The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kalies, K.
Right arrow Articles by Westermann, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kalies, K.
Right arrow Articles by Westermann, J.
The Journal of Immunology, 2006, 176: 741-749.
Copyright © 2006 by The American Association of Immunologists

T Cell Zones of Lymphoid Organs Constitutively Express Th1 Cytokine mRNA: Specific Changes during the Early Phase of an Immune Response1

Kathrin Kalies2, Maike Blessenohl, Julia Nietsch and Jürgen Westermann

Institute of Anatomy, Center for Structural and Cell Biology in Medicine, University of Lübeck, Lübeck, Germany


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The cytokine milieu of the T cell zones in lymphoid organs is involved in the activation of naive T cells. Quantitative data regarding the local expression of cytokines are lacking. Therefore, the expression of Th1 (IL-2, IL-12p40, IFN-{gamma}), Th2 (IL-4, IL-10), as well as TGF{beta}1 and IL-15 mRNA was studied after laser microdissection in the steady state and during an immune response in rats. Our results show that Th1 cytokines are preferentially found in lymphoid tissues and in the T cell zones, whereas Th2 cytokines are expressed throughout the organs and especially in the B cell zones. After injection of sheep RBC, IL-2 and IFN-{gamma} mRNA are significantly increased in the T cell zone only, a change not seen by analyzing the whole spleen. Studying the spatial and temporal expression of genes will reveal new insights into the regulation of immune responses.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Activated CD4+ T cells can be assigned to two different subsets with distinct functions and cytokine secretion profiles. One population produces preferentially IL-2 and IFN-{gamma} and thereby supports cellular immunity (Th1-like). The other population secrets preferentially IL-4 and IL-10 and induces humoral immune responses (Th2-like) (1). The development of a Th1 or Th2 response is crucial for the outcome of diseases. Either it leads to progression and death, or healing and resistance (2, 3). Thus, understanding the mechanisms underlying the Th1/Th2 differentiation in vivo remains one of the key questions in immunology. The most clearly defined differentiation inducers are cytokines themselves: IL-12 and IFN-{gamma} for Th1 and IL-4 for Th2 induction. IL-12 is produced by dendritic cells and macrophages after encounter of pathogens. Naive T cells activated in a microenvironment dominated by IL-12 develop preferentially into Th1 cells (4). In contrast, the source of IL-4 as inducer of a Th2 development is not so clearly defined. Candidates are NK cells, eosinophils, mast cells, CD4+ memory T cells, or naive CD4+ T cells (5). It is assumed that the local cytokine microenvironment at different tissue sites has the potential to influence immune responses (6). However, information about the local cytokine microenvironment in vivo with no overt stimulation is not available. Most of the experiments concerning the expression of cytokines were performed in cell cultures after strong stimulations or in analyzing whole lymphoid organs (7, 8). In both approaches the local information is missing because in cell suspensions, the cells interact randomly with each other, and homogenates of whole lymphoid organs reflect the average expression of genes only. However, even with these approaches, it was shown that peripheral lymph nodes mainly draining the skin have a Th1-dominated cytokine milieu, whereas mesenteric lymph nodes (mln)3 mainly draining the intestine reveal a Th2-dominated milieu (9, 10). Today, cells and tissues can be analyzed in their original environment using laser microdissection (11, 12, 13). In combination with the real-time RT-PCR, it is possible to examine the pattern of gene expression at the compartmental level quantitatively with a high sensitivity (14, 15). The present study aims to analyze the cytokine milieu at different anatomical sites as one of the most critical factors in the Th1 or Th2 induction. The investigation of cells in their original environment provides the possibility to assess the impact of all cells including stromal or endothelial cells. Therefore, the expression of Th1 (IL-2, IL-12p40, IFN-{gamma}) and Th2 (IL-4, IL-10) cytokines was determined quantitatively in lymphoid and nonlymphoid organs in healthy rats. The expression of TGF{beta}1 and IL-15, well known as T cell regulator cytokines, were also investigated. All of these cytokines were not only analyzed in lymphoid organs, but also in the specific lymphoid organ compartments: the T cell zones and the B cell zones. Finally, we monitored changes in cytokine expression in the different compartments of the spleen during an immune response.

Our results show that Th1 and Th2 cytokines are expressed constitutively. Th1 cytokines are preferentially found in lymphoid tissues and in the corresponding T cell zones, whereas Th2 cytokines are expressed throughout the tissues examined and especially in the B cell zones.

After injection of sheep RBC (SRBC), a significantly increased expression of IL-2 and IFN-{gamma} for 1 day and only in the T cell zone is found. This observation cannot be made by analyzing the whole spleen. Our approach provides the basis for quantitative assessments of changes in the expression of cytokine genes within the specialized lymphoid compartments, even during the very early phase of immune responses.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 Disclosures
 References
 
Rats and histology

Healthy male Lewis rats were obtained from Charles River Laboratories, and used between 8 and 24 wk of age. Spleen, axillary lymph nodes (aln), mln, thymus, and parts of small intestine, liver, kidney, skeletal muscle, and footpad-skin were snap frozen and stored at –80°C. Cryosections, 8 µm in thickness, were either placed directly into 350 µl of guadinium-isothiocyanate-containing lysis buffer for isolation of RNA (RNeasy Kit; Qiagen) or mounted on slides for histology. For laser microdissection and pressure catapulting, the frozen tissue specimens were prepared on membrane-covered slides (Palm Membrane Slides, PEN membrane, 1 mm; PALM) and stored at –80°C. Staining with toluidinblue was performed according the manufacturer’s protocol (LCM Frozen Section Staining Kit; Arcturus Engineering). In brief, the slides were fixed in 75% alcohol, rinsed in RNase-free water, and stained for 5 min with toluidinblue staining solution (0.1%, 1 ml/slide). Eventually, the slides were dipped into 100% alcohol for 10 s, air-dried, and stored at –80°C. Staining with hemalaun was performed using Mayers hemalum staining solution according the manufacturer’s protocol (Merck).

To visualize the T and B cell compartments in the lymph nodes or spleens, the sections were stained immunohistologically with either mAbs R73 ({alpha}{beta} T cells) or mAbs G35-2238 (B cells; both obtained from BD Biosciences). To identify proliferating cells, the splenic and thymic tissue sections were stained for the rat homologue of the Ki-67 Ag (MIB-5; DakoCytomation) as described previously (16). All animals were maintained under specific pathogen-free conditions. The animals were analyzed in separate experimental series (see Figs. 3 and 4). All experiments performed were in accordance with the German Animal Protection Law and were approved by the Animal Research Ethics Board of the Ministry of Environment (Kiel, Germany).



View larger version (33K):
[in this window]
[in a new window]
  		FIGURE 3. Expression of the Th1 and Th2 cytokines in the T and B cell zones of lymph nodes and spleen. T and B cell zones of aln, mln, and the spleen were isolated by microdissection of toluidinblue-stained frozen sections for mRNA analysis. The differential expression of Th1 cytokine mRNA (A) and Th2 cytokine mRNA (B), TGF{beta}1 and IL-15 mRNA (E and F) in T and B cell zones of mln, aln, and spleen is shown. The values obtained from the same animal are connected (n = 8). One symbol was used for the same animal in all graphs. C and D, The mean value of the expressed Th1 cytokines IL-12p40, IL-2, and IFN-{gamma} was divided through the respective mean value of the expressed Th2 cytokines IL-4 and IL-10 for the T and B cell zone for each animal (n = 8). The mean values and the SDs of the Th1:Th2 ratios from the eight animals were calculated for the T and the B cell zones, respectively. If Th1 cytokine expression is comparable to Th2 cytokine expression, the Th1:Th2 ratio is 1 (dotted line). As shown in the diagram, it is easy to see that the T cell zones of all organs are Th1 dominated (Th1:Th2 ratio above 1), whereas the B cell zones have more of a Th2-like milieu (Th1:Th2 ratio below 1). Furthermore, the Th1:Th2 ratios differ significantly between the lymphoid organs (*, p < 0.05; Wilcoxon-matched pairs signed rank test).

 


View larger version (66K):
[in this window]
[in a new window]
  		FIGURE 4. Cell proliferation and of IL-2 mRNA expression in the early phase of an immune response induced by injection of SRBC. Spleen cryosections are stained for B cells (blue, with IgD) and the proliferating cells (red, Ki-67). A, Only few proliferating cells are found 1 day after injection of SRBC both in the T cell zone (PALS) and in the B cell zone (follicles; Fo). B, Many proliferating T cells (red) appear 3 days after injection of SRBC mainly in the T cell zone. C, Level of IL-2 mRNA in the individual compartments of the spleen (PALS; follicles (Fo); marginal zone (MZ); and red pulp (RP)) after antigenic stimulation. The mean values and SDs of the individual compartments and the whole organ are displayed before and 1 and 3 days after injection of SRBC (n = 3–8). The expression of IL-2 mRNA is significantly increased in the T cell zone 1 day after antigenic stimulation (Mann-Whitney U test, n = 8; p < 0.01). Note that no change in expression of IL-2 could be detected if a complete section was analyzed.

 
Laser microdissection and pressure catapulting

A pulsed UV laser was used to dissect the lymphoid tissue compartments (Palm Microbeam; PALM). To avoid contaminations, only well-defined T cell zones (paracortex, periarteriolar lymphoid sheath (PALS)) or B cell zones (cortex, follicle) were dissected. Tissue compartments were captured directly into the cap of a reaction tube. To yield enough RNA for the analysis of seven cytokine genes and one housekeeping gene in duplicated reaction including controls, an area of 2 x 106 µm2 per compartment was captured. The dissected tissue was immediately dissolved in 350 µl of guadinium-isothiocyanate-containing lysis buffer for isolation of total RNA (RNeasy Kit; Qiagen) and stored at –20°C.

RNA isolation and cDNA synthesis

Total RNA was isolated according the manufacturer’s protocol (RNeasy Kit; Qiagen). In brief, frozen samples were thawed at room temperature and vortexed for 1 min. After shearing the lysates, they were placed into the RNeasy Mini Spin Column. Following several washing steps, the RNA was eluted in 30 µl of RNase-free water. To increase the RNA concentration, the final volume of the extracted RNA was reduced (Speed-Vac) and treated with DNase I (Sigma-Aldrich). cDNA synthesis was performed with 200 ng of random primer (Promega), 0.01 M DTT, 1x reaction buffer, 0.5 mM dNTP (each obtained from Promega), and 100 U reverse transcriptase Superscript II RNase H- (Invitrogen Life Technologies) in a total volume of 20 µl. Samples were incubated at 42°C for 50 min. No reverse transcriptase enzyme was added to the controls.

Validations of the housekeeping genes

To identify the most stable expressed housekeeping gene in lymphoid tissue compartments and skin, the RNA from 1.5 x 106 µm2 of every compartment and from 1 x 106 unstimulated or stimulated cultured cells was extracted and reverse transcribed. The cDNA was added to the SYBR Green PCR Master Mix (Applied Biosystems) and amplified. For signal detection, the ABI Prism 7000 sequence detector (Applied Biosystems) was programmed to an initial step of 6 min at 95°C, followed by 50 thermal cycles of 15 s at 95°C and 1 min at 60°C. To prove the specificity of the amplification, the melting point of all amplificates was determined. The following forward (for) and reverse (rev) primers (shown below) were designed by using the computer software CloneManager (Sci-Ed Central; version 7.01). To define the optimal primer concentration, the cDNAs were amplified by using all combinations of the following for and rev primer concentrations (50, 300, and 900 nM). The sizes of the amplicons (bp) are displayed in parenthesis: 18sRNA for, 5'GGAGAGGGAGCCTGAG and rev, 5'GCTGGCACCAGACTTG (188); {beta}-ACTIN for, 5'GCTCCTAGCACCATGAAG and rev, 5'CTCCTGCTTGCTGATCC (123); GAPDH for, 5'GCTCCTAGCACCATGAAG and rev, 5'CTCGTGGTTCACACC CATC (208); HPRT for, 5'CCAGCGTCGTGATTAGTG and rev, 5'GCCTCCCATCTCCTTCATG (159); MLN51 for, 5'AGGACAGCCTTCATTCCTG and rev, 5'GCTTAGCTCGACCACT CTG (128); PBGD for, 5'GATGGCTCAGATAGCATGCAAG and rev, 5'GCTGGGC TCCTCTTGGAATG (130); SEC61 for, 5'CACCATCTTCGTCTTTGCTG and rev, 5'GTTGGACACCAGAGCAGAC (160); UBC for, 5'ATGGCTCTGAAGAGAATCC and rev, 5'CGGTTTGAAGGGGTAATCTG (192).

For absolute comparison of the expression stability, the cycles of threshold (ct) as amount of the accumulated PCR product was measured, and the mean value and SD of all 11 tissue compartments and tissue cultures were calculated. Dividing the SD by the mean value yields the variation coefficient.

For relative comparison of the expression stability of the eight tested housekeeping genes, the ct values of all cDNA samples were determined. The ct values were transformed to quantities through setting the highest relative quantity for each tested housekeeping gene to 1. These not yet normalized housekeeping gene quantities are the required input data for entering in the GeNorm VBA applet. This applet determines the most stable housekeeping gene by calculating a gene expression normalization factor for each tissue compartment based on the geometric mean of all eight housekeeping genes tested. The genes with the highest M value are excluded sequentially. The underlying principles and calculations are described in Ref.17 .

Relative cytokine mRNA quantification

To analyze the expression of cytokine genes in lymphoid or nonlymphoid tissues, the RNA of five cryosections, 8 µm in thickness, were extracted. For lymphoid tissue compartments 2 x 106 µm2 of every compartment were dissected, the RNA was extracted and reverse transcribed. The cDNA was added to the TaqMan Universal PCR Master Mix (Applied Biosystems) and amplified as described above. The TaqMan probes, for and rev primers (Table I) were designed by using the computer software CloneManager (Sci-Ed Central; version 7.01). The optimal primer concentrations used are 900 nM each for the for and rev primers and 200 nM for the TaqMan probes (IBA TAGnologies). The same batch of cDNA (20 µl) was used to determine the ct of seven cytokine genes and MLN51 as housekeeping gene in duplicated reactions. Because the amplification efficiencies are close to 1 (as assessed by template dilution; see Fig. 1F), it is possible to apply the following equation to relate the amount of the cytokine genes to MLN51: 2(ct cytokine-ct MLN51) (14). In case of a very low number of transcripts (e.g., IL-2 in the B cell zones), no fluorescence signal was detectable. In this case, we used a ct of 40 for our calculations, the maximum possible ct value detectable using the TaqMan System, and the ABI 7000 PCR cycler as described previously (Manual, RQ software; Applied Biosystems).


View this table:
[in this window]
[in a new window]
  		Table I. Primer sequences, exon locations, amplicon sizes, and gene accession nos. of the cytokine genes

 


View larger version (78K):
[in this window]
[in a new window]
  		FIGURE 1. Staining with toluidinblue allows identifying functionally different lymphoid compartments without mRNA loss and permits exponential amplification. A, Cryosections of rat mln were stained with toluidinblue. The T cell zone (paracortex; PC), B cell zone (cortex with follicles; Fo), and the medulla (Me) are easily distinguishable. B, Adjacent cryosections were stained immunohistologically with Abs against B cells (IgM, brown) and T cells (CD3, blue). This approach has been repeated many times and always showed that the T and B cell zones, which were chosen for dissection, can be identified with the same accuracy both in sections stained by immunohistochemistry and in sections stained with toluidineblue. C, Staining with toluidinblue clearly identifies cortex (Co) and the medulla (Me) of the thymus. D, A serial cryosection was stained immunohistologically for proliferating cells (Ki-67 positive, red), which are preferentially found in the cortex. E, The RNA recovery of spleens was determined by real-time RT-PCR of unstained (no), toluidinblue stained (Tb), or hemalaun stained (He) cryosections (n = 3). Note that a higher ct corresponds to less copies of cDNA. *, Indicates significant differences among the levels of expression (p < 0.05, Student’s t test). F, The efficiency of the PCR amplifications was determined by serial 10-fold dilutions of cDNA samples. The cDNA was prepared from complete section of spleens. One batch of cDNA was used for all primer pairs in the same PCR run.

 
For the Th1:Th2 ratio, the average expression of the Th1 cytokines (IL-2, IL-12p40, IFN-{gamma}) and the average expression of the Th2 cytokines (IL-4, IL-10) per copy MLN51 for the T and B cell zones of each animal was calculated. The resulting mean value for the Th1 cytokines were divided by the mean value of the Th2 cytokines for each individual animal (n = 8). The graph (see Fig. 3, C and D) shows the mean value and SD of the Th1/Th2 quotient of all eight animals.

Cell cultures

Cells cultures were prepared by passing single spleens through a steel sieve. After lyses of the RBC, the cells were washed with PBS-EDTA buffer (pH 7.4) and resuspended in 15 ml of RPMI 1640 containing 10% FCS, 600 µM L-glutamin, streptomycin (20,000 µg/100 ml), penicillin (20,000 U/100 ml) (all reagents from Biochrom), and 3.75 µM 2-ME (Fluka). Viable cells were cultured in 24-well plates (Sarstedt) at a density of 1 x 106 cells/ml in a total volume of 1 ml/well either in presence of 5 µg/ml Con A (Sigma-Aldrich) or without any stimulus for a maximum of 4 days at 37°C in 5% CO2. Viable cells (1 x 106) were harvested after 0, 4, 24, or 96 h of culture and analyzed by RT-PCR as described above. To prove the activated state of the cells cultured in the presence of Con A, the increase in cell volume was monitored by microscopy. Moreover, cytospin preparations were done at each time point of cultivation and stained with Ki-67 Ag (MIB-5; DakoCytomation).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 Disclosures
 References
 
Determination of an internal standard gene

Given the low number of cells after microdissection, it is not practical to measure the amount of RNA for normalization. Therefore, one prerequisite for normalization and comparative quantification is the choice of an appropriate internal standard gene, a housekeeping gene. It should be expressed at a constant level at all stages of activation and should be unaffected by experimental handling. Thus, we focused our analysis on the expression of eight commonly used housekeeping genes (Table II) not only in whole organs but also in tissue compartments (Table III) and lymphocyte cultures. The distinct tissue compartments can be identified after staining with Abs (Fig. 1, B and D), but they are also easily recognizably after staining with toluidinblue (Fig. 1, A and C). Because the toluidinblue staining protocol requires 5 min only, the same amount of mRNA can be recovered as obtained in untreated cryosections. In contrast, staining with hemalaun reveals a 5-fold loss of mRNA (Fig. 1E).


View this table:
[in this window]
[in a new window]
  		Table II. Function and gene accession no. of the evaluated housekeeping genesa

 

View this table:
[in this window]
[in a new window]
  		Table III. The housekeeping genes are ranked in order of their expression stabilitya

 
As shown in Table III, the housekeeping gene with the lowest variation in tissue compartments and cell cultures is MLN51. Although we performed the experiments in a standardized fashion, calculation of the variation coefficient does not consider any experimental variances. To exclude these variations, normalization of the expression levels of the housekeeping genes to each other is necessary. A robust method to calculate the variation in expression after normalization is the gene-stability measure M (GeNorm VBA applet) (17). The genes with the lowest M values have the most stable expression. The calculation of the gene-stability measure M of all eight housekeeping genes in tissue compartments and cell cultures reveals M values between 3.6 and 0.54. MLN51 and SEC61 with an average expression stability value of 0.54 are the steadiest expressed genes. We decided to use MLN51 as housekeeping gene for our experiments as judged by applying the raw, nonnormalized and the normalized expression levels for calculation. Our results confirm the data from Hamalainen et al. (18), who described MLN51 as housekeeping gene for lymphocytes after analyzing cDNA arrays.

Another important prerequisite for a comparative quantification of mRNA transcripts is the parallel accumulation of all cDNA strands during the real-time PCR. We performed amplifications of serial 10-fold dilutions of cDNA samples simultaneously. The amplifications of the housekeeping gene MLN51 and the cytokine genes proceed parallel and display efficiencies close to 100%. Therefore, it is possible to compare the amount of PCR products directly (Fig. 1F).

Th1 and Th2 cytokine mRNA is constitutively expressed in secondary lymphoid organs

It is widely assumed that Th1 and Th2 cytokines are produced after induction of a primary immune response (1, 7). Our results show that Th1 and Th2 cytokines are constitutively expressed in spleen and lymph nodes of healthy rats with no overt stimulation (Table IV). Interestingly, the number of the particular cytokine transcripts varies among the secondary lymphoid organs. For example, the IL-4 gene is expressed ~300 times lower compared with the expression of TGF{beta}1 mRNA, whereas IL-2, IFN-{gamma}, and IL-10 are expressed at 5- to 10-fold higher levels compared with IL-4. IL-12p40, IL-15, and TGF{beta}1 are the most abundant transcripts (Table IV).


View this table:
[in this window]
[in a new window]
  		Table IV. Quantitative average expression level of each individual cytokine in resting secondary lymphoid organsa

 
Th1 cytokines are preferentially expressed in lymphoid organs, but Th2 cytokines are also found in nonlymphoid organs

There is increasing evidence that immune responses in nonlymphoid tissues contribute a large portion to the overall response (19). Therefore, we wanted to know whether the cytokines are also expressed constitutively in nonlymphoid organs. As shown in Fig. 2, the mRNA for the Th1 cytokines IL-12p40, IL-2, and IFN-{gamma} is preferentially found in spleen, mln, and aln. Particularly, the expression of IL-12p40 is highly restricted to spleen and lymph nodes, and is not detectable in nonlymphoid organs except the skin. In addition to lymphoid organs, IL-2 and IFN-{gamma} are also expressed in the small intestine.



View larger version (22K):
[in this window]
[in a new window]
  		FIGURE 2. Expression of cytokine mRNA differs between lymphoid and nonlymphoid organs. RNA from whole tissue sections of aln, mln, spleen, liver, small intestine, kidney, muscle, and skin from rats were isolated and reverse transcribed. The ct of the cytokine genes and MLN 51 were determined using the same batch of cDNA in duplicated reaction tubes in the same PCR run, and three animals were studied. Mean values and SDs of the amount of cDNA copies normalized to the internal standard gene MLN51 for the Th1 cytokines (IL-12p40, IL-2, IFN-{gamma}), the Th2 cytokines (IL-4, IL-10), and for TGF{beta}1 and IL-15 are shown (n = 3–6). *, Indicate significant differences among the levels of expression between nonlymphoid organs (IL-12, IL-2, IL-15), lymphoid organs (IL-4, IL-10) or between lymphoid and nonlymphoid organs (TGF{beta}1) (p < 0.05, Student’s t test).

 
Th2 cytokines are found in comparable amounts in lymphoid and nonlymphoid organs (Fig. 2). Quantitative analysis shows that the expression of IL-4 and IL-10 is significantly elevated in mln compared with aln. IL-15 and TGF{beta}1 can be detected in both lymphoid and nonlymphoid organs (Fig. 2). Interestingly, whereas IL-15 transcripts are equally expressed in lymphoid and nonlymphoid organs, the expression of TGF{beta}1 is ~10 times higher in lymphoid organs.

T cell zones have a Th1-like milieu and differ among secondary lymphoid organs

Lymphoid tissues are highly structured organs designed to maximize cellular interactions. It has been shown that there is a constant contact between dendritic cells and T cells (16, 20). The functional consequences of this interaction, especially during an immune response, are influenced by the cytokine milieu present in the T cell zone (21). Therefore, the expression of various cytokine mRNAs was analyzed quantitatively in the T cell zone and compared with that of the B cell zone. Cryosections of aln, mln, and spleen were prepared, T cell zones and B cell zones were cut out by microdissection, and the expression of cytokines were analyzed.

As shown in Fig. 3A, all three Th1 cytokines prevail in the T cell zone of aln compared with the B cell zone. The spleen reveals a similar expression pattern, except for IFN-{gamma}. In contrast, in mln none of the Th1 cytokines shows a clear preference for the T cell zone. This expression pattern is complementary for Th2 cytokines (Fig. 3B). In this study, in mln a strong preferential expression pattern of Th2 cytokines in the B cell zone is seen, which is less clear for spleen and aln. To demonstrate the unique cytokine milieu in the T cell zone of the different lymph nodes and the spleen, the ratio of the mean value of Th1 to Th2 cytokine expression was calculated (Fig. 3, C and D). If Th1 and Th2 cytokines are expressed at same quantities the ratio is 1, if Th1 cytokines prevail the ratio is above 1, and if Th2 cytokines dominate the ratio is below one. Fig. 3C clearly shows that the T cell zone of aln is more dominated by Th1 cytokines than that of mln, the T cell zone of the spleen being in between. Furthermore, the most prominent Th2 profile is shown by the B cell zone of mln, whereas in the B cell zone of aln, Th2 and Th1 cytokines are expressed in comparable amounts (Fig. 3D). Both TGF{beta}1 and IL-15 are much higher expressed than any other cytokine investigated. Whereas TGF{beta}1 mRNA is equally distributed in the T and B cell zone of lymphoid organs (Fig. 3E), IL-15 is significantly higher expressed in the T cell zone (Fig. 3F).

Early changes in cytokine gene expression during an immune response are detectable only in the T cell zone

To analyze whether it is possible to follow early changes in the expression of cytokines during a T cell dependent-immune response, SRBC were injected i.v. into rats, which induce a thymus-dependent immune response in the spleen (22). Before injection of SRBC and 1 as well as 3 days after antigenic stimulation, the spleen was removed, and both cell proliferation (Fig. 4, A and B) and cytokine mRNA expression were analyzed (Fig. 4C).

Three days after injection of SRBC, cell proliferation increases mainly in the T cell zone of the spleen (Fig. 4B). In contrast, the increase of the IL-2 mRNA expression in the T cell zone lasts only 1 day after injection of SRBC and is down-regulated on day 3 (Fig. 4C). The same pattern is observed for IFN-{gamma} mRNA expression (data not shown). No changes are detected for IL-12p40, IL-4, IL-10, IL-15, and TGF{beta}1 mRNA expression neither in the T cell zone nor in the B cell zone, the marginal zone, or red pulp. Moreover, when investigating whole spleen sections, the increase in IL-2 and IFN-{gamma} mRNA expression 1 day after injection of SRBC is not visible (Fig. 4C).


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
Disclosures
 References
 
It is well known that T cell effector functions are modulated by cytokines (2). However, little is known about the quantitative distribution of Th1 and Th2 cytokines between lymphoid and nonlymphoid organs. In addition, it is unclear whether and how the milieu in the T cell zone as the prominent location of CD4+ T cell activation differs from the other compartments in lymphoid organs. In this study we show that, already in the steady state, all cytokines investigated are expressed. However, their expression level differs significantly. The quantitative comparison of very low cytokine expression levels was possible by combining the exponential amplification of the target cDNA with the choice of an appropriate housekeeping gene. We established MLN51 as the best housekeeping gene not only for whole organs, but also for organ compartments and cultured lymphocytes as judged by its lowest variation coefficient and its lowest gene-stability measure M of only 0.54 (17). The gene-stability value M of {beta}-Actin and 18s RNA, which are often used as internal standards for quantification of gene expression, is above 3.0 showing that their expression varies ~5 times more than MLN51. Thus, choosing MLN51 as a housekeeping gene allows the reliable and quantitative detection of very low levels of cytokine mRNA even in unchallenged animals.

Although one should not generally correlate cytokine mRNA levels directly with rates of protein secretion, mRNA expression gives a good indication as shown for IFN-{gamma} (23, 24). Therefore, it is reasonable to assume that the differences in mRNA expression, in the range of several hundred times, as shown in the present study are associated with expression of the corresponding proteins. In addition, due to exponential amplification during the PCR, mRNA determination is the only method at the moment to pick up minimal and therefore early changes in the regulation of cytokines in vivo. This point is confirmed by injecting SRBC and following the cytokine expression in the different compartments of the spleen.

The present study demonstrates that the expression of the Th1 cytokines is mainly restricted to lymphoid tissues. Th1 cells mediate macrophage activation and support the elimination of intracellular pathogens. The so-called cellular immunity leads to proinflammatory immune responses and potential tissue injuries. Therefore, it is very likely that the expression of Th1 cytokines is restricted to secondary lymphoid organs to keep the induction of unwanted inflammatory immune responses under control (25, 26). The high expression levels of IL-2 and IFN-{gamma} in the small intestine are probably due to both the presence of the high number of lymphocytes and the immunological stimulation by continuous antigenic challenge.

In contrast to Th1 cytokines, IL-4 and IL-10 promote the secretion of Abs (IgG1 and IgE) and support the elimination of extracellular pathogens leading to humoral immune responses. IL-10 was first described as a Th2 cytokine that could inhibit Th1 cell activation and cytokine production (27). More recent reports have shown that IL-10 is a potent inhibitor of both Th1 and Th2 cell responses and plays a major role in the development of regulatory T cells (28, 29, 30). However, our data show that the expression of IL-10 correlates nicely with IL-4 in nonlymphoid and lymphoid organs as well as in T and B cell zones (Figs. 2 and 3B). This expression pattern supports studies showing that both cytokines play a role in down-modulating ongoing immune responses to protect nonlymphoid organs from tissue injury caused by inflammatory responses (31). In addition, our data imply that other cells than T cells are responsible for the IL-4 and IL-10 expression in nonlymphoid tissues, especially because it has been shown that Th1 rather than Th2-like T cells enter nonlymphoid tissues (32, 33, 34). The anti-inflammatory role of IL-4 and IL-10 is also underlined by our observation that they are significantly more expressed in mln compared with aln, the former playing an important role in mediating oral tolerance (35).

Like the Th2 cytokines, TGF{beta}1 is expressed both in lymphoid and nonlymphoid organs. This expression pattern corresponds well with the anti-inflammatory effects of TGF{beta}1 (36). Compared with Th1 or Th2 cytokines, its expression is 10 to 100 times higher. In addition, TGF{beta}1 mRNA is significantly more expressed in lymphoid tissues. This observation is in line with many studies showing TGF{beta}1 as prominent T cell regulator with multiple effects on immune responses. It is reported to stimulate (37, 38, 39) and to suppress immune reactions (40, 41).

IL-15 mRNA is also expressed at higher levels in lymphoid and nonlymphoid organs compared with Th1 or Th2 cytokines. Thus, it is assumed that one of the most prominent functions of IL-15 is the maintenance of the lymphoid homeostasis by supporting NK cells and memory T cells in nonlymphoid organs (42, 43). It is well known that IL-15 interacts with the {beta}- and {gamma}-chains of the IL-2R (44), and therefore the biological activity of IL-15 is thought to be controlled in balance with IL-2. The present study shows that, within the lymphoid organs, the expression of IL-15 and IL-2 mRNA coincidences. Interestingly, the expression of IL-15 is ~40 times higher compared with IL-2. It would be worthwhile to know how the expression of the corresponding {alpha} receptor chains is regulated in lymphoid vs nonlymphoid organs during an antigenic stimulation.

So far, no quantitative information is available about the cytokine milieu in the T cell zone of lymphoid organs in comparison to other organ compartments. By combining laser microdissection of T and B cell zones from frozen tissue sections with quantitative real-time RT-PCR, we show that the T cell zone is dominated by the expression of Th1 cytokines, whereas in the B cell zone Th2 cytokines prevail.

It is unknown whether the milieu in the two compartments is formed by lymphocytes themselves or if other cells are involved. It is also unknown whether only few cells express the cytokines at a very high level or whether many cells express small amounts of the respective mRNA.

Candidate sources of Th1 expression in the T cell zones include memory T cells or naive T cells themselves. However, dendritic cells may play the most prominent role in orchestrating immune responses by cytokine secretion (45). For example, IL-12, known for a long time to be produced by dendritic cells, is one of the inducers of a Th1 cell differentiation (46).

For the B cell zones either few Th2 cytokine-expressing T cells are responsible for the characteristic milieu or the B cells themselves, which are also known to produce IL-4 and IL-10 (47, 48, 49).

The quantitative mapping of cytokines in various organ compartments seems to be an attractive approach to obtain indications of the in vivo role of cytokines. For instance, according the expression pattern IL-15 belongs to the same group as IL-12p40 and IL-2. All three cytokines are expressed mainly in the T cell zone. It will be interesting to find out whether there are principal differences in the in vivo function of cytokines mainly expressed in the T cell zone (e.g., IL-2), mainly expressed in the B cell zone (e.g., IL-10), or equally expressed in both zones (e.g., TGF{beta}1).

The question arises whether the cytokines produced in one compartment diffuses to the other compartment. It would be interesting to know whether T cells have to be exposed to the different cytokines consecutively while migrating through the two compartments to get activated or whether the cytokines act in synergy at one anatomical location. Future studies should investigate the functional implication of the cytokine gradient between the T cell zone and the B cell zone during the course of an immune response. It would be also interesting to find out whether the activation of T cells right in the middle of the T cell zone (Th1 dominated) leads to different consequences compared with activation occurring at the border to the B cell zone (Th2 influenced). Recently, we could show that interactions of T cells with dendritic cells taking place at the border of the T cell zone result in a higher portion of T cell in the S-phase of the cell cycle compared with interactions in the inner T cell zone (16). In addition, during infection with Leishmania major in mice, the course of the disease seems to depend on whether the Ag is presented at the outer or at the inner T cell zone (50).

Although the principle distribution of the cytokines is comparable in the lymphoid organs investigated, the Th1/Th2 gradient differs significantly. For example, the T cell zone in aln has the most pronounced Th1 profile, and the B cell zone has the least expressed Th2 profile. In contrast, mln show the reverse pattern: low Th1 profile in the T cell zone, high Th2 profile in the B cell zone. The functional consequences of this difference are far from clear. It might be that the expression pattern in aln is more favorable for the induction of immune responses, whereas those in mln have a more suppressive character thereby being involved in mediating oral tolerance (35). In addition, it is completely unknown how the different gradients in aln and mln are created. The data presented in this study are established using rats as experimental animal model. It would be worthwhile to find out how the Th1/Th2 cytokines are distributed in other animal species.

Taken into account that the mRNA expression does not necessarily correspond to the expression of proteins, we induced an immune reaction in the rat spleen by injecting SRBC and followed the cytokine expression in the different compartments. Spitz et al. (51) showed that cell suspensions of spleens prepared 3 days after injection of SRBC secreted IL-2 in their culture supernatant. Our results nicely confirm this report. Moreover, we can show that the IL-2 transcription in vivo is increased within 24 h only and is restricted to the T cell zone of the spleen. Simultaneous to the increased transcription of IL-2, the IFN-{gamma} mRNA was also augmented in the T cell zone. Interestingly, the increase of IL-2 and IFN-{gamma} mRNA is not seen when the whole spleen is analyzed. This demonstrates that relevant changes in cytokine expression as observed in the T cell zone (comprising ~10% of the spleen) are masked by the background activity in the remaining 90% of the spleen (53). The simultaneous expression of IL-2 and IFN-{gamma} is in contrast to reports showing that cytokines are expressed sequentially by activated T cells (52). These differences might be explained by the possibility of random cell interaction in vitro vs in vivo analysis of cells in their original environment.

In conclusion, the approach presented in our study allows the sensitive detection of biological relevant changes in cytokine concentrations at defined locations. This permits us to study in vivo the early phase of immune responses in which both quality and quantity of the resulting effector phase is determined. Knowing these molecular mechanisms in more detail will allow manipulating immune responses so that beneficial ones are supported, whereas detrimental ones are suppressed.


   Acknowledgments
 
We thank E. Behrens, L. Gutjahr, P. Lau, and M.-L. Leppin for excellent technical assistance, and K. Nohroudi for taking care of the animals. Furthermore, we thank I. König from the Institute of Biometry and Statistics (University of Lübeck, Lübeck, Germany) for helpful discussion regarding the calculations of the housekeeping genes. The comments of A. Jorns (Center of Anatomy, Hannover Medical School, Hannover, Germany), L. Fink (Department of Pathology, University of Giessen, Giessen, Germany), R. Mentlein (Institute of Anatomy, University of Kiel, Kiel, Germany), and G. van Zandbergen (Institute for Medical Microbiology and Hygiene, University of Luebeck, Luebeck, Germany) are gratefully acknowledged.


   Disclosures
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
References
 
The authors have no financial conflict of interest.


   Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by the German Research Foundation Grant SFB 367-A12. Back

2 Address correspondence and reprint requests to Dr. Kathrin Kalies, Institute of Anatomy, University of Lübeck, Ratzeburger Allee 160, 23538 Lübeck, Germany. E-mail address: kalies{at}anat.uni-luebeck.de Back

3 Abbreviations used in this paper: mln, mesenteric lymph node; SRBC, sheep RBC; aln, axillary lymph node; PALS, periarteriolar lymphoid sheath; for, forward; rev, reverse; ct, cycles of threshold. Back

Received for publication August 23, 2005. Accepted for publication October 24, 2005.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Mosmann, T. R., S. Sad. 1996. The expanding universe of T-cell subsets: Th1, Th2 and more. Immunol. Today 17: 138-146. [Medline]
  2. Abbas, A. K., K. M. Murphy, A. Sher. 1996. Functional diversity of helper T lymphocytes. Nature 383: 787-793. [Medline]
  3. Sacks, D., N. Noben-Trauth. 2002. The immunology of susceptibility and resistance to Leishmania major in mice. Nat. Rev. Immunol. 2: 845-858. [Medline]
  4. Moser, M., K. M. Murphy. 2000. Dendritic cell regulation of TH1-TH2 development. Nat. Immunol. 1: 199-205. [Medline]
  5. Coffman, R. L., T. von der Weid. 1997. Multiple pathways for the initiation of T helper 2 (Th2) responses. J. Exp. Med. 185: 373-375. [Free Full Text]
  6. Constant, S. L., J. L. Brogdon, D. A. Piggott, C. A. Herrick, I. Visintin, N. H. Ruddle, K. Bottomly. 2002. Resident lung antigen-presenting cells have the capacity to promote Th2 T cell differentiation in situ. J. Clin. Invest. 110: 1441-1448. [Medline]
  7. Swain, S. L.. 1995. CD4 T cell development and cytokine polarization: an overview. J. Leukocyte Biol. 57: 795-798. [Abstract]
  8. Weinberg, A. D., M. English, S. L. Swain. 1990. Distinct regulation of lymphokine production is found in fresh versus in vitro primed murine helper T cells. J. Immunol. 144: 1800-1807. [Abstract]
  9. Premier, R. R., E. N. Meeusen. 1998. Lymphocyte surface marker and cytokine expression in peripheral and mucosal lymph nodes. Immunology 94: 363-367. [Medline]
  10. Bode, U., A. Sahle, G. Sparmann, F. Weidner, J. Westermann. 2002. The fate of effector T cells in vivo is determined during activation and differs for CD4+ and CD8+ cells. J. Immunol. 169: 6085-6091. [Abstract/Free Full Text]
  11. Emmert-Buck, M. R., R. F. Bonner, P. D. Smith, R. F. Chuaqui, Z. Zhuang, S. R. Goldstein, R. A. Weiss, L. A. Liotta. 1996. Laser capture microdissection. Science 274: 998-1001. [Abstract/Free Full Text]
  12. Fink, L., W. Seeger, L. Ermert, J. Hanze, U. Stahl, F. Grimminger, W. Kummer, R. M. Bohle. 1998. Real-time quantitative RT-PCR after laser-assisted cell picking. Nat. Med. 4: 1329-1333. [Medline]
  13. Schutze, K., G. Lahr. 1998. Identification of expressed genes by laser-mediated manipulation of single cells. Nat. Biotechnol. 16: 737-742. [Medline]
  14. Livak, K. J., T. D. Schmittgen. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2–{delta}{delta}CT method. Methods 25: 402-408. [Medline]
  15. Freeman, W. M., S. J. Walker, K. E. Vrana. 1999. Quantitative RT-PCR: pitfalls and potential. BioTechniques 26: 112-122. [Medline]
  16. Westermann, J., U. Bode, A. Sahle, U. Speck, N. Karin, E. B. Bell, K. Kalies, A. Gebert. 2005. Naive, effector, and memory T lymphocytes efficiently scan dendritic cells in vivo: contact frequency in T cell zones of secondary lymphoid organs does not depend on LFA-1 expression and facilitates survival of effector T cells. J. Immunol. 174: 2517-2524. [Abstract/Free Full Text]
  17. Vandesompele, J., K. De Preter, F. Pattyn, B. Poppe, N. Van Roy, A. De Paepe, F. Speleman. 2002. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 3: 0034.1-0034.11.
  18. Hamalainen, H. K., J. C. Tubman, S. Vikman, T. Kyrola, E. Ylikoski, J. A. Warrington, R. Lahesmaa. 2001. Identification and validation of endogenous reference genes for expression profiling of T helper cell differentiation by quantitative real-time RT-PCR. Anal. Biochem. 299: 63-70. [Medline]
  19. Marzo, A. L., V. Vezys, K. Williams, D. F. Tough, L. Lefrancois. 2002. Tissue-level regulation of Th1 and Th2 primary and memory CD4 T cells in response to Listeria infection. J. Immunol. 168: 4504-4510. [Abstract/Free Full Text]
  20. Lindquist, R. L., G. Shakhar, D. Dudziak, H. Wardemann, T. Eisenreich, M. L. Dustin, M. C. Nussenzweig. 2004. Visualizing dendritic cell networks in vivo. Nat. Immunol. 5: 1243-1250. [Medline]
  21. Langenkamp, A., M. Messi, A. Lanzavecchia, F. Sallusto. 2000. Kinetics of dendritic cell activation: impact on priming of TH1, TH2 and nonpolarized T cells. Nat. Immunol. 1: 311-316. [Medline]
  22. Van den Eertwegh, A. J., W. J. Boersma, E. Claassen. 1992. Immunological functions and in vivo cell-cell interactions of T cells in the spleen. Crit. Rev. Immunol. 11: 337-380. [Medline]
  23. Gupta, A. K., C. Rusterholz, W. Holzgreve, S. Hahn. 2005. Constant IFN{gamma} mRNA to protein ratios in cord and adult blood T cells suggests regulation of IFN{gamma} expression in cord blood T cells occurs at the transcriptional level. Clin. Exp. Immunol. 140: 282-288. [Medline]
  24. Holscher, C., A. Holscher, D. Ruckerl, T. Yoshimoto, H. Yoshida, T. Mak, C. Saris, S. Ehlers. 2005. The IL-27 receptor chain WSX-1 differentially regulates antibacterial immunity and survival during experimental tuberculosis. J. Immunol. 174: 3534-3544. [Abstract/Free Full Text]
  25. Trinchieri, G.. 2003. Interleukin-12 and the regulation of innate resistance and adaptive immunity. Nat. Rev. Immunol. 3: 133-146. [Medline]
  26. Smith, K. A.. 1988. Interleukin-2: inception, impact, and implications. Science 240: 1169-1176. [Abstract/Free Full Text]
  27. Fiorentino, D. F., M. W. Bond, T. R. Mosmann. 1989. Two types of mouse T helper cell. IV. Th2 clones secrete a factor that inhibits cytokine production by Th1 clones. J. Exp. Med. 170: 2081-2095. [Abstract/Free Full Text]
  28. Hoffmann, K. F., A. W. Cheever, T. A. Wynn. 2000. IL-10 and the dangers of immune polarization: excessive type 1 and type 2 cytokine responses induce distinct forms of lethal immunopathology in murine schistosomiasis. J. Immunol. 164: 6406-6416. [Abstract/Free Full Text]
  29. Specht, S., L. Volkmann, T. Wynn, A. Hoerauf. 2004. Interleukin-10 (IL-10) counterregulates IL-4-dependent effector mechanisms in murine filariasis. Infect. Immun. 72: 6287-6293. [Abstract/Free Full Text]
  30. Mills, K. H.. 2004. Regulatory T cells: friend or foe in immunity to infection?. Nat. Rev. Immunol. 4: 841-855. [Medline]
  31. Rocken, M., M. Racke, E. M. Shevach. 1996. IL-4-induced immune deviation as antigen-specific therapy for inflammatory autoimmune disease. Immunol. Today 17: 225-231.
  32. Austrup, F., D. Vestweber, E. Borges, M. Lohning, R. Brauer, U. Herz, H. Renz, R. Hallmann, A. Scheffold, A. Radbruch, A. Hamann. 1997. P- and E-selectin mediate recruitment of T-helper-1 but not T-helper-2 cells into inflammed tissues. Nature 385: 81-83. [Medline]
  33. Iezzi, G., D. Scheidegger, A. Lanzavecchia. 2001. Migration and function of antigen-primed nonpolarized T lymphocytes in vivo. J. Exp. Med. 193: 987-993. [Abstract/Free Full Text]
  34. Maloy, K. J., C. Burkhart, T. M. Junt, B. Odermatt, A. Oxenius, L. Piali, R. M. Zinkernagel, H. Hengartner. 2000. CD4+ T cell subsets during virus infection. Protective capacity depends on effector cytokine secretion and on migratory capability. J. Exp. Med. 191: 2159-2170. [Abstract/Free Full Text]
  35. Gonnella, P. A., Y. Chen, J. Inobe, Y. Komagata, M. Quartulli, H. L. Weiner. 1998. In situ immune response in gut-associated lymphoid tissue (GALT) following oral antigen in TCR-transgenic mice. J. Immunol. 160: 4708-4718. [Abstract/Free Full Text]
  36. Gorelik, L., R. A. Flavell. 2002. Transforming growth factor-{beta} in T-cell biology. Nat. Rev. Immunol. 2: 46-53. [Medline]
  37. Bode, U., G. Sparmann, J. Westermann. 2001. Gut-derived effector T cells circulating in the blood of the rat: preferential re-distribution by TGF{beta}-1 and IL-4 maintained proliferation. Eur. J. Immunol. 31: 2116-2125. [Medline]
  38. Bode, U., K. Tiedemann, J. Westermann. 2004. CD4+ effector T cell distribution in vivo: TGF-{beta}1/TGF-{beta} receptor II interaction during activation mediates accumulation in the target tissue by preferential proliferation. Eur. J. Immunol. 34: 1050-1058. [Medline]
  39. Zhang, X., L. Giangreco, H. E. Broome, C. M. Dargan, S. L. Swain. 1995. Control of CD4 effector fate: transforming growth factor {beta}1 and interleukin 2 synergize to prevent apoptosis and promote effector expansion. J. Exp. Med. 182: 699-709. [Abstract/Free Full Text]
  40. Fahlen, L., S. Read, L. Gorelik, S. D. Hurst, R. L. Coffman, R. A. Flavell, F. Powrie. 2005. T cells that cannot respond to TGF-{beta} escape control by CD4+CD25+ regulatory T cells. J. Exp. Med. 201: 737-746. [Abstract/Free Full Text]
  41. Langermans, J. A., P. H. Nibbering, M. E. Van Vuren-Van Der Hulst, R. Van Furth. 2001. Transforming growth factor-{beta} suppresses interferon-{gamma}-induced toxoplasmastatic activity in murine macrophages by inhibition of tumour necrosis factor-{alpha} production. Parasite Immunol. 23: 169-175. [Medline]
  42. Schluns, K. S., E. C. Nowak, A. Cabrera-Hernandez, L. Puddington, L. Lefrancois, H. L. Aguila. 2004. Distinct cell types control lymphoid subset development by means of IL-15 and IL-15 receptor {alpha} expression. Proc. Natl. Acad. Sci. USA 101: 5616-5621. [Abstract/Free Full Text]
  43. Colucci, F., M. A. Caligiuri, J. P. Di Santo. 2003. What does it take to make a natural killer?. Nat. Rev. Immunol. 3: 413-425. [Medline]
  44. Grabstein, K. H., J. Eisenman, K. Shanebeck, C. Rauch, S. Srinivasan, V. Fung, C. Beers, J. Richardson, M. A. Schoenborn, M. Ahdieh, et al 1994. Cloning of a T cell growth factor that interacts with the {beta} chain of the interleukin-2 receptor. Science 264: 965-968. [Abstract/Free Full Text]
  45. Pulendran, B.. 2004. Modulating Th1/Th2 responses with microbes, dendritic cells, and pathogen recognition receptors. Immunol. Res. 29: 187-196. [Medline]
  46. Trinchieri, G., S. Pflanz, R. A. Kastelein. 2003. The IL-12 family of heterodimeric cytokines: new players in the regulation of T cell responses. Immunity 19: 641-644. [Medline]
  47. Paul, W. E.. 1987. Interleukin 4/B cell stimulatory factor 1: one lymphokine, many functions. FASEB J. 1: 456-461. [Abstract]
  48. Lund, F. E., B. A. Garvy, T. D. Randall, D. P. Harris. 2005. Regulatory roles for cytokine-producing B cells in infection and autoimmune disease. Curr. Dir. Autoimmun. 8: 25-54. [Medline]
  49. Benjamin, D., T. J. Knobloch, M. A. Dayton. 1992. Human B-cell interleukin-10: B-cell lines derived from patients with acquired immunodeficiency syndrome and Burkitt’s lymphoma constitutively secrete large quantities of interleukin-10. Blood 80: 1289-1298. [Abstract/Free Full Text]
  50. Misslitz, A. C., K. Bonhagen, D. Harbecke, C. Lippuner, T. Kamradt, T. Aebischer. 2004. Two waves of antigen-containing dendritic cells in vivo in experimental Leishmania major infection. Eur. J. Immunol. 34: 715-725. [Medline]
  51. Spitz, M., A. Gearing, M. Callus, L. Spitz, R. Thorpe. 1985. Interleukin-2 in vivo: production of and response to interleukin-2 in lymphoid organs undergoing a primary immune response to heterologous erythrocytes. Immunology 54: 527-532. [Medline]
  52. Assenmacher, M., M. Lohning, A. Scheffold, R. A. Manz, J. Schmitz, A. Radbruch. 1998. Sequential production of IL-2, IFN-{gamma} and IL-10 by individual staphylococcal enterotoxin B-activated T helper lymphocytes. Eur. J. Immunol. 28: 1534-1543. [Medline]
  53. Milicevic, N. M., Z. Milicevic. 1974. Stereological study of splenic tissue compartments in FK506-treated rats. Histol. Histopathol. 12: 995-1001.



This article has been cited by other articles:


Home page
 Int ImmunolHome page
A. Klinger, A. Gebert, K. Bieber, K. Kalies, A. Ager, E. B. Bell, and J. Westermann
Cyclical expression of L-selectin (CD62L) by recirculating T cells
Int. Immunol., April 1, 2009; 21(4): 443 - 455.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
K. Kalies, P. Konig, Y.-M. Zhang, M. Deierling, J. Barthelmann, C. Stamm, and J. Westermann
Nonoverlapping Expression of IL10, IL12p40, and IFN{gamma} mRNA in the Marginal Zone and T Cell Zone of the Spleen after Antigenic Stimulation
J. Immunol., April 15, 2008; 180(8): 5457 - 5465.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
Q. Liu, Z. Liu, C. T. Rozo, H. A. Hamed, F. Alem, J. F. Urban Jr., and W. C. Gause
The Role of B Cells in the Development of CD4 Effector T Cells during a Polarized Th2 Immune Response
J. Immunol., September 15, 2007; 179(6): 3821 - 3830.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kalies, K.
Right arrow Articles by Westermann, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kalies, K.
Right arrow Articles by Westermann, J.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS