The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yu, S.
Right arrow Articles by Braley-Mullen, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yu, S.
Right arrow Articles by Braley-Mullen, H.
The Journal of Immunology, 2006, 176: 1259-1265.
Copyright © 2006 by The American Association of Immunologists

Thyrocytes Responding to IFN-{gamma} Are Essential for Development of Lymphocytic Spontaneous Autoimmune Thyroiditis and Inhibition of Thyrocyte Hyperplasia1

Shiguang Yu*, Gordon C. Sharp*,{dagger} and Helen Braley-Mullen2,*,{ddagger},§

* Department of Internal Medicine, {dagger} Department of Pathology, and {ddagger} Department of Molecular Microbiology and Immunology, University of Missouri School of Medicine, Columbia, MO 65212; and § Department of Veterans Affairs, Research Service, Columbia, MO 65212


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
IFN-{gamma} promotes the development of lymphocytic spontaneous autoimmune thyroiditis (L-SAT) in NOD.H-2h4 mice and inhibits the development of thyrocyte hyperplasia and proliferation (TEC H/P). The precise mechanisms by which IFN-{gamma} promotes L-SAT and inhibits TEC H/P are unknown. To determine whether responsiveness of lymphocytes or thyrocytes to IFN-{gamma} is important for the development of these lesions, IFN-{gamma}R–/– mice, which develop TEC H/P similar to IFN-{gamma}–/– mice, were used as recipients for adoptive cell transfer. Wild-type (WT) splenocytes or bone marrow induced L-SAT and inhibited TEC H/P in IFN-{gamma}–/–, but not IFN-{gamma}R–/– recipients. IFN-{gamma}R–/– recipients of WT cells developed severe TEC H/P, but did not develop L-SAT, suggesting that thyrocytes responding to IFN-{gamma} are important for inhibition of TEC H/P. Unexpectedly, IFN-{gamma}R–/– splenocytes or bone marrow did not induce L-SAT in IFN-{gamma}–/– or WT mice even though IFN-{gamma}R–/– lymphocyte donors produced as much IFN-{gamma} as lymphocytes from WT donors, and thyrocytes could respond to IFN-{gamma}. Real-time PCR indicated that recipients of IFN-{gamma}R–/– bone marrow expressed less mRNA for IFN-{gamma}-inducible chemokines compared with recipients of WT bone marrow. This might limit the migration of IFN-{gamma}R–/– lymphocytes to thyroids. Few IFN-{gamma}R–/– lymphocytes infiltrated thyroids even in the presence of WT lymphocytes, suggesting that lymphocytes unable to respond to IFN-{gamma} are not induced to migrate to thyroids. These results suggest that thyrocytes must be able to respond to IFN-{gamma} for the development of L-SAT and inhibition of TEC H/P, and lymphocytes must be able to respond to IFN-{gamma} to induce L-SAT.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Lymphocytic spontaneous autoimmune thyroiditis (L-SAT)3 in NOD.H-2h4 mice is characterized by infiltration of thyroids by CD4+ T cells, B cells, and CD8+ T cells (1, 2, 3, 4). Our previous studies showed that IFN-{gamma} has a dual role in SAT, promoting L-SAT and inhibiting thyroid epithelial cell hyperplasia and proliferation (TEC H/P) (5). TEC H/P is characterized by excessive proliferation of thyroid follicular cells, resulting in epithelial cell hyperplasia, ultimately leading to fibrosis and decreased thyroid function (32). TEC H/P in IFN-{gamma}–/– NOD.H-2h4 mice has an autoimmune basis, because thyroid-infiltrating lymphocytes are required for its development, and all mice with thyrocyte hyperplasia produced anti-mouse thyroglobulin Ab (32). However, the mechanisms by which IFN-{gamma} induces L-SAT and inhibits TEC H/P are still unknown.

IFN-{gamma}R is expressed on most cell types (6). IFN-{gamma} and IFN-{gamma}R are of central importance for mediating autoimmunity, and mice with disrupted genes for IFN-{gamma} or IFN-{gamma}R have severe defects in IFN-{gamma}-mediated responses and defects in host defense (7, 8). The roles of IFN-{gamma} in experimental autoimmune thyroiditis (EAT) in mice are complex. IFN-{gamma} has been shown to promote, suppress, or have no influence on EAT induction (9, 10, 11, 12, 13, 14). Thyroid-specific expression of IFN-{gamma} in NOD.H-2h4 mice limits EAT (9), and expression of the IFN-{gamma} transgene in thyroids of C57BL/6 mice induces hypothyroidism (15). The same cytokine can have dramatically different effects depending on the organ in which it is expressed, and these effects may be diametrically opposite. These considerations encourage investigation of the role of IFN-{gamma} in the initiation or progression of autoimmune disease.

To increase our understanding of how IFN-{gamma} regulates the development of L-SAT and inhibits TEC H/P, the cellular events involved in this process need to be understood. Our hypothesis is that IFN-{gamma} inhibits TEC H/P and promotes L-SAT in NOD.H-2h4 mice by its effects on IFN-{gamma}-responsive thyrocytes. The aim of the present study was to determine whether thyrocytes or lymphocytes must be able to respond to IFN-{gamma} for the development of L-SAT and inhibition of TEC H/P. By using IFN-{gamma}R–/– mice and adoptive cell transfer, we show that suppression of TEC H/P and induction of L-SAT both require thyrocyte responsiveness to IFN-{gamma}, and lymphocyte responsiveness to IFN-{gamma} is important for the development of L-SAT.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 Disclosures
 References
 
Mice

NOD.H-2h4 mice are I-E-negative and express H-2Kk, I-Ak, and Dd on the NOD background (16). IFN-{gamma}–/– NOD.H-2h4 mice were generated as previously described (5). IFN-{gamma}R–/– male NOD mice (17), provided by Dr. D. Serreze (The Jackson Laboratory, Bar Harbor, ME), were crossed with NOD.H-2h4 mice. IFN-{gamma}R–/– NOD.H-2h4 mice were generated by breeding F1 mice and selecting F2 mice for the expression of the H-2Kk MHC class I molecule and the IFN-{gamma}R neo allele by PCR analysis of tail DNA using primers described in Ref.17 . After selection of mice homozygous for H-2Kk and the IFN-{gamma}R neo insert, mice were bred in our animal facilities under specific pathogen-free conditions. Mice homozygous for the disrupted IFN-{gamma} or IFN-{gamma}R gene as well as wild-type (WT) NOD.H-2h4 mice received 0.05% sodium iodide (NaI) in their drinking water for 2–7 mo beginning at 7–8 wk of age. Both male and female mice were used, although all mice in a given experiment were the same sex. For some experiments, WT Thy1.1+ NOD.H-2h4 mice, generated as previously described (5), were used to distinguish donor and recipient T cells in cell transfer experiments. Heterozygous IFN-{gamma}+/– and IFN-{gamma}R+/– NOD.H-2h4 mice were also used, and they had L-SAT similar to that of WT NOD.H-2h4 mice (data not shown). All animal protocols were approved by the University of Missouri animal care and use committee.

Evaluation of thyroiditis

At various intervals after receiving NaI in water, thyroids were removed, and one thyroid lobe from each mouse was fixed in formalin, sectioned, and stained with H&E as previously described (2, 5). All slides were coded before being scored by two individuals, one of whom had no knowledge of the experimental groups. The other thyroid lobe was snap-frozen in liquid nitrogen and stored at –70°C for use in immunohistochemical staining or for isolation of RNA for RT-PCR. Thyroid histopathology was scored for the extent of thyroid follicle replacement or destruction using a scale of 0 to 5+ as previously described (2, 5). Briefly, a score of 0 indicates a normal thyroid, whereas 0+ indicates mild follicular changes and/or a few inflammatory cells infiltrating the thyroids. A 1+ severity score is defined as an inflammatory infiltrate of at least 125 cells in one or several foci or hyperplasia of TEC sufficient to cause replacement of several follicles. A 2+ score represents 10–20 foci of cellular infiltration, each the size of several follicles, or TEC H/P changes causing replacement or destruction of up to one-quarter of the gland; a 3+ score indicates that one-quarter to one-half of the gland is destroyed by infiltrating inflammatory cells or hyperplasia/proliferative changes, and a 4+ score indicates that greater than one-half of the gland is destroyed. Thyroids given a score of 5+ had few or no remaining intact follicles; 5+ lesions occurred only in IFN-{gamma}–/– or IFN-{gamma}R–/– mice with severe TEC H/P. In this report, thyroid lesions referred to as severe TEC H/P all have 4–5+ severity scores, with few or no remaining thyroid follicles.

Thyroids of IFN-{gamma}–/– and IFN-{gamma}R–/– mice were characterized by variable degrees of TEC H/P, with few infiltrating lymphocytes compared with WT thyroids. Thyroid lesions in IFN-{gamma}–/– and IFN-{gamma}R–/– mice graded 0+ to 2+ had areas containing groups of small follicles (microfollicles) often devoid of colloid and closely juxtaposed with compression of the interstitial areas. Surrounding thyrocytes were enlarged and became cuboidal or columnar, and small numbers of lymphocytes were scattered throughout these areas. The more severe lesions in IFN-{gamma}–/– and IFN-{gamma}R–/– mice (graded 4–5+ based on the percentage of normal thyroid follicles remaining) had widespread clusters of proliferating thyrocytes and histiocytes, with some lymphocyte infiltration. The areas of proliferating thyrocytes were usually surrounded by collagen. All thyroids with mild or severe TEC H/P had some infiltrating lymphocytes, primarily T cells, but lymphocyte infiltration was always much less than in thyroids of WT mice with L-SAT.

Immunohistochemical staining

Immunohistochemical staining was performed as previously described (5). The following primary Abs, anti-CD4 (GK1.5; American Type Culture Collection), anti-CD8 (53-6.7; American Type Culture Collection), and anti-B220 (Caltag Laboratories) were used individually on frozen thyroid sections. Biotinylated goat anti-rat IgG (Caltag Laboratories) was used as secondary Ab. Biotinylated anti-Thy1.1 or anti-Thy1.2 (BD Pharmingen) was used for detecting donor vs recipient T cells. Hydrogen peroxide (0.3%; Sigma-Aldrich) was applied for 30 min to block endogenous peroxidase, and sections were incubated with the Vectastain Elite ABC (avidin-biotin complex) kit (Vector Laboratories) for 30 min. Peroxidase activity was visualized using the Nova-Red substrate (Vector Laboratories). Sections were counterstained with hematoxylin. Negative controls were performed as described above using IgG isotype controls as primary Ab; these controls were always negative.

Splenocyte transfer

A single pool of splenocytes from Thy1.1 WT mice was injected i.v. (3 x 107 cells) into 8- to 9-wk-old, 300-rad-irradiated, IFN-{gamma}–/– and IFN-{gamma}R–/– mice. Control IFN-{gamma}–/– and IFN-{gamma}R–/– mice received 300 rad irradiation, but no splenocytes. On the day of cell transfer, mice received 0.05% NaI in water, and thyroids were removed 3–5 mo later.

Bone marrow (BM) transplantation

Six- to 7-wk-old IFN-{gamma}–/–, IFN-{gamma}R–/–, and Thy1.1+ or Thy1.2+ WT mice were irradiated (1100 rad), and Thy1.1+ or Thy 1.2+ WT or Thy1.2+ IFN-{gamma}R–/– BM was injected i.v. into recipient mice. Six weeks later, mice were given NaI in water, and thyroids were removed 3 mo later for evaluation of thyroid histopathology.

Flow cytometry

For detecting donor Thy1.1+ and recipient Thy1.2+ T cells, recipient splenocytes were stained and examined for the expression of CD4+ and CD8+ T cells expressing Thy1.1 or Thy1.2 using FITC-conjugated anti-CD4 or anti-CD8 (Caltag Laboratories) and PE-conjugated anti-Thy1.1 or anti-Thy1.2 (BD Pharmingen). Spleen cells were examined for the expression of B220 using FITC-conjugated B220 (Caltag Laboratories). Cells were examined using a FACScan (BD Biosciences).

Semiquantitative and quantitative RT-PCR

Total RNA was isolated from splenocytes using TRIzol (Invitrogen Life Technologies). cDNA was synthesized using reverse transcriptase. Semiquantitative RT-PCR was performed as previously described (5, 18, 19). Quantitative RT-PCR was done using ABsolute QPCR SYBR Green ROX Mix (ABgene) in an ABI PRISM 7000 sequence detection system (Applied Biosystems). A series of five standards with defined values were included in every reaction, and a standard curve was obtained to calculate the amount of gene amplified. A dissociation curve was generated at the end of each PCR to verify the amplification of a single product. The following primers were used for amplification: IFN-{gamma} forward, CAGCAACAACATAAGCGTCA; IFN-{gamma} reverse, CCTCAAACTTGGCAATACTCA; IL-2 forward, CCTGAGCAGGATGGAGAATTACA; IL-2 reverse, TCCAGAACATGCCGCAGAG; CXCL-10 forward, GCCGTCATTTTCTGCCTCAT; CXCL-10 reverse, GCTTCCCTATGGCCCTCATT; CXCL-9 forward, TCTGCCATGAAGTCCGCTG; CXCL-9 reverse, CAGGAGCATCGTGCATTCCT; CXCR3 forward, GCCTTTCTTCTGGAAAACAGC; and CXCR3 reverse, TGCTGCTCAGGGCAGTGCGC; hypoxanthine phosphoribosyltransferase (HPRT) (18). The level of HPRT expression for each sample was used for data normalization.

Student’s t test

Statistical analysis of the data was performed using an unpaired two-tailed Student’s t test. A value of p < 0.05 was considered statistically significant.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 Disclosures
 References
 
IFN-{gamma}R–/– mice develop severe TEC H/P

Sixty to 70% of IFN-{gamma}–/– mice develop severe (4–5+) TEC H/P after 6–7 mo of receiving NaI in water (4). Before using IFN-{gamma}R–/– mice as recipients to test our hypothesis, it was important to know whether IFN-{gamma}R–/– mice would also develop severe TEC H/P. IFN-{gamma}R–/– mice were given NaI in water, and thyroids were removed 4 or 7 mo later to evaluate the histopathology as described in Materials and Methods. Severe TEC H/P developed in both IFN-{gamma}R–/– and IFN-{gamma}–/– mice (Fig. 1), although the incidence was lower in IFN-{gamma}R–/– mice (25 vs 60–70%; p < 0.05). Serum T4 levels were low in both IFN-{gamma}–/– and IFN-{gamma}R–/– mice with severe TEC H/P (data not shown). Proliferating thyrocytes filled the entire thyroid gland, and few or no remaining normal thyroid follicles remained in both IFN-{gamma}–/– and IFN-{gamma}R–/– mice with severe (4–5+) TEC H/P (5) (data not shown). Although no IFN-{gamma}R–/– or IFN-{gamma}–/– mice developed typical L-SAT after prolonged exposure to NaI in water, all mice with mild or severe TEC H/P had some lymphocytes infiltrating their thyroids. All IFN-{gamma}–/– and IFN-{gamma}R–/– mice produced anti-mouse thyroglobulin autoantibody, and autoantibody levels were highest in mice with 4–5+ severity scores (data not shown). Thyroids of mice with severe TEC H/P had minimal lymphocyte infiltration compared with thyroids of WT mice with L-SAT, and lymphocytes tended to localize at the periphery of the gland or were scattered within the gland. Because IFN-{gamma}R–/– mice can presumably produce IFN-{gamma}, but their cells cannot respond to it, these results confirm our previous studies indicating that IFN-{gamma} is important for the development of L-SAT (5) and extend them by showing that the ability to respond to IFN-{gamma} is important for inhibition of TEC H/P.



View larger version (14K):
[in this window]
[in a new window]
  		FIGURE 1. TEC H/P in IFN-{gamma}–/– and IFN-{gamma}R–/– mice were given NaI in water for 6–7 mo. IFN-{gamma}–/– and IFN-{gamma}R–/– mice were given NaI water at 7–8 wk of age, and thyroids were removed 6–7 mo later. Thyroid histology was evaluated according to criteria described in Materials and Methods. IFN-{gamma}R–/– and IFN-{gamma}–/– mice both developed TEC H/P, but the incidence of severe TEC H/P was lower in IFN-{gamma}R–/– mice (p < 0.05). No IFN-{gamma}R–/– or IFN-{gamma}–/– mice developed L-SAT. Two of five representative experiments are shown.

 
WT splenocytes do not inhibit TEC H/P in IFN-{gamma}R–/– recipients

Transfer of WT splenocytes into IFN-{gamma}–/– mice inhibits TEC H/P and results in L-SAT (5). If our hypothesis that IFN-{gamma} acts directly on thyrocytes to inhibit TEC H/P is correct, transfer of WT splenocytes should have no effect on TEC H/P in IFN-{gamma}R–/– mice. To test this hypothesis, Thy1.1+ WT splenocytes were transferred to IFN-{gamma}–/– and IFN-{gamma}R–/– mice. Consistent with our previous results (5), WT splenocytes inhibited TEC H/P and resulted in L-SAT in IFN-{gamma}–/– recipients (Fig. 2 and Fig. 3, A vs B and C). By contrast, the same pool of WT splenocytes did not inhibit TEC H/P or result in L-SAT in IFN-{gamma}R–/– recipients (Fig. 2), suggesting that thyrocyte responsiveness to IFN-{gamma} is necessary for both inhibition of TEC H/P and development of L-SAT. Interestingly, most IFN-{gamma}R–/– recipients of WT splenocytes developed more severe TEC H/P than control IFN-{gamma}R–/– mice (Fig. 2 (p < 0.004) and Fig. 3, G vs H and I), suggesting that WT spleen cells produce a factor that promotes the development of severe TEC H/P in mice unable to respond to IFN-{gamma}.



View larger version (12K):
[in this window]
[in a new window]
  		FIGURE 2. TEC H/P in IFN-{gamma}–/– and IFN-{gamma}R–/– mice given spleen cells from Thy1.1+ WT donors. Mice were given NaI in water on the day of cell transfer, and thyroids were removed 5 mo later. Disease severity scores of individual mice are shown. {circ}, TEC H/P; X, L-SAT. All IFN-{gamma}–/– recipients of WT splenocytes developed L-SAT, whereas IFN-{gamma}R–/– mice given WT splenocytes developed TEC H/P. One of three representative experiments is shown.

 


View larger version (86K):
[in this window]
[in a new window]
  		FIGURE 3. Representative histopathology of H&E-stained thyroid sections from mice given NaI in water for 5 mo. Severe (4–5+) TEC H/P in IFN-{gamma}–/– mice (A) and mild (2+) thyrocyte hyperplasia in IFN-{gamma}R–/– mice (G) was found. IFN-{gamma}–/– mice given Thy1.1+ WT splenocytes developed L-SAT (B and C), whereas IFN-{gamma}R–/– mice given the same pool of WT splenocytes developed severe TEC H/P (H and I). The number of donor Thy1.1+ and recipient Thy1.2+ T cells in thyroids of IFN-{gamma}–/– recipients (D and E) was greater than in IFN-{gamma}R–/– recipients (J and K). Note that most Thy1.1+ cells were widely scattered in IFN-{gamma}R–/– thyroids (J), whereas in IFN-{gamma}–/– thyroids, Thy 1.1+ T cells were clustered within the gland (D). Characteristic of L-SAT lesions, clusters of B220+ B cells were observed in IFN-{gamma}–/– recipients of WT splenocytes (F), whereas very few B cells were observed in IFN-{gamma}R–/– recipients of WT splenocytes (L). Magnification: A, B, G, and H, x100; C–F and I–L, x400.

 
To determine whether the inability of WT splenocytes to inhibit TEC H/P in IFN-{gamma}R–/– mice could be explained by poor survival of WT splenocytes in IFN-{gamma}R–/– compared with IFN-{gamma}–/– recipients, flow cytometry and immunohistochemical staining were used to examine spleens and thyroids of recipient Thy1.2+ mice for the presence of donor Thy1.1+ WT T cells. Similar numbers of Thy1.1+ donor CD4+ and CD8+ T cells were detected by flow cytometry in spleens of IFN-{gamma}–/– and IFN-{gamma}R–/– recipients 5 mo after cell transfer (data not shown). However, there were more donor Thy1.1+ and recipient-derived Thy1.2+ inflammatory cells in thyroids of IFN-{gamma}–/– compared with IFN-{gamma}R–/– recipients (Fig. 3, D and E vs J and K), consistent with the fact that IFN-{gamma}–/– recipients of WT spleen cells had L-SAT (Fig. 3, B and C), whereas IFN-{gamma}R–/– recipients of WT spleen cells had TEC H/P (Fig. 3, H and I). Donor Thy1.1+ WT T cells in thyroids of IFN-{gamma}–/– recipients were generally localized in clusters, and there were also many B220+ B cells (Fig. 3, D and F), which is characteristic of L-SAT (20). In contrast, donor Thy1.1+ T cells in IFN-{gamma}R–/– recipients were scattered (Fig. 3J) or tended to localize primarily at the periphery of the gland (data not shown), and there were very few B220+ cells (Fig. 3L). These results indicate that thyrocytes responding to IFN-{gamma} are important for inhibition of TEC H/P and recruitment of IFN-{gamma}-responsive inflammatory cells to the thyroid to result in L-SAT.

Transfer of WT BM cells into IFN-{gamma}R–/– mice does not inhibit TEC H/P

As shown above, WT splenocytes did not induce L-SAT or inhibit TEC H/P in IFN-{gamma}R–/– recipients. Because endogenous IFN-{gamma}R–/– lymphocytes in recipients of WT splenocytes could contribute to the results, BM chimeras were used to generate recipients in which most lymphocytes would be derived from the donors, and thyrocytes either could or could not respond to IFN-{gamma}. When possible, the BM donors and irradiated recipients differed at Thy1 to distinguish donor- vs recipient-derived T cells. Analysis of peripheral blood by flow cytometry 6 wk after BM reconstitution indicated that 80–90% of the circulating lymphocytes were derived from the BM donors, and very few recipient lymphocytes were detectable (data not shown). Mice were then given NaI in water for 3 mo, donor vs recipient T cells were assessed in the spleen by flow cytometry, and thyroids were removed to assess the development of L-SAT vs TEC H/P. Thy 1.1+ WT bone marrow transferred to Thy1.2+ WT recipients induced L-SAT, whereas the same pool of WT bone marrow induced TEC H/P in IFN-{gamma}R–/– recipients (Fig. 4A) even though most splenic and thyroid-infiltrating lymphocytes were derived from WT BM donors (Fig. 4B; data not shown). As shown above for IFN-{gamma}R–/– recipients of WT splenocytes (Fig. 2), IFN-{gamma}R–/– recipients of WT BM developed more severe TEC H/P than IFN-{gamma}R–/– recipients of IFN-{gamma}R–/– BM (Fig. 4A; p < 0.002), again suggesting that WT lymphocytes may produce a factor that can promote TEC H/P in the absence of thyrocyte responsiveness to IFN-{gamma}.



View larger version (24K):
[in this window]
[in a new window]
  		FIGURE 4. TEC H/P in bone marrow chimeras. A, Recipients were irradiated (1100 rad) and given BM from the indicated donors. Six weeks after BM reconstitution, mice were given NaI in water, and thyroids were removed 3 mo later. {circ}, Mild (0–1+) or severe (4–5+) TEC H/P; X, L-SAT. All IFN-{gamma}R–/– mice given WT BM had severe TEC H/P. B, Flow cytometric analysis indicated that most CD4+ T cells were derived from the donor BM. Mice were the same as those shown in A. One of three representative experiments is shown.

 
IFN-{gamma}R–/– lymphocytes do not induce L-SAT in recipients able to respond to IFN-{gamma}

When IFN-{gamma}R–/– splenocytes are transferred into IFN-{gamma}–/– mice, they should induce L-SAT and inhibit TEC H/P, because donor cells should produce IFN-{gamma}, and thyrocytes should respond to it. In contrast to these expectations, IFN-{gamma}R–/– splenocytes did not inhibit TEC H/P or induce L-SAT after transfer to IFN-{gamma}–/– recipients, whereas WT splenocytes induced L-SAT in IFN-{gamma}–/– recipients (Fig. 5A). Thy 1.1+ WT recipients given IFN-{gamma}R–/– BM (Thy1.2+) also did not develop L-SAT (Fig. 5B) even though the recipient thyroids could respond to IFN-{gamma}, and the IFN-{gamma}R–/– BM donors should produce IFN-{gamma}. The inability of IFN-{gamma}R–/– lymphocytes to induce L-SAT in recipients able to respond to IFN-{gamma} could be explained if IFN-{gamma}R–/– lymphocytes did not produce sufficient IFN-{gamma} in vivo because they are less activated than lymphocytes of WT donors and/or if IFN-{gamma}R–/– lymphocytes are deficient in their ability to migrate to sites of inflammation, as suggested by others (21).



View larger version (12K):
[in this window]
[in a new window]
  		FIGURE 5. IFN-{gamma}R–/– lymphocytes do not induce L-SAT in IFN-{gamma}–/– and WT recipients. A, Unlike adoptive transfer of WT splenocytes, adoptive transfer of IFN-{gamma}R–/– splenocytes did not induce L-SAT and did not inhibit TEC H/P in IFN-{gamma}–/– recipients. B, WT BM induces L-SAT in WT recipients, whereas IFN-{gamma}R–/– BM does not induce L-SAT. X, L-SAT; {circ}, TEC H/P. One of three representative experiments is shown.

 
To address these possibilities, RNA was isolated from spleens of IFN-{gamma}–/– recipients given WT or IFN-{gamma}R–/– splenocytes and then given NaI in water for 5 mo (the two groups shown in Fig. 5A). Semiquantitative RT-PCR analysis indicated that the expression of IFN-{gamma} mRNA was similar for both groups and comparable to that of WT mice given NaI in water for 5 mo (Fig. 6A), suggesting that insufficient production of IFN-{gamma} in vivo was unlikely to explain why IFN-{gamma}R–/– splenocytes did not induce L-SAT in IFN-{gamma}–/– mice. In these splenocyte transfer experiments, both donor and recipient lymphocytes could contribute to the production of most cytokines, except IFN-{gamma}, making it difficult to determine whether WT and IFN-{gamma}R–/– donor splenocytes were activated to a comparable extent. To overcome this problem and to more directly compare the activation of WT and IFN-{gamma}R–/– donor lymphocytes in vivo, RNA was isolated from the spleens of BM chimeras, where most lymphocytes are derived from the BM donors, and the contribution of recipient lymphocytes should be minimal. Analysis of mRNA expression by real-time PCR showed that spleens of recipients of either WT or IFN-{gamma}R–/– BM expressed similar amounts of IFN-{gamma} as well as IL-2 mRNA (Fig. 6, B and C). However, WT or IFN-{gamma}R–/– recipients given IFN-{gamma}R–/– BM had much lower expression of mRNA for the IFN-{gamma}-inducible chemokines CXCL10 and CXCL9 compared with recipients given WT bone marrow (Fig. 6, D and E). These differences were also observed using semiquantitative RT-PCR (data not shown). However, splenocytes from all groups of recipients expressed similar levels of mRNA for CXCR3, the receptor for CXCL9 and CXCL10 (Fig. 6F). These results suggested that the low level of expression of IFN-{gamma}-inducible chemokines by IFN-{gamma}R–/– splenocytes could impair their ability to migrate to thyroids to result in L-SAT.



View larger version (27K):
[in this window]
[in a new window]
  		FIGURE 6. IFN-{gamma}R–/– BM-derived splenocytes express low levels of CXCL10 and CXCL9 mRNA. A, Semiquantitative RT-PCR shows that IFN-{gamma}R–/– and WT splenocytes express similar levels of IFN-{gamma} mRNA in IFN-{gamma}–/– recipients given NaI water for 5 mo. Quantitative real-time PCR indicates that spleens from WT recipients given WT or IFN-{gamma}R–/– BM express similar amounts of IFN-{gamma} (B), IL-2 (C), and CXCR3 (F) mRNA. However, compared with recipients of WT BM, recipients of IFN-{gamma}R–/– BM express much less CXCL10 (D) and CXCL9 (E) mRNA. RNA was isolated from spleens of mice shown in Figs. 4 and 5. Data are expressed as the mean ± SEM ratio of cytokine or chemokine/HPRT mRNA of five mice per group. *, p < 0.01; **, p < 0.05 (compared with WT BM as donors).

 
Results of immunohistochemical staining also indicate that few IFN-{gamma}R–/– lymphocytes migrate to thyroids even in the presence of WT splenocytes. When Thy1.1+ WT splenocytes are transferred to IFN-{gamma}–/– recipients, many donor Thy1.1+ as well as recipient Thy1.2+ T cells are detected in thyroids (5) (Fig. 3, D and E). By contrast, many fewer T cells of either donor or recipient origin were detected in thyroids of IFN-{gamma}R–/– recipients of WT splenocytes (Fig. 3, J and K), and most thyroid-infiltrating cells were donor-derived Thy1.1+ cells (Fig. 3J). These results suggest that lymphocytes have to respond to IFN-{gamma} to be induced to migrate to the thyroid for development of L-SAT. IFN-{gamma}R–/– lymphocytes may be defective in their ability to migrate to thyroids, because they fail to up-regulate the expression of particular chemokines in response to IFN-{gamma}. The results also suggest that although some lymphocytes that can produce and respond to IFN-{gamma}, i.e., WT lymphocytes, do migrate to the thyroids of IFN-{gamma}R–/– mice, relatively few of them are maintained in an inflammatory site that is unresponsive to IFN-{gamma}.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
Disclosures
 References
 
The studies reported in this paper show that thyrocytes able to respond to IFN-{gamma} are required for the development of L-SAT and the inhibition of TEC H/P. Although IFN-{gamma}R–/– mice develop severe TEC H/P histologically like that of IFN-{gamma}–/– mice, the incidence of severe TEC H/P is lower in IFN-{gamma}R–/– mice. The reason for this difference is not known.

Approximately 25% of IFN-{gamma}R–/– mice given NaI in water for 7 mo developed severe TEC H/P, and all other IFN-{gamma}R–/– mice had mild thyrocyte hyperplasia (Fig. 1). Notably, the incidence of severe TEC H/P was greater in IFN-{gamma}R–/– recipients of WT splenocytes or BM, and there were few lymphocytes of either donor or recipient origin in these thyroids (Fig. 3, J and K). The increased incidence of severe TEC H/P in IFN-{gamma}R–/– recipients of WT cells was most striking in IFN-{gamma}R–/– recipients of WT BM (Fig. 4A), in which there were very few endogenous IFN-{gamma}R–/– lymphocytes, and most lymphocytes were derived from the WT donors (Fig. 4B). Because lymphocytes are required for the development of thyrocyte hyperplasia (32), these results suggest that WT bone marrow-derived lymphocytes may produce a factor that promotes the development of severe TEC H/P when thyrocytes are unable to respond to IFN-{gamma}. In contrast, when recipient thyrocytes can respond to IFN-{gamma}, WT lymphocytes induce L-SAT (5) (Figs. 3 and 5). If IFN-{gamma}R–/– T cells are defective in their ability to migrate to sites of inflammation (21, 22), WT lymphocytes may migrate to thyroids more efficiently than IFN-{gamma}R–/– lymphocytes and produce particular cytokines that promote TEC H/P when thyrocytes are unable to respond to IFN-{gamma}. Studies are in progress to determine whether WT lymphocytes produce a particular cytokine or other molecule that promotes TEC H/P in IFN-{gamma}R–/– mice.

Immunohistochemical staining was used to compare the extent of infiltration by donor- (Thy1.1+) and recipient-derived (Thy1.2+) T cells in thyroids of IFN-{gamma}–/– and IFN-{gamma}R–/– mice given WT splenocytes. In thyroids of IFN-{gamma}–/– mice given WT splenocytes, there were many lymphocytes derived from both donors and recipients (Fig. 3, D and E). By contrast, there were fewer lymphocytes in thyroids of IFN-{gamma}R–/– mice given WT splenocytes, and most were of donor origin (Fig. 3, J and K). This is consistent with the fact that IFN-{gamma}R–/– mice given WT splenocytes had TEC H/P, but not L-SAT, whereas IFN-{gamma}–/– recipients of WT spleen cells had L-SAT. Differences in the extent of infiltration by recipient-derived Thy1.2+ T cells were especially notable in these two groups of recipients. The finding that many Thy1.2+ IFN-{gamma}–/– lymphocytes migrated to the thyroids and contributed to L-SAT in the presence of WT lymphocytes is consistent with other reports demonstrating that host T cells could be recruited into inflammatory lesions by donor T cells (23). In contrast, very few recipient-derived Thy1.2+ IFN-{gamma}R–/– lymphocytes infiltrated the thyroids of IFN-{gamma}R–/– mice given WT lymphocytes even though the IFN-{gamma}R–/– lymphocytes could produce IFN-{gamma} (Fig. 6). These results suggest that lymphocytes must be able to respond to IFN-{gamma} to be induced to migrate to the thyroid in sufficient numbers to result in L-SAT when thyrocytes are able to respond to IFN-{gamma}. As discussed below, this could reflect a requirement for IFN-{gamma} to induce up-regulation of particular adhesion molecules or chemokines on T cells needed for them to migrate to the thyroid. Thyrocyte responsiveness to the local production of IFN-{gamma} by thyroid-infiltrating inflammatory cells may also be required to induce chemokine or adhesion molecule expression on thyrocytes for the development of L-SAT.

An unexpected finding in these experiments was that IFN-{gamma}R–/– splenocytes or BM-derived lymphocytes, which produced nearly as much IFN-{gamma} as WT lymphocytes (Fig. 6, A and B) did not induce L-SAT after transfer to IFN-{gamma}–/– or WT recipients (Fig. 5), both of which have IFN-{gamma}-responsive thyrocytes. This suggests that lymphocytes must both produce and respond to IFN-{gamma} to induce L-SAT. This could reflect a requirement for lymphocytes to up-regulate certain chemokines needed to induce their migration to the thyroid and suggests that local production of IFN-{gamma} in the thyroid is needed to inhibit TEC H/P and induce L-SAT.

IFN-{gamma} induces the expression of several chemokines, including CXCL10 (inducing protein 10), CXCL9 (monokine induced by IFN-{gamma}), and CXCL11 (IFN-inducible T cell {alpha} chemoattractant), which are important for promoting the migration of T cells to sites of inflammation (24, 25, 26, 27, 28). Recipients of IFN-{gamma}R–/–-derived BM expressed much lower levels of CXCL9 and CXCL10 mRNA than recipients of WT bone marrow (Fig. 6, D and E), and this could explain why very few IFN-{gamma}R–/– lymphocytes migrate to the thyroid. As a result, local production of IFN-{gamma} would be insufficient to inhibit TEC H/P. IFN-{gamma}R–/– and WT splenocytes expressed similar amounts of IFN-{gamma}, IL-2, and CXCR3 mRNA (Fig. 6), indicating that IFN-{gamma}R–/– lymphocytes are activated in vivo under the conditions of these experiments. These results suggest that even though lymphocytes from IFN-{gamma}R–/– mice are activated to produce IFN-{gamma}, they apparently do not migrate to the thyroid, perhaps because they are unable to up-regulate IFN-{gamma}-inducible chemokines.

The migration of inflammatory cells to sites of inflammation is determined by several factors, including the adhesion of cells to the vascular endothelium and the recruitment of T and B cells by chemokines (29). The migration of lymphocytes to the thyroid during the development of thyroiditis presumably requires the expression of particular adhesion molecules by both lymphocytes and thyroid (30, 31). NOD-H-2h (4) thyrocytes constitutively express ICAM, but not VCAM (30) (our unpublished results), and both ICAM and VCAM are up-regulated on thyrocytes of IFN-{gamma}–/–, IFN-{gamma}R–/–, and WT mice during SAT development (our unpublished results). There were no apparent differences in the levels of VCAM or ICAM expression by thyrocytes of IFN-{gamma}–/–, IFN-{gamma}R–/–, and WT mice, and VLA-4 and LFA-1, the receptors for VCAM and ICAM, were up-regulated to a similar extent on spleen cells of WT, IFN-{gamma}–/–, and IFN-{gamma}R–/– mice during development of SAT or TEC H/P (data not shown). Others showed that homing of diabetogenic WT T cells to the pancreas was defective in both IFN-{gamma}–/– and IFN-{gamma}R–/– recipients in an adoptive transfer model of diabetes (22), whereas in our model, WT T cells effectively migrated to thyroids of IFN-{gamma}–/–, but not IFN-{gamma}R–/–, recipients. In addition, WT lymphocytes promoted the migration of many IFN-{gamma}–/– recipient T cells, but very few IFN-{gamma}R–/– recipient T cells to thyroids (Fig. 3, E and K). These results indicate that IFN-{gamma} is important for trafficking of lymphocytes to inflammatory sites, as demonstrated by others (22, 28). Our results extend previous studies by showing that lymphocytes that are unable to produce IFN-{gamma} can be induced to migrate to inflammatory sites by IFN-{gamma} produced by other cells, whereas very few lymphocytes that are unable to respond to IFN-{gamma} go to the thyroid even when thyrocytes can respond to IFN-{gamma}.

IFN-{gamma} apparently acts directly on thyrocytes to induce molecules that inhibit TEC H/P. IFN-{gamma} can have direct antiproliferative effects on lymphocytes as well as other cells (33, 34) and can also promote apoptosis (35). TUNEL staining showed few apoptotic cells in thyroids with either TEC H/P or L-SAT (data not shown). The multiple functions of IFN-{gamma} are mediated by its binding to the IFN-{gamma}R, followed by activation of STAT1 to promote the expression of many target genes (36). However, some functions of IFN-{gamma} are STAT1 independent (36), and additional studies will be needed to determine which IFN-{gamma} signaling pathway is involved in the inhibition of TEC H/P in this model.

TEC H/P has an autoimmune basis, and thyroid-infiltrating inflammatory cells are required for its induction (32). Thyroid hyperplasia is common in humans, often progressing to thyroid neoplasia (37, 38), and a high incidence of thyroid cancer is associated with autoimmune thyroiditis (39). The data derived using this animal model should provide important information that will increase our understanding of the relationship among IFN-{gamma}, autoimmune thyroiditis, thyroid hyperplasia, and thyroid neoplasia.


   Acknowledgments
 
We thank Patti Mierzwa and Neal Bluel for skilled technical assistance. We also thank Dr. David Serreze (The Jackson Laboratory) for providing breeding stock of NOD IFN-{gamma}–/– and NOD IFN-{gamma}R–/– mice, and Louise Barnett for assisting with the flow cytometric analyses.


   Disclosures
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
References
 
The authors have no financial conflict of interest.


   Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by a Merit Review Grant from the Department of Veterans Affairs, the A. P. Green Foundation, the University of Missouri Research Council, and the University of Missouri Research Board (Columbia, MO). Back

2 Address correspondence and reprint requests to Dr. Helen Braley-Mullen, Department of Internal Medicine, Division of Immunology and Rheumatology, University of Missouri, M307 Medical Sciences, One Hospital Drive, Columbia, MO 65212. E-mail address: mullenh{at}health.missouri.edu Back

3 Abbreviations used in this paper: L-SAT, lymphocytic spontaneous autoimmune thyroiditis; BM, bone marrow; EAT, experimental autoimmune thyroiditis; HPRT, hypoxanthine phosphoribosyltransferase; NaI, sodium iodide; TEC, thyroid epithelial cell or thyrocyte; TEC H/P, thyrocyte hyperplasia and proliferation; WT, wild type. Back

Received for publication June 6, 2005. Accepted for publication October 27, 2005.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Rasooly, L., C. L. Burek, N. R. Rose. 1996. Iodine-induced autoimmune thyroiditis in NOD-H-2h4 mice. Clin. Immunol. Immunopathol. 81: 287-292. [Medline]
  2. Braley-Mullen, H., G. C. Sharp, B. Medling, H. Tang. 1999. Spontaneous autoimmune thyroiditis in NOD.H-2h4 mice. J. Autoimmun. 12: 157-165. [Medline]
  3. Verma, S., P. Hutchings, J. Guo, S. McLachlan, B. Rapoport, A. Cooke. 2000. Role of MHC class I expression and CD8+ T cells in the evolution of iodine-induced thyroiditis in NOD-H2 (h4) and NOD mice. Eur. J. Immunol. 30: 1191-1202. [Medline]
  4. Rose, N. R., R. Bonita, C. L. Burek. 2002. Iodine: an environmental trigger of thyroiditis. Autoimmun. Rev. 1: 97-103. [Medline]
  5. Yu, S., G. C. Sharp, H. Braley-Mullen. 2002. Dual roles for IFN-{gamma}, but not for IL-4, in spontaneous autoimmune thyroiditis in NOD.H-2h4 mice. J. Immunol. 169: 3999-4007. [Abstract/Free Full Text]
  6. Bach, E. A., M. Aguet, R. D. Schreiber. 1997. The IFN-{gamma} receptor: a paradigm for cytokine receptor signaling. Annu. Rev. Immunol. 15: 563-591. [Medline]
  7. Newport, M. J., C.M. Huxley, S. Huston, C. M. Hawrylowicz, B. A. Oostra, R. Williamson, M. Levin. 1996. A mutation in the interferon-{gamma}-receptor gene and susceptibility to mycobacterial infection. N. Engl. J. Med. 335: 1941-1949. [Abstract/Free Full Text]
  8. Ikeda, H. L. J. Old, R. D. Schreiber. 2002. The roles of IFN-{gamma} in protection against tumor development and cancer immunoediting. Cytokine Growth Factor Rev. 13: 95-109. [Medline]
  9. Barin, J. G., M. Afanasyeva, M. V. Talor, N. R. Rose, C. L. Burek, P. Caturegli. 2003. Thyroid specific expression of IFN-{gamma} limits experimental autoimmune thyroiditis by suppressing lymphocyte activation in cervical lymph nodes. J. Immunol. 170: 5523-5529. [Abstract/Free Full Text]
  10. Tang, H., K. Mignon-Godefroy, P. L. Meroni, G. Garotta, J. Charreire, F. Nicoletti. 1993. The effects of a monoclonal antibody to interferon-{gamma} on experimental autoimmune thyroiditis (EAT): prevention of disease and decrease of EAT-specific T cells. Eur. J. Immunol. 23: 275-278. [Medline]
  11. Stull, S. J., G. C. Sharp, M. Kyriakos, J. T. Bickel, H. Braely-Mullen. 1992. Induction of granulomatous experimental autoimmune thyroiditis in mice with in vitro activated effector T cells and anti-IFN-{gamma} antibody. J. Immunol. 149: 2219-2226. [Abstract]
  12. Tang, H., G. C. Sharp, H. Braley-Mullen. 1998. IFN-{gamma}-deficient mice develop severe granulomatous experimental autoimmune thyroiditis with eosinophil infiltration in thyroids. J. Immunol. 160: 5105-5112. [Abstract/Free Full Text]
  13. Alimi, E., S. Huang, M. P. Brazillet, J. Charreire. 1998. Experimental autoimmune thyroiditis (EAT) in mice lacking the IFN-{gamma} receptor. Eur. J. Immunol. 28: 201-208. [Medline]
  14. Stafford, E. A., N. R. Rose. 2000. Newer insights into pathogenesis of experimental autoimmune thyroiditis. Int. Rev. Immunol. 19: 501-533. [Medline]
  15. Caturegli, P., M. Hejazi, K. Suzuki, O. Dohan, N. Carrasco, L. D. Kohn, N. R. Rose. 2000. Hypothyroidism in transgenic mice expressing IFN-{gamma} in the thyroid. Proc. Natl. Acad. Sci. USA 97: 1719-1724. [Abstract/Free Full Text]
  16. Podolin, P. L., A. Pressey, N. H. DeLarato, P. A. Fischer, L. B. Peterson, L. S. Wicker. 1993. I-E+ nonobese diabetic mice develop insulitis and diabetes. J. Exp. Med. 178: 793-803. [Abstract/Free Full Text]
  17. Serreze, D. V., C. M. Post, H. D. Chapman, E. A. Johnson, B. Lu, P. B. Rothman. 2000. IFN-{gamma} receptor signaling is dispensable in the development of autoimmune type 1 diabetes in NOD mice. Diabetes 49: 2007-2111. [Abstract/Free Full Text]
  18. Tang, H., H. Braley-Mullen. 1997. Intravenous administration of deaggregated mouse thyroglobulin suppresses induction of experimental autoimmune thyroiditis and expression of both Th1 and Th2 cytokines. Int. Immunol. 9: 679-687. [Abstract/Free Full Text]
  19. Chen, K., Y. Wei, A. Alter, G. C. Sharp, H. Braley-Mullen. 2005. Chemokine expression during development of fibrosis versus resolution in a murine model of granulomatous experimental autoimmune thyroiditis. J. Leukocyte Biol. 78: 716-724. [Abstract/Free Full Text]
  20. Yu, S., B. Medling, H. Yagita, H. Braley-Mullen. 2001. Characteristics of inflammatory cells in spontaneous autoimmune thyroiditis of NOD.H-2h4 mice. J. Autoimmun. 16: 37-46. [Medline]
  21. Zhu, Y., H. G. Ljunggren, E. Mix, H. L. Li, P. van der Meide, A. Elhasssan, B Winblad, J. Zhu. 2001. Suppression of autoimmune neuritis in IFN-{gamma} receptor deficient mice. Exp. Neurol. 169: 472-478. [Medline]
  22. Savinov, A. Y., F. S. Wong, A. V. Chervonsky. 2001. IFN-{gamma} affects homing of diabetogenic T cells. J. Immunol. 167: 6637-6643. [Abstract/Free Full Text]
  23. Bai, X. F., O. Li, Q. Zhou, H. Zhang, P. S. Joshi, X. Zheng, Y. Liu, Y. Wang, P. Zheng, Y. Liu. 2004. CD24 controls expansion and persistence of autoreactive T cells in the central nervous system during experimental autoimmune encephalomyelitis. J. Exp. Med. 200: 447-458. [Abstract/Free Full Text]
  24. Boehm, U., T. Klamp, M. Groot, J. C. Howard. 1997. Cellular response to interferon-{gamma}. Ann. Rev. Immunol. 15: 749-795. [Medline]
  25. Nakajima, C., Y. Uekusa, M. Iwasaki, N. Yamaguchi, T. Mukai, P. Gao, M. Tomura, S. Ono, T. Tsujimura, H. Fujiwara, et al 2001. A role of interferon-{gamma} (IFN-{gamma}) in tumor immunity: T cells with the capacity to reject tumor cells are generated but fail to migrate to tumor sites in IFN-{gamma}-deficient mice. Cancer Res. 61: 3399-3405. [Abstract/Free Full Text]
  26. Fifle, B. T., K. J. Kennedy, M. C. Paniagua, N. W. Lukacs, S. L. Kunkel, A. D. Luster, W. J. Karpus. 2001. CXCL10 (IFN-{gamma}-inducible protein-10) control of encephalitogenic CD4+ T cell accumulation in the central nervous system during experimental autoimmune encephalomyelitis. J. Immunol. 166: 7617-7624. [Abstract/Free Full Text]
  27. Tran, E. H., E. N. Prince, T. Owens. 2000. IFN-{gamma} shapes immune invasion of the central nervous system via regulation of chemokines. J. Immunol. 164: 2759-2768. [Abstract/Free Full Text]
  28. Koga, S., M. Auerbach, T. Engeman, A. Novick, H. Toma, R. L. Fairchild. 1999. T cell infiltration into class II MHC-disparate allograft and acute rejection is dependent on the IFN-{gamma}-induced chemokine Mig. J. Immunol. 163: 4878-4885. [Abstract/Free Full Text]
  29. Hjelmstrom, P.. 2001. Lymphoid neogenesis: de novo formation of lymphoid tissue in chronic inflammation through expression of homing chemokines. J. Leukocyte Biol. 69: 331-339. [Abstract/Free Full Text]
  30. Bonita, R. E., N. R. Rose, L. Rasooly, P. Caturegli, C. L. Burek. 2002. Adhesion molecules as susceptibility factors in spontaneous autoimmune thyroiditis in NOD-h2h4 mice. Exp. Mol. Pathol. 73: 155-163. [Medline]
  31. McMurray, R. W., H. Tang, H. Braley-Mullen. 1996. The role of {alpha}4 integrin and intercellular adhesion molecule-1 (ICAM-1) in murine experimental autoimmune thyroiditis. Autoimmunity 23: 9-23. [Medline]
  32. Yu, S., G. C. Sharp, and H. Braley-Mullen. Thyroid epithelial cell hyperplasia in IFN-{gamma} deficient NOD.H-2h4 mice. Clin. Immunol. In press.
  33. Chin, Y. E., M. Kitagawa, W. C. Su, Z. H. You, Y. Iwamoto, X. Y. Fu. 1996. Cell growth arrest and induction of cyclin-dependent kinase inhibitor p21 WAF1/CIP1 mediated by STAT1. Science 272: 719-722. [Abstract]
  34. Bromberg, J. F., C. M. Horvath, Z. Wen, R. D. Schreiber, J. E. Darnell, Jr. 1996. Transcriptionally active Stat1 is required for the anti-proliferative effects of both interferon-{alpha} and interferon-{gamma}. Proc. Natl. Acad. Sci. USA 93: 7673-7678. [Abstract/Free Full Text]
  35. Chin, Y. E., M. Kitagawa, K. Kuida, R. A. Flavell, X. Y. Fu. 1997. Activation of the STAT signaling pathway can cause expression of caspase-1 and apoptosis. Mol. Cell. Biol. 17: 5328-5337. [Abstract]
  36. Ramana, C. V., M. P. Gil, R. D. Schreiber, G. R. Stark. 2002. Stat1-dependent and -independent pathways in IFN-{gamma}-dependent signaling. Trends Immunol. 23: 96-101. [Medline]
  37. Derwahl, M., H. Studer. 2002. Hyperplasia versus adenoma in endocrine tissues: are they different?. Trends Endocrinol. Metab. 13: 23-28. [Medline]
  38. Balcoch, Z., V. A. Livolsi. 2002. Follicular-patterned lesions of the thyroid: the bane of the pathologist. Am. J. Clin. Pathol. 117: 143-150. [Abstract/Free Full Text]
  39. Tamimi, D.. 2002. The association between chronic lymphocytic thyroiditis and thyroid tumors. Int. J. Surg. Pathol. 10: 141-146. [Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 EndocrinologyHome page
I. Horie, N. Abiru, Y. Nagayama, G. Kuriya, O. Saitoh, T. Ichikawa, Y. Iwakura, and K. Eguchi
T Helper Type 17 Immune Response Plays an Indispensable Role for Development of Iodine-Induced Autoimmune Thyroiditis in Nonobese Diabetic-H2h4 Mice
Endocrinology, November 1, 2009; 150(11): 5135 - 5142.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
S. Yu, G. C. Sharp, and H. Braley-Mullen
TGF-{beta} Promotes Thyroid Epithelial Cell Hyperplasia and Fibrosis in IFN-{gamma}-Deficient NOD.H-2h4 Mice
J. Immunol., August 1, 2008; 181(3): 2238 - 2245.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
S. Poncin, B. Lengele, I. M. Colin, and A.-C. Gerard
Differential Interactions between Th1/Th2, Th1/Th3, and Th2/Th3 Cytokines in the Regulation of Thyroperoxidase and Dual Oxidase Expression, and of Thyroglobulin Secretion in Thyrocytes in Vitro
Endocrinology, April 1, 2008; 149(4): 1534 - 1542.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yu, S.
Right arrow Articles by Braley-Mullen, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yu, S.
Right arrow Articles by Braley-Mullen, H.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS