  26. Heslan, J., G. Beriou, J. Le Luduec, C. Guilloneau, I. Anegon, J. Soulillou, M. Cuturi, and E. Chiffoleau. 2005. Accumulation of T cells with potent regulatory properties and restricted V{beta}7-TCR rearrangements in tolerated allografts. Transplantation. In press.
  27. Chen, W., W. Jin, N. Hardegen, K. J. Lei, L. Li, N. Marinos, G. McGrady, S. M. Wahl. 2003. Conversion of peripheral CD4+CD25 naive T cells to CD4+CD25+ regulatory T cells by TGF-{beta} induction of transcription factor Foxp3. J. Exp. Med. 198: 1875-1886. [Abstract/Free Full Text]
  28. Fantini, M. C., C. Becker, G. Monteleone, F. Pallone, P. R. Galle, M. F. Neurath. 2004. Cutting edge: TGF-{beta} induces a regulatory phenotype in CD4+CD25 T cells through Foxp3 induction and down-regulation of Smad7. J. Immunol. 172: 5149-5153. [Abstract/Free Full Text]
  29. Rao, P. E., A. L. Petrone, P. D. Ponath. 2005. Differentiation and expansion of T cells with regulatory function from human peripheral lymphocytes by stimulation in the presence of TGF-{beta}. J. Immunol. 174: 1446-1455. [Abstract/Free Full Text]
  30. Marie, J. C., J. J. Letterio, M. Gavin, A. Y. Rudensky. 2005. TGF-{beta}1 maintains suppressor function and Foxp3 expression in CD4+CD25+ regulatory T cells. J. Exp. Med. 201: 1061-1067. [Abstract/Free Full Text]
  31. Bridoux, F., A. Badou, A. Saoudi, I. Bernard, E. Druet, R. Pasquier, P. Druet, L. Pelletier. 1997. Transforming growth factor {beta} (TGF-{beta})-dependent inhibition of T helper cell (Th2)-induced autoimmunity by self-major histocompatibility (MHC) class II-specific, regulatory T cell lines. J. Exp. Med. 185: 1769-1775. [Abstract/Free Full Text]
  32. Cautain, B., J. Damoiseaux, I. Bernard, H. van Straaten, P. van Breda Vriesman, B. Boneu, P. Druet, A. Saoudi. 2001. Essential role of TGF-{beta} in the natural resistance to experimental allergic encephalomyelitis in rats. Eur. J. Immunol. 31: 1132-1140. [Medline]
  33. McCombe, P. A., J. Harness, M. P. Pender. 1999. Effects of cyclosporin A treatment on clinical course and inflammatory cell apoptosis in experimental autoimmune encephalomyelitis induced in Lewis rats by inoculation with myelin basic protein. J. Neuroimmunol. 97: 60-69. [Medline]
  34. Hori, S., T. Nomura, S. Sakaguchi. 2003. Control of regulatory T cell development by the transcription factor Foxp3. Science 299: 1057-1061. [Abstract/Free Full Text]
  35. Fontenot, J. D., J. P. Rasmussen, L. M. Williams, J. L. Dooley, A. G. Farr, A. Y. Rudensky. 2005. Regulatory T cell lineage specification by the forkhead transcription factor foxp3. Immunity 22: 329-341. [Medline]
  36. Khattri, R., T. Cox, S. A. Yasayko, F. Ramsdell. 2003. An essential role for Scurfin in CD4+CD25+ T regulatory cells. Nat. Immunol. 4: 337-342. [Medline]
  37. Ducoroy, P., O. Micheau, S. Perruche, L. Dubrez-Daloz, D. de Fornel, P. Dutartre, P. Saas, E. Solary. 2003. LF 15-0195 immunosuppressive agent enhances activation-induced T-cell death by facilitating caspase-8 and caspase-10 activation at the DISC level. Blood 101: 194-201. [Abstract/Free Full Text]
  38. Kleinewietfeld, M., F. Puentes, G. Borsellino, L. Battistini, O. Rotzschke, K. Falk. 2005. CCR6 expression defines regulatory effector/memory-like cells within the CD25+CD4+ T-cell subset. Blood 105: 2877-2886. [Abstract/Free Full Text]
  39. Glabinski, A. R., B. Bielecki, S. O’Bryant, K. Selmaj, R. M. Ransohoff. 2002. Experimental autoimmune encephalomyelitis: CC chemokine receptor expression by trafficking cells. J. Autoimmun. 19: 175-181. [Medline]
  40. Bystry, R. S., V. Aluvihare, K. A. Welch, M. Kallikourdis, A. G. Betz. 2001. B cells and professional APCs recruit regulatory T cells via CCL4. Nat. Immunol. 2: 1126-1132. [Medline]
  41. McGeachy, M. J., L. A. Stephens, S. M. Anderton. 2005. Natural recovery and protection from autoimmune encephalomyelitis: contribution of CD4+CD25+ regulatory cells within the central nervous system. J. Immunol. 175: 3025-3032. [Abstract/Free Full Text]
  42. Combadiere, B., S. Faure, B. Autran, P. Debre, C. Combadiere. 2003. The chemokine receptor CX3CR1 controls homing and anti-viral potencies of CD8 effector-memory T lymphocytes in HIV-infected patients. AIDS 17: 1279-1290. [Medline]
  43. Gregori, S., M. Casorati, S. Amuchastegui, S. Smiroldo, A. M. Davalli, L. Adorini. 2001. Regulatory T cells induced by 1{alpha},25-dihydroxyvitamin D3 and mycophenolate mofetil treatment mediate transplantation tolerance. J. Immunol. 167: 1945-1953. [Abstract/Free Full Text]
  44. Matsue, H., C. Yang, K. Matsue, D. Edelbaum, M. Mummert, A. Takashima. 2002. Contrasting impacts of immunosuppressive agents (rapamycin, FK506, cyclosporin A, and dexamethasone) on bidirectional dendritic cell-T cell interaction during antigen presentation. J. Immunol. 169: 3555-3564. [Abstract/Free Full Text]
  45. Min, W. P., D. Zhou, T. E. Ichim, G. H. Strejan, X. Xia, J. Yang, X. Huang, B. Garcia, D. White, P. Dutartre, A. M. Jevnikar, R. Zhong. 2003. Inhibitory feedback loop between tolerogenic dendritic cells and regulatory T cells in transplant tolerance. J. Immunol. 170: 1304-1312. [Abstract/Free Full Text]
  46. Jonuleit, H., E. Schmitt, G. Schuler, J. Knop, A. H. Enk. 2000. Induction of interleukin 10-producing, nonproliferating CD4+ T cells with regulatory properties by repetitive stimulation with allogeneic immature human dendritic cells. J. Exp. Med. 192: 1213-1222. [Abstract/Free Full Text]
  47. Dhodapkar, M. V., R. M. Steinman, J. Krasovsky, C. Munz, N. Bhardwaj. 2001. Antigen-specific inhibition of effector T cell function in humans after injection of immature dendritic cells. J. Exp. Med. 193: 233-238. [Abstract/Free Full Text]
  48. Yang, J., S. M. Bernier, T. E. Ichim, M. Li, X. Xia, D. Zhou, X. Huang, G. H. Strejan, D. J. White, R. Zhong, W. P. Min. 2003. LF15-0195 generates tolerogenic dendritic cells by suppression of NF-{kappa}B signaling through inhibition of IKK activity. J. Leukocyte Biol. 74: 438-447. [Abstract/Free Full Text]
  49. Holcombe, H., I. Mellman, C. A. Janeway, Jr, K. Bottomly, B. N. Dittel. 2002. The immunosuppressive agent 15-deoxyspergualin functions by inhibiting cell cycle progression and cytokine production following naive T cell activation. J. Immunol. 169: 4982-4989. [Abstract/Free Full Text]
  50. Welch, A. M., J. H. Holda, R. H. Swanborg. 1980. Regulation of experimental allergic encephalomyelitis. II. Appearance of suppressor cells during the remission phase of the disease. J. Immunol. 125: 186-189. [Abstract]
  51. MacPhee, I. A., F. A. Antoni, D. W. Mason. 1989. Spontaneous recovery of rats from experimental allergic encephalomyelitis is dependent on regulation of the immune system by endogenous adrenal corticosteroids. J. Exp. Med. 169: 431-445. [Abstract/Free Full Text]
  52. McDonald, A. H., R. H. Swanborg. 1988. Antigen-specific inhibition of immune interferon production by suppressor cells of autoimmune encephalomyelitis. J. Immunol. 140: 1132-1138. [Abstract]
  53. Mustafa, M. I., P. Diener, B. Hojeberg, P. Van der Meide, T. Olsson. 1991. T cell immunity and interferon-{gamma} secretion during experimental allergic encephalomyelitis in Lewis rats. J. Neuroimmunol. 31: 165-177. [Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
R. A. O'Connor, K. H. Malpass, and S. M. Anderton
The Inflamed Central Nervous System Drives the Activation and Rapid Proliferation of Foxp3+ Regulatory T Cells
J. Immunol., July 15, 2007; 179(2): 958 - 966.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow