|
|
||||||||
CUTTING EDGE |
after Lipopolysaccharide Stimulation1

* Department of Internal Medicine, Division of Gastroenterology and Hepatology, University of Iowa, Carver College of Medicine, Iowa City, IA 52242; and
U.S. Department of Agriculture, Agricultural Research Service, Nutrient Requirements and Functions Laboratory, Beltsville Human Nutrition Research Center, Beltsville, MD 20705
| Abstract |
|---|
|
|
|---|
production from LPMC of uninfected mice. LPS strongly induced LPMC from worm-infected animals to secrete TGF
, but not TNF-
or IL-12. The TGF
derived from mucosal T cells. Helminth infection up-regulated TLR4 expression only in lamina propria T cells. LPMC from worm-infected TLR4 mutant animals did not respond to LPS, suggesting that LPS required TLR4 to stimulate TGF
secretion. Thus, during helminth infection, LPS challenge induces mucosal T cells to make TGF
through a TLR4-dependent process without promoting synthesis of proinflammatory cytokines. | Introduction |
|---|
|
|
|---|
). In some cases, the Th2 response to helminths deviates Th1 antigenic immunity toward Th2 (4, 5). Helminths also induce production of powerful immune modulatory molecules like IL-10 and TGF
(6) that can affect both Th1 and Th2 function. Inflammatory bowel disease (IBD)4 is an idiopathic immunological disease of the intestines subclassified as either ulcerative colitis or Crohns disease (CD). Intestinal flora probably drives the inflammation (7).
Animal models of IBD suggest that helminths can prevent disease onset and reverse ongoing disease (8, 9). The positive outcome of clinical trials using helminths to treat human IBD (10) supports the concept that helminths can down-modulate intestinal immune reactivity. Little is known regarding how helminths modulate or prevent IBD or other immunological diseases.
Genetic studies have linked mutations affecting proteins of innate immune pathways with human IBD susceptibility. Various mutations in NOD2, which is a cytosolic protein that senses bacterial peptidoglycan, make individuals vulnerable to CD. Also, certain alleles of TLR4 that recognizes Gram-negative bacterial LPS may confer susceptibility to both CD and ulcerative colitis (11, 12). The link between LPS and IBD could be particularly important since LPS, via TLR4 stimulation, usually promotes production of proinflammatory molecules. We therefore examined whether helminth colonization with the murine helminth Heligmosomoides polygyrus would alter LPS responses in the gut.
In this study, we show that murine LPMC from normal intestine are largely unresponsive to LPS stimulation. After helminth infection, LPS challenge unexpectedly induced mucosal T cells to make TGF
through a TLR4-dependent process without promoting synthesis of proinflammatory cytokines. Thus, H. polygyrus intestinal exposure may alter the interaction of the host with gut bacterial-derived LPS promoting mucosal immune quiescence.
| Materials and Methods |
|---|
|
|
|---|
Five- to 7-wk-old C56BL/6 wild-type (WT) and C57BL/10ScN mice with a point mutation in the TLR4 gene (The Jackson Laboratory) were colonized by gastric lavage with 200 third-stage H. polygyrus larvae (U.S. National Helminthological Collection No. 81930). Two weeks after worm colonization mice were sacrificed for experimentation. Animal studies have been reviewed and approved by our institutional review committee.
Cell culture
LPMC from the terminal ileum were isolated as described previously (13). For T cell enrichment and depletion, Thy1.2+ cells were isolated using Ab-coated, paramagnetic beads (Dynal). T cell purity was >98%, and T cell contamination in the non-T cell compartment was <1% by flow cytometry. Our cell culture medium has been described previously (13). For TGF
ELISA, 1%, rather than 10%, FCS was used with 1 mg/ml albumin (Amresco) added. The cells were cultured alone or with anti-CD3 (2C11; American Type Culture Collection) and anti-CD28 mAbs (BD Pharmingen); each at 1 µg/ml), or 100 ng/ml highly purified LPS derived from Escherichia coli 026:B6 (Sigma-Aldrich), or 0.6 µg/ml synthetic phosphorothioate backbone oligonucleotide oligodeoxynucleotide 1826 (TCCATGACGTTCCTGACGTT) with two (underlined) immunostimulatory CpG motifs (Coley Pharmaceutical Group). T cell-enriched or -depleted LPMC were cultured alone or with plate-bound anti-CD3 and soluble anti-CD28 mAbs or LPS.
Flow cytometry
LPMC were stained using anti-Thy1.2 FITC, anti-CD11c FITC, anti-CD25 FITC, anti-CD8 FITC, anti-CD3 PE-Cy7, and anti-CD4 PerCP (BD Pharmingen) and rat anti-mouse TLR4-MD2 PE (Santa Cruz Biotechnology) and analyzed as described (13).
RNA extraction and RT-PCR
Total cellular RNA was extracted from isolated LPMC, LP T cells, or LP cells depleted of T cells and reverse transcribed as defined before (14) for TLR4 (15), F4/80 (16), CD3
(17), and hypoxanthine phosphoribosyltransferase PCR.
Sandwich ELISA
TGF
ELISA was performed using paired Abs (R&D Systems) according to the manufacturers instructions. TNF-
ELISA was done using primary capture Ab from DNAX (Palo Alto, CA) and biotinylated anti-TNF-
Ab (PeproTech). IL-12(p40) ELISA was performed using primary capture Ab C17.15 (a gift from Dr. G. Trinchieri, National Institutes of Health, Bethesda, MD) and biotinylated secondary Ab (Endogen). IL-10 was captured with anti-IL-10 mAb (MAB417; R&D Systems) and detected with biotinylated mAb (BAF417; R&D Systems).
| Results |
|---|
|
|
|---|
in mice infected with H. polygyrus
LPS is released by bacteria that reside in the distal intestine. This study determined whether H. polygyrus, a murine intestinal helminth, alters host terminal ileal LPMC cytokine responses to LPS. LPMC isolated from helminth-infected or uninfected control mice failed to respond in vitro to LPS stimulation with production of IL-12(p40) or TNF-
as measured by ELISA (Fig. 1) or intracellular cytokine staining (data not shown). The sensitivity of our ELISAs for TNF-
and IL12(p40) were down to 30 pg/ml. LPS stimulated the RAW264.7 macrophage cell line to produce TNF-
beginning at 1 and plateauing at 100 ng/ml (Fig. 1A). In LPMC from uninfected mice, anti-CD3/28 induced TNF-
secretion, and CpG stimulated IL12(p40) production (Fig. 1, B and C). These data indicate that LPMC can generate these two proinflammatory cytokines, but did not in response to LPS.
|
. LPS stimulated LPMC from uninfected mice to produce IL-10 (Fig. 1D). Colonization with H. polygyrus did not enhance LPS-induced IL-10 production (data not shown).
Unstimulated LPMC from control and helminth-infected mice secreted TGF
at comparable levels (Fig. 2A). LPS did not stimulate TGF
production by LPMC of control mice. However, LPMC from H. polygyrus-infected mice responded to LPS with a striking 5-fold increase in TGF
production (Fig. 2A).
|
after LPS stimulation
To determine the cellular subgroup in LPMC that made TGF
in response to LPS, LPMC were separated into T cell-enriched and T cell-depleted fractions. Unstimulated T cell-enriched and T cell-depleted LPMC released similar amounts of TGF
into their culture supernatants (Fig. 2B). Only T cells produced more TGF
(3-fold) after LPS stimulation (Fig. 2B). The amount of TGF
produced by T cells in response to LPS was similar to that produced after anti-CD3-induced TCR activation (Fig. 2B).
Helminth infection increases TLR4 expression in LP T cells
LPS acts through TLR4 to stimulate mammalian cells. Therefore, we investigated the influence of H. polygyrus infection on LP T cell TLR4 expression. RNA from LP T cells was isolated from helminth-infected or uninfected mice. The efficiency of T cell separation was assessed by using RT-PCR to detect F4/80 (macrophage marker) and CD3
(T cell marker) transcripts. The F4/80 message was present in unfractionated LPMC from TLR4-deficient (Fig. 3A) and WT mice (data not shown), but was absent in T cell-enriched fractions. CD3
transcription was present in unfractionated as well as T cell-enriched isolates (Fig. 3A). RNA was analyzed for TLR4 mRNA content. cDNA from LP T cells of TLR4 mutant mice that do not produce TLR4 transcripts served as the negative control. Little or no TLR4 transcripts were detected in RNA from LP T cells of uninfected WT mice (Fig. 3A). Yet, LP T cells from mice infected with H. polygyrus were strongly positive for TLR4 mRNA (Fig. 3A).
|
5% of total LPMC, and TLR4+ LP T cells were not enriched for CD25 expression (Fig. 3D). TLR4-MD2-positive LPMC were CD11c negative (Fig. 3E).
TGF
production in response to LPS is TLR4 dependent
LPS-stimulated cytokine responses are absent in mice without TLR4 or which display a mutant TLR4 receptor. To confirm our observation that LPS-stimulated TGF
production is TLR4 dependent, we used LPMC from H. polygyrus-infected TLR4 mutant mice. LPMC from these mice failed to produce more TGF
with LPS stimulation (Fig. 4). Conversely, these LPMC responded to anti-CD3 mAb with enhanced TGF
production. These data suggest that TGF
release by LP T cells in response to LPS is TLR4 dependent.
|
| Discussion |
|---|
|
|
|---|
. However, LPMC did not produce IL-12 or TNF-
with LPS stimulation. After helminth exposure, LPS engagement of TLR4 on LP T cells stimulated production of the modulatory cytokine TGF
, rather than proinflammatory molecules. This TGF
response was lost in TLR4-deficient mice, attesting to the importance of the LPS receptor for cytokine production. Thus, after H. polygyrus exposure, LPS from commensal bacteria could regulate mucosal inflammation by stimulating TGF
-producing T cells.
The TLR4 signaling pathway is important for gastrointestinal mucosal homeostasis (18, 19). Certain TLR4 alleles are associated with IBD in humans (11, 12). It is possible that absence of TLR4 function leads to inappropriate immunity to intestinal flora, resulting in enhanced intestinal inflammation. Our experiments suggest an alternative hypothesis, since induction of functional TLR4 on mucosal T cells followed by LPS stimulation results in TGF
production rather than secretion of proinflammatory molecules.
Transgenic mice with a T cell-selective blockade in TGF
signaling develop colitis, illustrating the importance of TGF
in control of mucosal T cells (20). LPMC from these mice produce abnormally large amounts of IFN-
, IL12(p40), IL-4, and IL-5 showing that TGF
signaling helps limit both Th1 and Th2 cytokine expression in the intestine (M. N. Ince, T. Setiawan, A. Metwali, A. Blum, J. F. Urban, D. E. Elliott, and J. F. Weinstock, manuscript in preparation). Patients with IBD express high levels of a transcription factor called Smad7 in their intestines that blocks TGF
receptor signaling (21), which may contribute to the disease process.
It is not known how LPS signals through TLR4 to stimulate TGF
synthesis. TLR4 signaling via MyD88 leads to expression of proinflammatory cytokines like TNF-
. TLR4 also can activate the MyD88 adapter-like pathway (22), which can induce expression of a different array of genes. The specific elements of the TLR4 signaling pathway involved in TGF
secretion remains to be characterized.
TLR4 and CD14 expression increase on murine and human intestinal epithelial cells during inflammation like IBD (23, 24). Therefore, induction of TLR4 expression could be a defense mechanism of mammalian gut to stimulate antibacterial immune responses and to prevent bacterial infection. However, enhanced TLR4 expression in IBD could also protect the mucosa from immunopathology (19). We show here that LP T cells up-regulate TLR4 expression and produce immunoregulatory TGF
in response to LPS during helminth infection Thus, LP T cells may help limit mucosal responses upon LPS exposure. We cannot totally exclude the possibility that a minor dendritic or other LP cell population contaminated nearly pure LP T cell cultures and helped orchestrate LPS-stimulated TGF
production, although we could not detect any such contamination.
Helminths may induce production of regulatory-type immune cells in their host. Terminal ileal LP T cells express high levels of FoxP3 with H. polygyrus colonization (14). This suggests that worms induce regulatory LP T cells. CD4+CD25+ regulatory T cells are reported to express TLR4 and respond to LPS with enhanced suppressor activity (15). Helminth-induced TLR4+ LP T cells did not have increased CD25 display. However, LPS did stimulate these cells to make TGF
, which suggests that helminths induce regulatory Th3-type T cells in intestinal mucosa.
Mucosal responses to LPS are complex, and LPS may be involved both in induction and protection from colitis (18, 19, 25). Helminths induce TLR4 on mucosal T cells. Subsequent LPS exposure stimulates TGF
production, which may help maintain the harmony between luminal bacteria and intestinal mucosa.
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported by Grants DK38327, DK58755, DK07663, and DK25295. ![]()
2 Address correspondence and reprint requests to Dr. M. Nedim Ince, Department of Internal Medicine, Division of Gastroenterology and Hepatology, University of Iowa Hospital and Clinics, 4544 JCP, 200 Hawkins Drive, Iowa City, IA 52242. E-mail address: m-nedim-ince{at}uiowa.edu ![]()
3 Current address: Department of Medicine, Division of Gastroenterology and Hepatology, Tufts New England Medical Center, Boston, MA 02111. ![]()
4 Abbreviations used in this paper: IBD, inflammatory bowel disease; CD, Crohns disease; LPMC, lamina propria mononuclear cell; WT, wild type; LP, lamina propria. ![]()
Received for publication January 31, 2005. Accepted for publication November 5, 2005.
| References |
|---|
|
|
|---|
expression by resident microglia and infiltrating leukocytes in the central nervous system of mice with experimental allergic encephalomyelitis: regulation by Th1 cytokines. J. Immunol. 154: 944-953. [Abstract]
signaling in T cells leads to spontaneous T cell differentiation and autoimmune disease. Immunity 12: 171-181. [Medline]
1 signaling in chronic inflammatory bowel disease. J. Clin. Invest. 108: 601-609. [Medline]This article has been cited by other articles:
![]() |
T. Setiawan, A. Metwali, A. M. Blum, M. N. Ince, J. F. Urban Jr., D. E. Elliott, and J. V. Weinstock Heligmosomoides polygyrus Promotes Regulatory T-Cell Cytokine Production in the Murine Normal Distal Intestine Infect. Immun., September 1, 2007; 75(9): 4655 - 4663. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |