The JI PBL Intereron Source
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ince, M. N.
Right arrow Articles by Weinstock, J. V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ince, M. N.
Right arrow Articles by Weinstock, J. V.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Substance via MeSH
The Journal of Immunology, 2006, 176: 726-729.
Copyright © 2006 by The American Association of Immunologists


CUTTING EDGE

Cutting Edge: Heligmosomoides polygyrus Induces TLR4 on Murine Mucosal T Cells That Produce TGF{beta} after Lipopolysaccharide Stimulation1

M. Nedim Ince2,*, David E. Elliott*, Tommy Setiawan*, Arthur Blum*, Ahmed Metwali*, Ying Wang*, Joseph F. Urban, Jr.{dagger} and Joel V. Weinstock3,*

* Department of Internal Medicine, Division of Gastroenterology and Hepatology, University of Iowa, Carver College of Medicine, Iowa City, IA 52242; and {dagger} U.S. Department of Agriculture, Agricultural Research Service, Nutrient Requirements and Functions Laboratory, Beltsville Human Nutrition Research Center, Beltsville, MD 20705


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Helminths are immune modulators that down-regulate colitis in inflammatory bowel disease. In animal models, intestinal bacteria drive colitis and in humans certain alleles of the LPS receptor protein TLR4 increase inflammatory bowel disease susceptibility. To understand helminthic immune modulation in the gut, we studied the influence of intestinal Heligmosomoides polygyrus colonization on LPS-induced lamina propria mononuclear cell (LPMC) cytokine responses in mice. LPS did not stimulate TGF{beta} production from LPMC of uninfected mice. LPS strongly induced LPMC from worm-infected animals to secrete TGF{beta}, but not TNF-{alpha} or IL-12. The TGF{beta} derived from mucosal T cells. Helminth infection up-regulated TLR4 expression only in lamina propria T cells. LPMC from worm-infected TLR4 mutant animals did not respond to LPS, suggesting that LPS required TLR4 to stimulate TGF{beta} secretion. Thus, during helminth infection, LPS challenge induces mucosal T cells to make TGF{beta} through a TLR4-dependent process without promoting synthesis of proinflammatory cytokines.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Helminthic exposure alters the immune reactivity of the human (1, 2) and murine host to immunological stimuli unrelated to the parasite. Most helminthic organisms stimulate the host to produce Th2 cytokines (IL-4, IL-5, IL-9, IL-13) (3), while blocking Th1 cytokine responses (IL-12, IFN-{gamma}). In some cases, the Th2 response to helminths deviates Th1 antigenic immunity toward Th2 (4, 5). Helminths also induce production of powerful immune modulatory molecules like IL-10 and TGF{beta} (6) that can affect both Th1 and Th2 function.

Inflammatory bowel disease (IBD)4 is an idiopathic immunological disease of the intestines subclassified as either ulcerative colitis or Crohn’s disease (CD). Intestinal flora probably drives the inflammation (7).

Animal models of IBD suggest that helminths can prevent disease onset and reverse ongoing disease (8, 9). The positive outcome of clinical trials using helminths to treat human IBD (10) supports the concept that helminths can down-modulate intestinal immune reactivity. Little is known regarding how helminths modulate or prevent IBD or other immunological diseases.

Genetic studies have linked mutations affecting proteins of innate immune pathways with human IBD susceptibility. Various mutations in NOD2, which is a cytosolic protein that senses bacterial peptidoglycan, make individuals vulnerable to CD. Also, certain alleles of TLR4 that recognizes Gram-negative bacterial LPS may confer susceptibility to both CD and ulcerative colitis (11, 12). The link between LPS and IBD could be particularly important since LPS, via TLR4 stimulation, usually promotes production of proinflammatory molecules. We therefore examined whether helminth colonization with the murine helminth Heligmosomoides polygyrus would alter LPS responses in the gut.

In this study, we show that murine LPMC from normal intestine are largely unresponsive to LPS stimulation. After helminth infection, LPS challenge unexpectedly induced mucosal T cells to make TGF{beta} through a TLR4-dependent process without promoting synthesis of proinflammatory cytokines. Thus, H. polygyrus intestinal exposure may alter the interaction of the host with gut bacterial-derived LPS promoting mucosal immune quiescence.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Animals and worm treatment

Five- to 7-wk-old C56BL/6 wild-type (WT) and C57BL/10ScN mice with a point mutation in the TLR4 gene (The Jackson Laboratory) were colonized by gastric lavage with 200 third-stage H. polygyrus larvae (U.S. National Helminthological Collection No. 81930). Two weeks after worm colonization mice were sacrificed for experimentation. Animal studies have been reviewed and approved by our institutional review committee.

Cell culture

LPMC from the terminal ileum were isolated as described previously (13). For T cell enrichment and depletion, Thy1.2+ cells were isolated using Ab-coated, paramagnetic beads (Dynal). T cell purity was >98%, and T cell contamination in the non-T cell compartment was <1% by flow cytometry. Our cell culture medium has been described previously (13). For TGF{beta} ELISA, 1%, rather than 10%, FCS was used with 1 mg/ml albumin (Amresco) added. The cells were cultured alone or with anti-CD3 (2C11; American Type Culture Collection) and anti-CD28 mAbs (BD Pharmingen); each at 1 µg/ml), or 100 ng/ml highly purified LPS derived from Escherichia coli 026:B6 (Sigma-Aldrich), or 0.6 µg/ml synthetic phosphorothioate backbone oligonucleotide oligodeoxynucleotide 1826 (TCCATGACGTTCCTGACGTT) with two (underlined) immunostimulatory CpG motifs (Coley Pharmaceutical Group). T cell-enriched or -depleted LPMC were cultured alone or with plate-bound anti-CD3 and soluble anti-CD28 mAbs or LPS.

Flow cytometry

LPMC were stained using anti-Thy1.2 FITC, anti-CD11c FITC, anti-CD25 FITC, anti-CD8 FITC, anti-CD3 PE-Cy7, and anti-CD4 PerCP (BD Pharmingen) and rat anti-mouse TLR4-MD2 PE (Santa Cruz Biotechnology) and analyzed as described (13).

RNA extraction and RT-PCR

Total cellular RNA was extracted from isolated LPMC, LP T cells, or LP cells depleted of T cells and reverse transcribed as defined before (14) for TLR4 (15), F4/80 (16), CD3{gamma} (17), and hypoxanthine phosphoribosyltransferase PCR.

Sandwich ELISA

TGF{beta} ELISA was performed using paired Abs (R&D Systems) according to the manufacturer’s instructions. TNF-{alpha} ELISA was done using primary capture Ab from DNAX (Palo Alto, CA) and biotinylated anti-TNF-{alpha} Ab (PeproTech). IL-12(p40) ELISA was performed using primary capture Ab C17.15 (a gift from Dr. G. Trinchieri, National Institutes of Health, Bethesda, MD) and biotinylated secondary Ab (Endogen). IL-10 was captured with anti-IL-10 mAb (MAB417; R&D Systems) and detected with biotinylated mAb (BAF417; R&D Systems).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
LPS induces LPMC to produce TGF{beta} in mice infected with H. polygyrus

LPS is released by bacteria that reside in the distal intestine. This study determined whether H. polygyrus, a murine intestinal helminth, alters host terminal ileal LPMC cytokine responses to LPS. LPMC isolated from helminth-infected or uninfected control mice failed to respond in vitro to LPS stimulation with production of IL-12(p40) or TNF-{alpha} as measured by ELISA (Fig. 1) or intracellular cytokine staining (data not shown). The sensitivity of our ELISAs for TNF-{alpha} and IL12(p40) were down to 30 pg/ml. LPS stimulated the RAW264.7 macrophage cell line to produce TNF-{alpha} beginning at 1 and plateauing at 100 ng/ml (Fig. 1A). In LPMC from uninfected mice, anti-CD3/28 induced TNF-{alpha} secretion, and CpG stimulated IL12(p40) production (Fig. 1, B and C). These data indicate that LPMC can generate these two proinflammatory cytokines, but did not in response to LPS.



View larger version (18K):
[in this window]
[in a new window]
 
FIGURE 1. LPMC do not produce IL12(p40) or TNF-{alpha} in response to LPS stimulation. A, The RAW264.7 macrophage cell line was stimulated with 1, 10, 100, and 1000 ng/ml LPS. Supernatants were harvested 48 h later for TNF-{alpha} ELISA. B–D, LPMC from uninfected control mice were stimulated with 100 ng/ml LPS, 0.6 µg/ml CpG, and anti-CD3/anti-CD28 (each 1 µg/ml). Supernatants were harvested 48 h later for TNF-{alpha}, IL12(p40), and IL-10 ELISA. Data are mean determinations from three separate experiments performed in triplicate ± SE.

 
Next, we determined whether LPS affected production of the immunomodulatory cytokines IL-10 or TGF{beta}. LPS stimulated LPMC from uninfected mice to produce IL-10 (Fig. 1D). Colonization with H. polygyrus did not enhance LPS-induced IL-10 production (data not shown).

Unstimulated LPMC from control and helminth-infected mice secreted TGF{beta} at comparable levels (Fig. 2A). LPS did not stimulate TGF{beta} production by LPMC of control mice. However, LPMC from H. polygyrus-infected mice responded to LPS with a striking 5-fold increase in TGF{beta} production (Fig. 2A).



View larger version (13K):
[in this window]
[in a new window]
 
FIGURE 2. LPS-induced TGF{beta} production from LPMC is T cell dependent. A, LPMC from uninfected WT (Control) or H. polygyrus-infected mice were isolated and cultured with or without 100 ng/ml LPS. Supernatants were harvested 48 h later for TGF{beta} ELISA. B, Isolated LP T cells (T cells) or LPMC depleted of T cells (non-T) from H. polygyrus-infected mice were cultured in vitro and analyzed for TGF{beta} production. Some wells contained LPS (100 ng/ml). Other cells were cultured in wells coated with anti-CD3 and exposed to soluble anti-CD28 (1 µg/ml). Data are mean determinations from three separate experiments performed in triplicate ± SE.

 
LP T cells are the source of TGF{beta} after LPS stimulation

To determine the cellular subgroup in LPMC that made TGF{beta} in response to LPS, LPMC were separated into T cell-enriched and T cell-depleted fractions. Unstimulated T cell-enriched and T cell-depleted LPMC released similar amounts of TGF{beta} into their culture supernatants (Fig. 2B). Only T cells produced more TGF{beta} (3-fold) after LPS stimulation (Fig. 2B). The amount of TGF{beta} produced by T cells in response to LPS was similar to that produced after anti-CD3-induced TCR activation (Fig. 2B).

Helminth infection increases TLR4 expression in LP T cells

LPS acts through TLR4 to stimulate mammalian cells. Therefore, we investigated the influence of H. polygyrus infection on LP T cell TLR4 expression. RNA from LP T cells was isolated from helminth-infected or uninfected mice. The efficiency of T cell separation was assessed by using RT-PCR to detect F4/80 (macrophage marker) and CD3{gamma} (T cell marker) transcripts. The F4/80 message was present in unfractionated LPMC from TLR4-deficient (Fig. 3A) and WT mice (data not shown), but was absent in T cell-enriched fractions. CD3{gamma} transcription was present in unfractionated as well as T cell-enriched isolates (Fig. 3A). RNA was analyzed for TLR4 mRNA content. cDNA from LP T cells of TLR4 mutant mice that do not produce TLR4 transcripts served as the negative control. Little or no TLR4 transcripts were detected in RNA from LP T cells of uninfected WT mice (Fig. 3A). Yet, LP T cells from mice infected with H. polygyrus were strongly positive for TLR4 mRNA (Fig. 3A).



View larger version (53K):
[in this window]
[in a new window]
 
FIGURE 3. H. polygyrus induces LP T cells to express TLR4 mRNA and protein. A, RNA from LPMC of control (NW) or H. polygyrus-infected (W) TLR4 mutant (knockout (KO)) mice or purified LP T cells of control (NW) or H. polygyrus-infected (W) WT mice was isolated and analyzed for TLR4, CD3{gamma}, F4/80, and hypoxanthine phosphoribosyltransferase gene (HPRT) expression. Shown are the results from two separate experiments (1 and 2). B, LP cells from uninfected control (NW) or worm-infected (W) mice were stained for CD3 and TLR4-MD2 and analyzed by FACS. C, LP cells from worm-infected mice were stained for TLR4-MD2, CD3, CD4, and CD8. Left panel, CD4/CD8 costaining of cells gated on TLR4-MD2-positive LPMC. Middle panel, TLR4-MD2/CD4 costaining of cells gated on CD3-positive LPMC. Right panel, TLR4-MD2/CD8 costaining of cells gated on CD3-positive LPMC. D, LPMC from worm-infected mice were stained for CD25 and CD4. Left panel, Whole lymphoid gate. Right panel, CD4 and CD25 costaining of TLR4-MD2-positive cells in lymphoid gate. E, LPMC from uninfected control (NW) and worm-infected (W) mice were stained for CD11c and TLR4-MD2 and analyzed by FACS. Each dot plot graph also displays the percentage of dots in each quadrant. Results are representative of at least three experiments.

 
For optimal responses, LPS binds to MD2 associated with TLR4. Flow analysis with an Ab that recognizes TLR4-MD2 complexes showed that H. polygyrus infection induced surface TLR4/MD2 protein expression on CD3-positive mucosal T cells (Fig. 3B). TLR4-MD2+ LP T cells were CD4 and CD8 single positive (Fig. 3C). CD25 was expressed on ~5% of total LPMC, and TLR4+ LP T cells were not enriched for CD25 expression (Fig. 3D). TLR4-MD2-positive LPMC were CD11c negative (Fig. 3E).

TGF{beta} production in response to LPS is TLR4 dependent

LPS-stimulated cytokine responses are absent in mice without TLR4 or which display a mutant TLR4 receptor. To confirm our observation that LPS-stimulated TGF{beta} production is TLR4 dependent, we used LPMC from H. polygyrus-infected TLR4 mutant mice. LPMC from these mice failed to produce more TGF{beta} with LPS stimulation (Fig. 4). Conversely, these LPMC responded to anti-CD3 mAb with enhanced TGF{beta} production. These data suggest that TGF{beta} release by LP T cells in response to LPS is TLR4 dependent.



View larger version (16K):
[in this window]
[in a new window]
 
FIGURE 4. LPS did not induce a TGF{beta} response from LPMC isolated from TLR4 mutant animals infected with H. polygyrus. LPMC from H. polygyrus-infected mice were isolated and cultured without or with 100 ng/ml LPS, or with anti-CD3/CD28 mAbs. Culture supernatants were analyzed 48 h later for TGF{beta} by ELISA. Data are mean determinations from three separate experiments performed in triplicate ± SE.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
This investigation revealed a potentially important new mechanism through which helminths promote mucosal protection. As suggested by flow analysis and mRNA data, H. polygyrus induces intestinal mucosal T cells to express TLR4, which is the receptor for LPS. LPS usually stimulates cells like macrophages and dendritic cells to produce proinflammatory mediators such as IL-12 and TNF-{alpha}. However, LPMC did not produce IL-12 or TNF-{alpha} with LPS stimulation. After helminth exposure, LPS engagement of TLR4 on LP T cells stimulated production of the modulatory cytokine TGF{beta}, rather than proinflammatory molecules. This TGF{beta} response was lost in TLR4-deficient mice, attesting to the importance of the LPS receptor for cytokine production. Thus, after H. polygyrus exposure, LPS from commensal bacteria could regulate mucosal inflammation by stimulating TGF{beta}-producing T cells.

The TLR4 signaling pathway is important for gastrointestinal mucosal homeostasis (18, 19). Certain TLR4 alleles are associated with IBD in humans (11, 12). It is possible that absence of TLR4 function leads to inappropriate immunity to intestinal flora, resulting in enhanced intestinal inflammation. Our experiments suggest an alternative hypothesis, since induction of functional TLR4 on mucosal T cells followed by LPS stimulation results in TGF{beta} production rather than secretion of proinflammatory molecules.

Transgenic mice with a T cell-selective blockade in TGF{beta} signaling develop colitis, illustrating the importance of TGF{beta} in control of mucosal T cells (20). LPMC from these mice produce abnormally large amounts of IFN-{gamma}, IL12(p40), IL-4, and IL-5 showing that TGF{beta} signaling helps limit both Th1 and Th2 cytokine expression in the intestine (M. N. Ince, T. Setiawan, A. Metwali, A. Blum, J. F. Urban, D. E. Elliott, and J. F. Weinstock, manuscript in preparation). Patients with IBD express high levels of a transcription factor called Smad7 in their intestines that blocks TGF{beta} receptor signaling (21), which may contribute to the disease process.

It is not known how LPS signals through TLR4 to stimulate TGF{beta} synthesis. TLR4 signaling via MyD88 leads to expression of proinflammatory cytokines like TNF-{alpha}. TLR4 also can activate the MyD88 adapter-like pathway (22), which can induce expression of a different array of genes. The specific elements of the TLR4 signaling pathway involved in TGF{beta} secretion remains to be characterized.

TLR4 and CD14 expression increase on murine and human intestinal epithelial cells during inflammation like IBD (23, 24). Therefore, induction of TLR4 expression could be a defense mechanism of mammalian gut to stimulate antibacterial immune responses and to prevent bacterial infection. However, enhanced TLR4 expression in IBD could also protect the mucosa from immunopathology (19). We show here that LP T cells up-regulate TLR4 expression and produce immunoregulatory TGF{beta} in response to LPS during helminth infection Thus, LP T cells may help limit mucosal responses upon LPS exposure. We cannot totally exclude the possibility that a minor dendritic or other LP cell population contaminated nearly pure LP T cell cultures and helped orchestrate LPS-stimulated TGF{beta} production, although we could not detect any such contamination.

Helminths may induce production of regulatory-type immune cells in their host. Terminal ileal LP T cells express high levels of FoxP3 with H. polygyrus colonization (14). This suggests that worms induce regulatory LP T cells. CD4+CD25+ regulatory T cells are reported to express TLR4 and respond to LPS with enhanced suppressor activity (15). Helminth-induced TLR4+ LP T cells did not have increased CD25 display. However, LPS did stimulate these cells to make TGF{beta}, which suggests that helminths induce regulatory Th3-type T cells in intestinal mucosa.

Mucosal responses to LPS are complex, and LPS may be involved both in induction and protection from colitis (18, 19, 25). Helminths induce TLR4 on mucosal T cells. Subsequent LPS exposure stimulates TGF{beta} production, which may help maintain the harmony between luminal bacteria and intestinal mucosa.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by Grants DK38327, DK58755, DK07663, and DK25295. Back

2 Address correspondence and reprint requests to Dr. M. Nedim Ince, Department of Internal Medicine, Division of Gastroenterology and Hepatology, University of Iowa Hospital and Clinics, 4544 JCP, 200 Hawkins Drive, Iowa City, IA 52242. E-mail address: m-nedim-ince{at}uiowa.edu Back

3 Current address: Department of Medicine, Division of Gastroenterology and Hepatology, Tufts New England Medical Center, Boston, MA 02111. Back

4 Abbreviations used in this paper: IBD, inflammatory bowel disease; CD, Crohn’s disease; LPMC, lamina propria mononuclear cell; WT, wild type; LP, lamina propria. Back

Received for publication January 31, 2005. Accepted for publication November 5, 2005.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Borkow, G., Q. Leng, Z. Weisman, M. Stein, N. Galai, A. Kalinkovich, Z. Bentwich. 2000. Chronic immune activation associated with intestinal helminth infections results in impaired signal transduction and anergy. J. Clin. Invest 106: 1053-1060. [Medline]
  2. Bentwich, Z., Z. Weisman, C. Moroz, S. Bar-Yehuda, A. Kalinkovich. 1996. Immune dysregulation in Ethiopian immigrants in Israel: relevance to helminth infections?. Clin. Exp. Immunol. 103: 239-243. [Medline]
  3. Finkelman, F. D., J. F. Urban, Jr. 2001. The other side of the coin: the protective role of the TH2 cytokines. J. Allergy Clin. Immunol. 107: 772-780. [Medline]
  4. Kullberg, M. C., E. J. Pearce, S. E. Hieny, A. Sher, J. A. Berzofsky. 1992. Infection with Schistosoma mansoni alters Th1/Th2 cytokine responses to a non-parasite antigen. J. Immunol. 148: 3264-3270. [Abstract]
  5. Pearlman, E., J. W. Kazura, F. E. Hazlett, Jr, W. H. Boom. 1993. Modulation of murine cytokine responses to mycobacterial antigens by helminth-induced T helper 2 cell responses. J. Immunol. 151: 4857-4864. [Abstract]
  6. Maizels, R. M., M. Yazdanbakhsh. 2003. Immune regulation by helminth parasites: cellular and molecular mechanisms. Nat. Rev. Immunol. 3: 733-744. [Medline]
  7. Sartor, R. B.. 2004. Therapeutic manipulation of the enteric microflora in inflammatory bowel diseases: antibiotics, probiotics, and prebiotics. Gastroenterology 126: 1620-1633.
  8. Moreels, T. G., R. J. Nieuwendijk, J. G. De Man, B. Y. De Winter, A. G. Herman, E. A. Van Marck, P. A. Pelckmans. 2004. Concurrent infection with Schistosoma mansoni attenuates inflammation induced changes in colonic morphology, cytokine levels, and smooth muscle contractility of trinitrobenzene sulphonic acid induced colitis in rats. Gut 53: 99-107. [Abstract/Free Full Text]
  9. Khan, W. I., P. A. Blennerhasset, A. K. Varghese, S. K. Chowdhury, P. Omsted, Y. Deng, S. M. Collins. 2002. Intestinal nematode infection ameliorates experimental colitis in mice. Infect. Immun. 70: 5931-5937. [Abstract/Free Full Text]
  10. Summers, R. W., D. E. Elliott, J. F. Urban, Jr, R. Thompson, J. V. Weinstock. 2005. Trichuris suis therapy in Crohn’s disease. Gut 54: 87-90. [Abstract/Free Full Text]
  11. Torok, H. P., J. Glas, L. Tonenchi, T. Mussack, C. Folwaczny. 2004. Polymorphisms of the lipopolysaccharide-signaling complex in inflammatory bowel disease: association of a mutation in the Toll-like receptor 4 gene with ulcerative colitis. Clin. Immunol. 112: 85-91. [Medline]
  12. Franchimont, D., S. Vermeire, H. El Housni, M. Pierik, K. Van Steen, T. Gustot, E. Quertinmont, M. Abramowicz, A. Van Gossum, J. Deviere, P. Rutgeerts. 2004. Deficient host-bacteria interactions in inflammatory bowel disease? The Toll-like receptor (TLR)-4 Asp299gly polymorphism is associated with Crohn’s disease and ulcerative colitis. Gut 53: 987-992. [Abstract/Free Full Text]
  13. Weinstock, J. V., A. Blum, A. Metwali, D. Elliott, N. Bunnett, R. Arsenescu. 2003. Substance P regulates Th1-type colitis in IL-10 knockout mice. J. Immunol. 171: 3762-3767. [Abstract/Free Full Text]
  14. Elliott, D. E., T. Setiawan, A. Metwali, A. Blum, J. F. Urban, Jr, J. V. Weinstock. 2004. Heligmosomoides polygyrus inhibits established colitis in IL-10-deficient mice. Eur. J. Immunol. 34: 2690-2698. [Medline]
  15. Caramalho, I., T. Lopes-Carvalho, D. Ostler, S. Zelenay, M. Haury, J. Demengeot. 2003. Regulatory T cells selectively express Toll-like receptors and are activated by lipopolysaccharide. J. Exp. Med. 197: 403-411. [Abstract/Free Full Text]
  16. Inoue, T., D. Plieth, C. D. Venkov, C. Xu, E. G. Neilson. 2005. Antibodies against macrophages that overlap in specificity with fibroblasts. Kidney Int. 67: 2488-2493. [Medline]
  17. Renno, T., M. Krakowski, C. Piccirillo, J. Y. Lin, T. Owens. 1995. TNF-{alpha} expression by resident microglia and infiltrating leukocytes in the central nervous system of mice with experimental allergic encephalomyelitis: regulation by Th1 cytokines. J. Immunol. 154: 944-953. [Abstract]
  18. Bashir, M. E., S. Louie, H. N. Shi, C. Nagler-Anderson. 2004. Toll-like receptor 4 signaling by intestinal microbes influences susceptibility to food allergy. J. Immunol. 172: 6978-6987. [Abstract/Free Full Text]
  19. Rakoff-Nahoum, S., J. Paglino, F. Eslami-Varzaneh, S. Edberg, R. Medzhitov. 2004. Recognition of commensal microflora by Toll-like receptors is required for intestinal homeostasis. Cell 118: 229-241. [Medline]
  20. Gorelik, L., R. A. Flavell. 2000. Abrogation of TGF{beta} signaling in T cells leads to spontaneous T cell differentiation and autoimmune disease. Immunity 12: 171-181. [Medline]
  21. Monteleone, G., A. Kumberova, N. M. Croft, C. McKenzie, H. W. Steer, T. T. MacDonald. 2001. Blocking Smad7 restores TGF-{beta}1 signaling in chronic inflammatory bowel disease. J. Clin. Invest. 108: 601-609. [Medline]
  22. O’Neill, L. A.. 2002. Toll-like receptor signal transduction and the tailoring of innate immunity: a role for Mal?. Trends Immunol. 23: 296-300. [Medline]
  23. Meijssen, M. A., S. L. Brandwein, H. C. Reinecker, A. K. Bhan, D. K. Podolsky. 1998. Alteration of gene expression by intestinal epithelial cells precedes colitis in interleukin-2-deficient mice. Am. J. Physiol. 274: G472-G479. [Medline]
  24. Cario, E., D. K. Podolsky. 2000. Differential alteration in intestinal epithelial cell expression of Toll-like receptor 3 (TLR3) and TLR4 in inflammatory bowel disease. Infect. Immun. 68: 7010-7017. [Abstract/Free Full Text]
  25. Abreu, M. T., M. Arditi. 2004. Innate immunity and Toll-like receptors: clinical implications of basic science research. J. Pediatr. 144: 421-429. [Medline]



This article has been cited by other articles:


Home page
Infect. Immun.Home page
T. Setiawan, A. Metwali, A. M. Blum, M. N. Ince, J. F. Urban Jr., D. E. Elliott, and J. V. Weinstock
Heligmosomoides polygyrus Promotes Regulatory T-Cell Cytokine Production in the Murine Normal Distal Intestine
Infect. Immun., September 1, 2007; 75(9): 4655 - 4663.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ince, M. N.
Right arrow Articles by Weinstock, J. V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ince, M. N.
Right arrow Articles by Weinstock, J. V.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Substance via MeSH


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS