The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Maezawa, Y.
Right arrow Articles by Iwamoto, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Maezawa, Y.
Right arrow Articles by Iwamoto, I.
The Journal of Immunology, 2006, 176: 1013-1018.
Copyright © 2006 by The American Association of Immunologists

Involvement of TNF Receptor-Associated Factor 6 in IL-25 Receptor Signaling1

Yuko Maezawa*, Hiroshi Nakajima2,*, Kotaro Suzuki*, Tomohiro Tamachi*, Kei Ikeda*, Jun-ichiro Inoue{dagger}, Yasushi Saito* and Itsuo Iwamoto*

* Department of Allergy and Clinical Immunology, Graduate School of Medicine, Chiba University, Chiba, Japan; and {dagger} Division of Cellular and Molecular Biology, Department of Cancer Biology, Institute of Medical Science, University of Tokyo, Tokyo, Japan


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
IL-25 (IL-17E) induces IL-4, IL-5, and IL-13 production from an unidentified non-T/non-B cell population and subsequently induces Th2-type immune responses such as IgE production and eosinophilic airway inflammation. IL-25R is a single transmembrane protein with homology to IL-17R, but the IL-25R signaling pathways have not been fully understood. In this study, we investigated the signaling pathway under IL-25R, especially the possible involvement of TNFR-associated factor (TRAF)6 in this pathway. We found that IL-25R cross-linking induced NF-{kappa}B activation as well as ERK, JNK, and p38 activation. We also found that IL-25R-mediated NF-{kappa}B activation was inhibited by the expression of dominant negative TRAF6 but not of dominant negative TRAF2. Furthermore, IL-25R-mediated NF-{kappa}B activation, but not MAPK activation, was diminished in TRAF6-deficient murine embryonic fibroblast. In addition, coimmunoprecipitation assay revealed that TRAF6, but not TRAF2, associated with IL-25R even in the absence of ligand binding. Finally, we found that IL-25R-mediated gene expression of IL-6, TGF-{beta}, G-CSF, and thymus and activation-regulated chemokine was diminished in TRAF6-deficient murine embryonic fibroblast. Taken together, these results indicate that TRAF6 plays a critical role in IL-25R-mediated NF-{kappa}B activation and gene expression.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Interleukin-25 has recently been identified as the fifth member of the IL-17 cytokine family (IL-17E) by database searching (1, 2, 3, 4). The IL-17 family now consists of six family members, namely IL-17 (IL-17A), IL-17B, IL-17C, IL-17D, IL-25, and IL-17F (5, 6, 7). Among IL-17 family members, IL-25 is less homologic to other IL-17 family members, e.g., 18% homology to IL-17A at amino acid level. Accordingly, in vivo biologic activities of IL-25 are markedly different from those described for IL-17 and other IL-17 family cytokines (2, 3, 4, 8, 9, 10). Remarkably, it has been shown that the enforced expression of IL-25 induces IL-4, IL-5, and IL-13 production from an unidentified non-T/non-B cell population and subsequently induces Th2-type immune responses such as eosinophilic airway inflammation, mucus production, and airway hyperreactivity (2, 3, 4, 8).

IL-25R, which is also called IL-17BR, IL-17Rh1, or Evi27, is a 56-kDa single transmembrane protein with homology to IL-17R (1, 11, 12). IL-25R was first identified as a receptor for IL-17B (11) but IL-25R has subsequently been shown to exhibit a higher affinity for IL-25 than for IL-17B (1). IL-25 has also been demonstrated to activate NF-{kappa}B and induce IL-8 production in a human renal carcinoma cell line (1). However, the molecular components consisting of IL-25R signaling pathways and their regulation are still largely unknown.

It has recently been shown that TNFR-associated factor (TRAF)3 family proteins play a critical role in a number of signaling pathways that activate NF-{kappa}B (13, 14, 15, 16). TRAF family proteins contain a conserved TRAF-C domain that is essential for the interaction with their cognate receptors or cytoplasmic signaling proteins (13, 14, 15, 16). Among TRAF family proteins, TRAF6 exhibits the unique properties in that its TRAF-C domain interacts with a peptide motif distinct from that recognized by other TRAF proteins (17), supporting the findings that TRAF6 exhibits various functions in regulating adaptive and innate immunity, bone metabolism, and cell apoptosis (13, 14, 15, 16). The structural analysis of the peptide-TRAF6 interaction has clarified the TRAF6-binding motif as X-X-Pro-X-Glu-X-X-(aromatic/acidic residue) (17). The TRAF6-binding motif is found not only in adaptor proteins such as IL-1R-associated kinase (17) and TIFA (18) but also in membrane-bound proteins such as CD40 and the receptor activator of NF-{kappa}B RANK (17). Importantly, the TRAF6-binding motif is present in human and murine IL-25R.

In the present study, we investigated whether TRAF6 is involved in IL-25R signaling. Our results have clearly demonstrated a critical involvement of TRAF6 in IL-25R-mediated NF-{kappa}B activation and gene expression.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 Disclosures
 References
 
Cell culture

X63 cells were maintained in RPMI 1640 medium with 10% FCS, 50 µM 2-ME, and antibiotics (complete RPMI 1640 medium). Ba/F3 cells were cultured in complete RPMI 1640 medium supplemented with 10% (v/v) of the supernatant of murine IL-3-producing X63 cells (X63-IL-3; a gift from Dr. H. Karasuyama, Tokyo Medical and Dental University, Tokyo, Japan) (19). COS7 cells were cultured in DMEM supplemented with 10% FCS and antibiotics (complete DMEM). Wild-type (WT) murine embryonic fibroblast (MEF), TRAF6-deficient (TRAF6–/–) MEF (20), and Plat-E cells (21) were established and maintained as described elsewhere.

Plasmids

DNA fragment coding the extracellular domain of murine IL-25R, a gift from Dr. J. D. Shaughnessy (University of Arkansas for Medical Sciences, Little Rock, AR) (12) was fused to the fragment coding C-terminal 187 aa of MPL, a receptor for thrombopoietin (22), and cloned into expression vector pCDNA3 (pCDNA3 IL-25R-MPL). Expression vectors for WT TRAF2, dominant negative (DN) TRAF2, Flag-tagged WT TRAF6, and Flag-tagged DN TRAF6 were previously described (23). Expression vectors for Flag-tagged IL-25 (BCMGS Flag-IL-25), Flag-tagged IL-25R (pCMV1 Flag-IL-25R), and myc-tagged intracellular region of IL-25R (pCDNA3 myc-IL-25R) were constructed by PCR amplification using PFU polymerase (Stratagene). The DNA fragment coding Flag-tagged IL-25R was subsequently subcloned into the retrovirus vector pMX IRES-GFP to generate pMX Flag-IL-25R-IRES-GFP. Alanine substitution of IL-25R on glutaminic acid at aa 338 (IL-25R E338A) was generated by using a PCR-based site-directed mutagenesis kit (Stratagene). The mutation was confirmed by DNA sequencing.

Cytokines

X63 cells were transfected with BCMGS Flag-IL-25 to generate murine IL-25-producing X63 cells (X63-IL-25). The supernatant of X63-IL-25 cells was collected and used as a source of IL-25. The supernatant of murine IL-3-producing X63 cells (X63-IL-3) and the empty vector (BCMGS neo)-transfected X63 cells (X63-control) were also used as controls.

Bioassay for IL-25

IL-3-dependent Ba/F3 cells were transfected with pCDNA3 IL-25R-MPL and Ba/F3 cells that stably expressed IL-25R-MPL were selected by G418 (Ba/F3 IL-25R-MPL cells). The expression of IL-25R-MPL was evaluated not only at mRNA levels by RT-PCR analysis but also at protein levels with the response to the supernatant of X63-IL-25 cells. Subsequently, bioactivity of IL-25 was assessed by the proliferative response of Ba/F3 IL-25R-MPL cells. Briefly, Ba/F3 IL-25R-MPL cells (2 x 103 cells/well) were cultured in triplicate at 37°C in 96-well plates in the complete RPMI 1640 medium in the presence of X63-IL-25 conditioned medium or X63-IL-3 conditioned medium (as a positive control) for 36 h with 0.5 µCi of [3H]thymidine added for the final 12 h. Empty vector (pCDNA3)-transfected Ba/F3 cells were used as a negative control.

Retrovirus-mediated expression of IL-25R in MEF

A transient retrovirus packaging cell line of Plat-E cells (2 x 106) was transfected with 3 µg of pMX Flag-IL-25R-IRES-GFP using FuGENE6 transfection reagents (Roche Diagnostics). At 24 h after the transfection, the medium was once changed and another 24 h later, the supernatant was harvested as virus stocks and stored at –80°C until use. WT MEF or TRAF6–/– MEF (1 x 106) were infected with 2 ml of virus stocks for 4 h in the presence of polybrene (1 µg/ml) and then diluted and maintained in the complete DMEM. Under these conditions, the efficiency of infection was 90% as assessed by GFP+ cells by FACS.

Luciferase assay

COS7 cells (1 x 105) were transfected with 1.0 µg of pCMV1 Flag-IL-25R and 0.3 µg of NF-{kappa}B-responding Photinus pyralis luciferase reporter vector pNF-{kappa}B-Luc (Stratagene) using FuGENE6. In some experiments, expression vector for DN TRAF6 or DN TRAF2 was cotransfected. Empty vector was added to adjust the total amount of plasmid DNA for transfection. To normalize for transfection efficiency, 10 ng of Renilla reniformis luciferase reporter vector pRL-TK was added to each transfection. At 24 h after the transfection, cells were stimulated with X63-IL-25 condition medium or anti-Flag M2 mouse mAb (2 µg/ml; Sigma-Aldrich) at 37°C for 24 h, and the luciferase activity of Photinus pyralis and Renilla reniformis were determined by the Dual-Luciferase Reporter Assay System (Promega). Photinus pyralis luciferase activity of pNF-{kappa}B-Luc was normalized by Renilla reniformis luciferase activity of pRL-TK. Condition medium of X63-control cells or mouse monoclonal IgG1 (Ancell) was used as controls.

Nuclear accumulation of NF-{kappa}B p65

WT MEF or TRAF6–/– MEF were infected with retrovirus of pMX Flag-IL-25R-IRES-GFP as described earlier and Flag-IL-25R-expressing WT MEF or TRAF6–/– MEF were stimulated with X63-IL-25 condition medium or anti-Flag M2 mAb (2 µg/ml) at 37°C for 30 min. Nuclear extracts were prepared as described elsewhere (24), and DNA-binding activity of NF-{kappa}B p65 in the nuclear extracts was detected by Transfactor NF-{kappa}B chemiluminescent kit (BD Biosciences) according to the manufacturer’s instruction. Briefly, nuclear extracts (5 µg) were added to wells coated with NF-{kappa}B consensus oligonucleotides and incubated for 1 h at room temperature. After washing, the wells were incubated with anti-NF-{kappa}B p65 rabbit polyclonal Ab, followed by anti-rabbit IgG HRP and then chemiluminescent substrate mixture. Chemiluminescent intensities were measured with Arvo 1420 multilabel counter (Wallac). For DNA competition experiments, 0.5 µg of unlabeled competitor oligonucleotide was added to the nuclear extracts.

Immunoblotting

MEF (1 x 105) were starved from FCS for over 12 h and then stimulated with anti-Flag mAb (2 µg/ml), mouse rIL-17 (100 ng/ml; R&D Systems), or mouse rIL-1{beta} (10 ng/ml; PeproTech) for 30 min. The cells were then lysed with cell lysis buffer (10 mM Tris-HCl, 150 mM NaCl, 2 mM EDTA, 0.875% Brij97, 0.125% Nonidet P-40, 8 mM DTT, and 1% protease inhibitor mixture (Sigma-Aldrich)) supplemented with 1 mM Na3VO4, 10 mM NaF, and 60 mM {beta}-glycerophosphate. The aliquot of lysates was applied for SDS-PAGE. The following Abs were used for immunoblotting: anti-I{kappa}B-{alpha} (MBL Japan), anti-p38{alpha}/SAP2a, anti-p38 (pT180/pY182), anti-ERK1, anti-ERK1/2 (pT202/pT204), anti-pan JNK/SAPK1, and anti-JNK (pT183/pT185) (BD Transduction).

Coimmunoprecipitation assay

COS7 cells (4 x 105) were transfected with pCDNA3 myc-IL-25R (1.0 µg) and/or pME18S Flag-TRAF6 (1.0 µg), pME18S Flag-TRAF2 (1.0 µg), or pME18S Flag-TRAF5 (1.0 µg) using FuGENE6. Twenty-four hours after the transfection, cells were harvested, lysed with cell lysis buffer, and centrifuged to remove cellular debris. After preclearation, the supernatants were immunoprecipitated with either anti-myc mAb (9E10; Santa Cruz Biotechnology) or anti-Flag M2 mAb and 100 µl of protein G-Sepharose (Pharmacia). The immunoprecipitates or the aliquot of whole cell lysates were applied for immunoblotting with rabbit polyclonal anti-Flag Ab (Sigma-Aldrich) or biotin-labeled anti-myc mAb (9E10; Santa Cruz Biotechnology).

RT-PCR

Total cellular RNA was prepared, and RT-PCR analysis was performed as previously described (24). In brief, Flag-IL-25R-expressing WT MEF or TRAF6–/– MEF were stimulated with anti-Flag mAb (2 µg/ml) at 37°C for 3 h and the total cellular RNA was isolated using Isogen solution (Nippon Gene) according to the manufacturer’s instruction. The following primer pairs were used for PCR: IL-6 (ATGAAGTTCCTCTCTGCAAGAG and GTTTGCCGAGTAGATCTCAAAG), G-CSF (GCTGTGGCAAAGTGCACTATG and AAGCCCTGCAGGTACGAAATG), TGF-{beta} (ATTCAGCGCTCACTGCTCTTG and TCAGCTGCACTTGCAGGAGC), and thymus and activation-regulated chemokine (TARC) (TGAGGTCACTTCAGATGCTGC and ACCAATCTGATGGCCTTCTTC). RT-PCR for {beta}-actin was performed as a control. All PCR amplifications were performed at least three times with multiple sets of experimental RNAs.

Data analysis

Data are summarized as mean ± SD. The statistical analysis of the results was performed by the unpaired t test. Values for p < 0.05 were considered significant.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 Disclosures
 References
 
Establishment of a bioassay for IL-25

It has been reported that IL-25 activates NF-{kappa}B in a renal carcinoma cell line (1), but the signaling pathway under IL-25R is largely unknown. To examine IL-25 signaling in detail, we first prepared rIL-25 and an assay that verifies the bioactivity of rIL-25. Because IL-25 belongs to the cystine knot family and correct refolding and dimer formation seem to be required for its biological activity (6, 7), we used the mammalian cell-based cytokine expression system (19) rather than the Escherichia coli-based expression system. We first established X63 cells that stably produced mouse IL-25 (X63-IL-25 cells) and used the supernatant of X63-IL-25 cells as a source of IL-25. To evaluate the bioactivity of the produced IL-25, we established Ba/F3 cells that expressed IL-25R-MPL fusion protein (Ba/F3 IL-25R-MPL cells) and used as a responding cell for IL-25 stimulation. As shown in Fig. 1, Ba/F3 IL-25R-MPL cells proliferated in response not only to the supernatant of X63-IL-3 cells but also to the supernatant of X63-IL-25 cells in a dose-dependent manner, whereas control Ba/F3 cells proliferated in response to the supernatant of X63-IL-3 cells but not to the supernatant of X63-IL-25 cells. As expected, either Ba/F3 IL-25R-MPL cells or control Ba/F3 cells did not proliferate in response to the supernatant of X63-control cells (Fig. 1).



View larger version (16K):
[in this window]
[in a new window]
  		FIGURE 1. Establishment of a bioassay for IL-25. Control vector-transfected Ba/F3 cells (left) and IL-25R-MPL-expressing Ba/F3 cells (right) were cultured in the presence of the supernatant of X63-control, X63-IL-3, or X63-IL-25 cells at the indicated concentrations at 37°C for 36 h with 0.5 µCi of [3H]thymidine added for the final 12 h. Data are mean ± SD of [3H]thymidine incorporation for four independent experiments.

 
IL-25R cross-linking induces NF-{kappa}B activation

We next established the system that mimicked IL-25R signaling to clarify the IL-25 signaling pathway in detail. To eliminate the possible involvement of the endogenously expressed IL-25R, we used Ab-mediated cross-linking of the receptors rather than ligand-mediated activation. Either WT IL-25R or Flag-IL-25R was expressed in COS7 cells, and these cells were stimulated with the supernatant of X63-IL-25 cells or anti-Flag mAb. In cells expressing WT IL-25R, the supernatant of X63-IL-25 cells, but not stimulation with anti-Flag mAb, activated the NF-{kappa}B-responding reporter construct (Fig. 2A). In contrast, in cells expressing Flag-IL-25R, both the supernatant of X63-IL-25 cells and anti-Flag mAb activated NF-{kappa}B-responding reporter construct (Fig. 2A). These results indicate that IL-25R signaling induces NF-{kappa}B activation and that the cross-linking with anti-Flag mAb mimics the ligand-mediated signaling of IL-25 in cells expressing Flag-IL-25R.



View larger version (31K):
[in this window]
[in a new window]
  		FIGURE 2. IL-25R signaling induces NF-{kappa}B activation by a TRAF6-dependent mechanism. A, IL-25R cross-linking induces NF-{kappa}B activation. COS7 cells were transfected with the expression vector for IL-25R or Flag-tagged-IL-25R in the presence of pNF-{kappa}B-Luc and pRL-TK. Twenty-four hours later, the cells were stimulated with the supernatant of X63-IL-25 cells (3%) or anti-Flag mAb (2 µg/ml) at 37°C for 24 h. Luciferase activities of pNF-{kappa}B-Luc were determined by a Dual-Luciferase Reporter System. Data are mean ± SD of the relative luciferase activity of pNF-{kappa}B-Luc for four experiments. Significantly different (*, p < 0.01) from the mean value of unstimulated cells (control IgG1). B, DN TRAF6 inhibits IL-25R-mediated NF-{kappa}B activation. The expression vector for Flag-tagged IL-25R was transfected to COS7 cells in the presence of pNF-{kappa}B-Luc and pRL-TK. Where indicated, amounts of expression vector for DN TRAF6 or DN TRAF2 were simultaneously transfected. Twenty-four hours later, cells were incubated with anti-Flag mAb or control IgG1 at 37°C for another 24 h, and the luciferase activities of pNF-{kappa}B-Luc were determined by the Dual-Luciferase Reporter Assay System. Data are mean ± SD for four experiments. Significant difference (*, p < 0.05 and **, p < 0.01) is shown. C, IL-25R-mediated I{kappa}B-{alpha} down-regulation is diminished in TRAF6–/– cells. WT MEF and TRAF6–/– MEF were infected with retrovirus of pMX-Flag-IL-25R-IRES-GFP as described in Materials and Methods. After infected cells were sorted and expanded, IL-25R was cross-linked with anti-Flag mAb or control IgG1 at 37°C for 20 min. As controls, MEF infected with retrovirus of pMX-Flag-IL-25R-IRES-GFP were stimulated with rIL-17 (100 ng/ml) or IL-1{beta} (10 ng/ml) at 37°C for 20 min. Cell lysates were subjected to immunoblotting with anti-I{kappa}B-{alpha} Ab. Shown are representative blot (top) and mean ± SD of the percentage of I{kappa}B-{alpha} down-regulation determined by a densitometer (bottom) from four independent experiments. Significantly different (*, p < 0.01) from the mean value of the corresponding response of WT MEF. D, TRAF6 is required for IL-25-induced nuclear accumulation of NF-{kappa}B p65. Flag-IL-25R-expressing WT MEF or TRAF6–/– MEF were stimulated with X63-IL-25 condition medium (top) or anti-Flag mAb (bottom) at 37°C for 30 min. As controls, supernatant of X63-control cells (top) or control IgG1 (bottom) was used. Nuclear extracts were prepared from these cells, and the binding activity to NF-{kappa}B consensus oligonucleotides was determined as described in Materials and Methods. Where indicated, unlabeled competitor oligonucleotides were added to nuclear extracts to confirm specific binding. Data are mean ± SD of relative light unit (RLU) for four experiments. Significant difference (*, p < 0.01) are indicated.

 
TRAF6 is crucial for IL-25R-mediated NF-{kappa}B activation

It has been reported that TRAF6 is involved in the signaling pathways of IL-1- and IL-17-induced NF-{kappa}B activation (20, 25, 26). To determine whether TRAF6 is involved in IL-25R-mediated signaling, we investigated the effect of a DN TRAF6 on IL-25R-mediated NF-{kappa}B activation. As a control, we examined the effect of DN TRAF2 on IL-25R-mediated NF-{kappa}B activation in parallel. As shown in Fig. 2B, the expression of DN TRAF6, but not DN TRAF2, inhibited IL-25R-mediated NF-{kappa}B activation in a dose-dependent manner (n = 4, p < 0.01), suggesting that TRAF6 but not TRAF2 is involved in the signaling pathways of NF-{kappa}B activation under IL-25R.

To further clarify the involvement of TRAF6 in IL-25R-mediated signaling, we compared IL-25R-mediated I{kappa}B-{alpha} down-regulation in Flag-IL-25R-expressing TRAF6–/– MEF and in Flag-IL-25R-expressing WT MEF. As controls, these cells were stimulated with IL-1{beta} or IL-17, cytokines that activate the NF-{kappa}B pathway (5, 6, 7, 20, 27). As shown in Fig. 2C, the expression levels of I{kappa}B-{alpha} in Flag-IL-25R-expressing WT MEF were down-regulated in response to anti-Flag mAb, compared with the basal levels of I{kappa}B-{alpha} (control IgG1) (n = 4, p < 0.01). Stimulation with the supernatant of X63-IL-25 cells also down-regulated the expression levels of I{kappa}B-{alpha} in Flag-IL-25R-expressing WT MEF (data not shown). Importantly, IL-25R-mediated I{kappa}B-{alpha} down-regulation was significantly impaired in Flag-IL-25R-expressing TRAF6–/– MEF, compared with that in Flag-IL-25R-expressing WT MEF (n = 4, p < 0.01) (Fig. 2C). As expected, IL-1- or IL-17-mediated I{kappa}B-{alpha} down-regulation was also impaired in TRAF6–/– MEF (Fig. 2C).

To further examine the involvement of TRAF6 in IL-25R-mediated NF-{kappa}B activation, we compared IL-25R-mediated nuclear accumulation of NF-{kappa}B p65 in Flag-IL-25R-expressing WT MEF and TRAF6–/– MEF. Nuclear accumulation of NF-{kappa}B p65 was induced by IL-25 stimulation (Fig. 2D, top panel) or by anti-Flag mAb-mediated IL-25R cross-linking (Fig. 2D, bottom panel) in Flag-IL-25R-expressing WT MEF. IL-25-mediated or anti-Flag mAb-mediated nuclear accumulation of NF-{kappa}B p65 was significantly decreased in Flag-IL-25R-expressing TRAF6–/– MEF (Fig. 2D). Taken together, these results indicate that TRAF6 is involved in IL-25R-mediated NF-{kappa}B activation.

TRAF6 associates with IL-25R

We then examined whether TRAF6 associates with IL-25R by a coimmunoprecipitation assay. Flag-tagged TRAF6 was expressed with or without myc-tagged IL-25R in COS7 cells and the amounts of Flag-tagged TRAF6 in the immunoprecipitates with anti-myc mAb was evaluated. As shown in Fig. 3A, anti-myc mAb coprecipitated Flag-tagged TRAF6. We also performed the immunoprecipitation with anti-Flag mAb and confirmed that myc-tagged IL-25R was coimmunoprecipitated with Flag-tagged TRAF6 (Fig. 3B). In contrast, myc-tagged IL-25R was not coimmunoprecipitated with Flag-tagged TRAF2 or TRAF5 (Fig. 3B). These results suggest that TRAF6 but not TRAF2 or TRAF5 can associate with IL-25R and that this association occurs even in the absence of ligand binding. Furthermore, IL-25R-mediated NF-{kappa}B activation was attenuated in cells expressing IL-25R E338A, in which TRAF6-binding motif was mutated, compared with that in cells expressing WT IL-25R (Fig. 3C). These results suggest that the direct association between IL-25R and TRAF6 is crucial for IL-25-mediated NF-{kappa}B activation.



View larger version (49K):
[in this window]
[in a new window]
  		FIGURE 3. TRAF6 but not TRAF2 nor TRAF5 associates with IL-25R. A, TRAF6 associates with IL-25R. COS7 cells were transfected with myc-tagged IL-25R and/or Flag-tagged TRAF6, and the cell lysates were immunoprecipitated (IP) with anti-myc Ab and followed by immunoblottings (IB) with anti-Flag Ab or anti-myc Ab. Shown are representative data of three independent experiments. B, TRAF2 and TRAF5 do not associate with IL-25R. COS7 cells were transfected with myc-tagged IL-25R and Flag-tagged TRAF6, Flag-tagged TRAF2, or Flag-tagged TRAF5. Cell lysates were immunoprecipitated with anti-Flag Ab and followed by immunoblottings with anti-myc Ab or anti-Flag Ab. Shown are representative data of three independent experiments. C, E338A mutation of IL-25R attenuates IL-25R-mediated NF-{kappa}B activation. COS7 cells were transfected with the expression vector for Flag-tagged IL-25R WT or Flag-tagged-IL-25R E338A (Flag IL-25R MT) in the presence of pNF-{kappa}B-Luc and pRL-TK. Twenty-four hours later, the cells were stimulated with anti-Flag mAb (2 µg/ml) at 37°C for 24 h. Luciferase activities of pNF-{kappa}B-Luc were determined by a Dual-Luciferase Reporter System. Data are means ± SD of the relative luciferase activity of pNF-{kappa}B-Luc for four experiments. Significant difference (*, p < 0.05) is shown.

 
IL-25 induces MAPK activation by a TRAF6-independent mechanism

To determine whether IL-25 activates other intracellular signaling pathways such as MAPK pathways, we next examined the phosphorylation of ERK, JNK, and p38 in Flag-IL-25R-expressing MEF upon stimulation with anti-Flag mAb. The phosphorylation of ERK was markedly induced upon stimulation with anti-Flag mAb at similar levels to that induced by IL-17 or IL-1 stimulation (Fig. 4). The phosphorylation of JNK and p38 was also induced by the stimulation with anti-Flag mAb, although it was weaker than that induced by IL-17 or IL-1 stimulation (Fig. 4). These results indicate that IL-25 activates not only the NF-{kappa}B pathway but also ERK, JNK, and p38 pathways. Interestingly, although IL-17- or IL-1-mediated activation of JNK and p38 was impaired in TRAF6–/– MEF (Fig. 4, lane 3 vs lane 7 and lane 4 vs lane 8, respectively), IL-25R-mediated activation of ERK, JNK, and p38 was not impaired in TRAF6–/– MEF (Fig. 4, lane 2 vs lane 6). These results indicate that in contrast to I{kappa}B-{alpha} down-regulation and subsequent NF-{kappa}B activation (Fig. 2, B and C), TRAF6-independent pathways mainly contribute to the activation of ERK, JNK, and p38 under IL-25R-mediated signaling.



View larger version (74K):
[in this window]
[in a new window]
  		FIGURE 4. IL-25 activates ERK, JNK, and p38 by a TRAF6-independent mechanism. Similar to Fig. 2C, WT or TRAF6–/– MEF infected with retrovirus of pMX-Flag-IL-25R-IRES-GFP were incubated with control IgG1, anti-Flag mAb, IL-17, or IL-1 at 37°C for 20 min, and cell lysates were subjected to immunoblotting with anti-phospho-ERK, anti-ERK, anti-phospho-JNK, anti-JNK, anti-phospho-p38, or anti-p38 Ab. Shown are representative blots from four independent experiments.

 
TRAF6 is involved in IL-25R-mediated gene expression

To determine whether TRAF6 is involved in IL-25R-mediated gene expression, we compared the mRNA induction of IL-6, TGF-{beta}, G-CSF, and TARC in Flag-IL-25R-expressing WT MEF with Flag-IL-25R-expressing TRAF6–/– MEF upon stimulation with anti-Flag mAb. Interestingly, the induction of mRNA expression of IL-6, TGF-{beta}, G-CSF, and TARC by anti-Flag cross-linking was significantly decreased in Flag-IL-25R-expressing TRAF6–/– MEF, compared with that in Flag-IL-25R-expressing WT MEF (Fig. 5). The induction of IL-6, TGF-{beta}, G-CSF, and TARC mRNA was also attenuated in Flag-IL-25R E338A-expressing WT MEF, compared with that in Flag-IL-25R-expressing WT MEF (data not shown). Taken together, these results suggest that TRAF6 plays an important role in the production of cytokines and chemokines upon IL-25R-mediated signaling.



View larger version (41K):
[in this window]
[in a new window]
  		FIGURE 5. IL-25 up-regulates cytokine and chemokine mRNA expression in a TRAF6-dependent manner. WT MEF and TRAF6–/– MEF were infected with retrovirus of pMX-Flag-IL-25R-IRES-GFP as described in Fig. 2C and then incubated with anti-Flag mAb or control IgG1 at 37°C for 3 h. Total cellular RNA was prepared, and RT-PCR analysis for IL-6, TGF-{beta}, G-CSF, TARC, and {beta}-actin (as a control) was performed. Shown are representative data of four independent experiments.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
Disclosures
 References
 
In this study, we show that TRAF6 mediates NF-{kappa}B activation in IL-25R signaling. We found that IL-25R-mediated signaling induced NF-{kappa}B activation (Fig. 2A) as well as ERK, JNK, and p38 activation (Fig. 4). We also found that IL-25R-mediated NF-{kappa}B activation was down-regulated by the expression of DN TRAF6 but not of DN TRAF2 (Fig. 2B). Furthermore, IL-25R-mediated NF-{kappa}B activation, but not MAPK activation, was diminished in TRAF6–/– MEF (Figs. 2C and 4). In addition, coimmunoprecipitation assay revealed that TRAF6 associated with IL-25R in a ligand-independent manner (Fig. 3, A and B). Finally, we found that IL-25R-mediated gene expression of IL-6, TGF-{beta}, G-CSF, and TARC was diminished in TRAF6–/– MEF (Fig. 4). Taken together, these results indicate that TRAF6 plays a critical role in IL-25R-mediated NF-{kappa}B activation and gene expression.

Our results suggest that TRAF6 directly associates with the cytoplasmic region of IL-25R and induces NF-{kappa}B activation upon ligand binding. The TRAF6-binding motif is conserved in the cytoplasmic region of mouse and human IL-25R and we showed the association between IL-25R and TRAF6 even in the absence of ligand binding (Fig. 3, A and B). We also found that the disruption of the TRAF6-binding motif attenuated IL-25R-mediated NF-{kappa}B activation (Fig. 3C). In contrast, although there is no TRAF6-binding motif in IL-17R, TRAF6 was coimmunoprecipitated with IL-17R (26) and IL-17-induced NF-{kappa}B activation was diminished in TRAF6–/– cells (26) (Fig. 2C). Therefore, the mechanisms underlying TRAF6 activation may be different between IL-25R- and IL-17R-mediated signaling.

In contrast, we show that IL-25R-mediated activation of ERK, JNK, and p38 is TRAF6-independent (Fig. 4). We found that IL-25R-mediated ERK, JNK, and p38 activation was similarly observed in WT and TRAF6–/– MEF (Fig. 4). In contrast, we found that IL-17R-mediated JNK and p38 activation was diminished in TRAF6–/– MEF (Fig. 4). Schwandner et al. (26) have also shown that IL-17-induced JNK activation is impaired in TRAF6–/– cells. These results indicate that TRAF6-independent pathways are primarily involved in the activation of JNK and p38 under IL-25R- but not IL-17R-mediated signaling.

The mechanisms by which IL-25 activates these MAPKs have not yet been elucidated. These MAPKs are activated by their specific MAPK kinases: ERK is activated by MEK1 and MEK2, JNK is activated by MAPK kinase (MKK)4 and MKK7, and p38 is activated by MKK3 and MKK6 (28). These MAPK kinases are also activated by various MAPK kinase kinases, such as Raf, TGF-{beta}-activated protein kinase 1, MEK kinase 1, MLK, and apoptosis signal-regulating kinase 1 (28). In preliminary experiments, we found that IL-25R cross-linking modestly induced Raf-1 and MKK3 activation in Flag-IL-25R-expressing cells. However, the induction of Raf-1 and MKK3 activation by IL-25R cross-linking was weaker than that by IL-1 or IL-17. Thus, other kinases may be participated in the activation of these MAPKs under IL-25R signaling. Future studies revealing the signaling cascade of IL-25-induced MAPKs activation especially in the undefined IL-25-responding cells could help the understanding of the physiological importance of MAPKs activation through IL-25R signaling.

Our results also show that IL-25R-mediated signaling induces the production of TARC by a TRAF6-dependent mechanism (Fig. 5). We also found that rIL-25-induced TARC expression in NIH3T3 cells (data not shown). Our findings support the previous report showing that the in vivo administration of IL-25-expressing adenovirus induces the expression of chemokines including TARC in the lung (4). TARC is a specific ligand for CCR4 (29, 30) and induces chemotaxis of T cells, especially of Th2 cells (31, 32). It has also been demonstrated that TARC plays a significant role for the induction of Th2 cell-mediated eosinophil recruitment into the airways in a murine model of asthma (33). We also found that mice that specifically expressed IL-25 in the lung under the control of CC-10 (Clara cell 10-kDa) promoter exhibited the enhanced T cell recruitment into the airways after Ag inhalation (T. Tamachi, Y. Maezawa, K. Ikeda, S.-i. Kagami, M. Hatano, Y. Seto, A. Suto, K. Suzuki, N. Watanabe, Y. Saito, T. Tokuhisa, I. Iwamoto, and H. Nakajima, manuscript in preparation). Therefore, it is suggested that the induction of TARC by IL-25-induced NF-{kappa}B activation may be involved in IL-25-mediated allergic inflammation.

IL-25 is expressed in Th2-polarized CD4+ T cells (2) and activated mast cells (34). It has also been reported that in vivo administration of IL-25 promotes the expression of Th2-cell associated cytokines such as IL-4, IL-5, and IL-13 from a non-T/non-B cell population (2, 4). These findings suggest that IL-25 is within the amplification loop of Th2-type immune responses. In this regard, a recent study has demonstrated that APCs such as macrophages and dendritic cells express IL-25R upon IL-4 stimulation (35), suggesting that APCs may be involved in the IL-25-induced Th2-type immune responses. Further investigation is needed to determine cell populations that respond to IL-25 and trigger Th2-type immune responses in vivo.

In summary, we have demonstrated that TRAF6 is involved in IL-25R-mediated NF-{kappa}B activation and gene expression. Because IL-25 is suggested to be involved in Th2 cell-mediated allergic inflammation by inducing Th2 cytokine production from an unidentified non-T/non-B cell population, the elucidation of IL-25R-mediated signaling provides a new tool for the treatment of allergic diseases such as bronchial asthma, atopic rhinitis, and atopic dermatitis.


   Acknowledgments
 
We thank Dr. John D. Shaughnessy, Jr., for providing an expression vector for murine IL-25R; Dr. Toshio Kitamura for expression vector of MPL, pMX-IRES-GFP, and Plat-E cells; and Dr. Hajime Karasuyama for X63 cells, X63-IL-3 cells, and BCMGS neo.


   Disclosures
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
References
 
The authors have no financial conflict of interest.


   Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported in part by grants from Special Coordination Funds for Promoting Science and Technology from the Ministry of Education, Culture, Sports, Science and Technology, Japan. Back

2 Address correspondence and reprint requests to Dr. Hiroshi Nakajima, Department of Allergy and Clinical Immunology, Graduate School of Medicine, Chiba University, 1-8-1 Inohana, Chiba City, Chiba 260-8670, Japan. E-mail address: nakajimh{at}faculty.chiba-u.jp Back

3 Abbreviations used in this paper: TRAF, TNFR-associated factor; TARC, thymus and activation-regulated chemokine; MEF, murine embryonic fibroblast; DN, dominant negative; MKK, MAPK kinase; WT, wild type. Back

Received for publication March 2, 2005. Accepted for publication November 2, 2005.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Lee, J., W. H. Ho, M. Maruoka, R. T. Corpuz, D. T. Baldwin, J. S. Foster, A. D. Goddard, D. G. Yansura, R. L. Vandlen, W. I. Wood, A. L. Gurney. 2001. IL-17E, a novel proinflammatory ligand for the IL-17 receptor homolog IL-17Rh1. J. Biol. Chem. 276: 1660-1664. [Abstract/Free Full Text]
  2. Fort, M. M., J. Cheung, D. Yen, J. Li, S. M. Zurawski, S. Lo, S. Menon, T. Clifford, B. Hunte, R. Lesley, et al 2001. IL-25 induces IL-4, IL-5 and IL-13 and Th2-associated pathologies in vivo. Immunity 15: 985-995. [Medline]
  3. Pan, G., D. French, W. Mao, M. Maruoka, P. Risser, J. Lee, J. Foster, S. Aggarwal, K. Nicholes, S. Guillet, et al 2001. Forced expression of murine IL-17E induces growth retardation, jaundice, a Th2-biased response, and multiorgan inflammation in mice. J. Immunol. 167: 6559-6567. [Abstract/Free Full Text]
  4. Hurst, S. D., T. Muchamuel, D. M. Gorman, J. M. Gilbert, T. Clifford, S. Kwan, S. Menon, B. Seymour, C. Jackson, T. T. Kung, et al 2002. New IL-17 family members promote Th1 or Th2 responses in the lung: in vivo function of the novel cytokine IL-25. J. Immunol. 169: 443-453. [Abstract/Free Full Text]
  5. Aggarwal, S., A. L. Gurney. 2002. IL-17: prototype member of an emerging cytokine family. J. Leukocyte Biol. 71: 1-8. [Abstract/Free Full Text]
  6. Moseley, T. A., D. R. Haudenschild, L. Rose, A. H. Reddi. 2003. Interleukin-17 family and IL-17 receptors. Cytokine Growth Factor Rev. 14: 155-174. [Medline]
  7. Kolls, J. K., A. Linden. 2004. Interleukin-17 family members and inflammation. Immunity 21: 467-476. [Medline]
  8. Kim, M. R., R. Manoukian, R. Yeh, S. M. Silbiger, D. M. Danilenko, S. Scully, J. Sun, M. L. DeRose, M. Stolina, D. Chang, et al 2002. Transgenic overexpression of human IL-17E results in eosinophilia, B-lymphocyte hyperplasia, and altered antibody production. Blood 100: 2330-2340. [Abstract/Free Full Text]
  9. Schwarzenberger, P., V. La Russa, A. Miller, P. Ye, W. Huang, A. Zieske, S. Nelson, G. J. Bagby, D. Stoltz, R. L. Mynatt, et al 1998. IL-17 stimulates granulopoiesis in mice: use of an alternate, novel gene therapy-derived method for in vivo evaluation of cytokines. J. Immunol. 161: 6383-6389. [Abstract/Free Full Text]
  10. Linden, A., H. Hoshino, M. Laan. 2000. Airway neutrophils and interleukin-17. Eur. Respir. J. 15: 973-977. [Abstract]
  11. Shi, Y., S. J. Ullrich, J. Zhang, K. Connolly, K. J. Grzegorzewski, M. C. Barber, W. Wang, K. Wathen, V. Hodge, C. L. Fisher, et al 2000. A novel cytokine receptor-ligand pair: identification, molecular characterization, and in vivo immunomodulatory activity. J. Biol. Chem. 275: 19167-19176. [Abstract/Free Full Text]
  12. Tian, E., J. R. Sawyer, D. A. Largaespada, N. A. Jenkins, N. G. Copeland, J. D. Shaughnessy, Jr. 2000. Evi27 encodes a novel membrane protein with homology to the IL17 receptor. Oncogene 19: 2098-2109. [Medline]
  13. Wajant, H., M. Grell, P. Scheurich. 1999. TNF receptor associated factors in cytokine signaling. Cytokine Growth Factor Rev. 10: 15-26. [Medline]
  14. Bradley, J. R., J. S. Pober. 2001. Tumor necrosis factor receptor-associated factors (TRAFs). Oncogene 20: 6482-6491. [Medline]
  15. Chung, J. Y., Y. C. Park, H. Ye, H. Wu. 2002. All TRAFs are not created equal: common and distinct molecular mechanisms of TRAF-mediated signal transduction. J. Cell Sci. 115: 679-688. [Abstract/Free Full Text]
  16. Wu, H., J. R. Arron. 2003. TRAF6, a molecular bridge spanning adaptive immunity, innate immunity and osteoimmunology. BioEssays 25: 1096-1105. [Medline]
  17. Ye, H., J. R. Arron, B. Lamothe, M. Cirilli, T. Kobayashi, N. K. Shevde, D. Segal, O. K. Dzivenu, M. Vologodskaia, M. Yim, et al 2002. Distinct molecular mechanism for initiating TRAF6 signaling. Nature 418: 443-447. [Medline]
  18. Takatsuna, H., H. Kato, J. Gohda, T. Akiyama, A. Moriya, Y. Okamoto, Y. Yamagata, M. Otsuka, K. Umezawa, K. Semba, J. Inoue. 2003. Identification of TIFA as an adapter protein that links tumor necrosis factor receptor-associated factor 6 (TRAF6) to interleukin-1 (IL-1) receptor-associated kinase-1 (IRAK-1) in IL-1 receptor signaling. J. Biol. Chem. 278: 12144-12150. [Abstract/Free Full Text]
  19. Karasuyama, H., F. Melchers. 1988. Establishment of mouse cell lines which constitutively secrete large quantities of interleukin 2, 3, 4 or 5, using modified cDNA expression vectors. Eur. J. Immunol. 18: 97-104. [Medline]
  20. Kobayashi, N., Y. Kadono, A. Naito, K. Matsumoto, T. Yamamoto, S. Tanaka, J. Inoue. 2001. Segregation of TRAF6-mediated signaling pathways clarifies its role in osteoclastogenesis. EMBO J. 20: 1271-1281. [Medline]
  21. Morita, S., T. Kojima, T. Kitamura. 2000. Plat-E: an efficient and stable system for transient packaging of retroviruses. Gene Ther. 7: 1063-1066. [Medline]
  22. Geddis, A. E., H. M. Linden, K. Kaushansky. 2002. Thrombopoietin: a pan-hematopoietic cytokine. Cytokine Growth Factor Rev. 13: 61-73. [Medline]
  23. Ishida, T., S. Mizushima, S. Azuma, N. Kobayashi, T. Tojo, K. Suzuki, S. Aizawa, T. Watanabe, G. Mosialos, E. Kieff, et al 1996. Identification of TRAF6, a novel tumor necrosis factor receptor-associated factor protein that mediates signaling from an amino-terminal domain of the CD40 cytoplasmic domain. J. Biol. Chem. 271: 28745-28748. [Abstract/Free Full Text]
  24. Suto, A., H. Nakajima, K. Hirose, K. Suzuki, S. Kagami, Y. Seto, A. Hoshimoto, Y. Saito, D. C. Foster, I. Iwamoto. 2002. Interleukin-21 prevents antigen-induced IgE production by inhibiting germline C{epsilon} transcription of IL-4-stimulated B cells. Blood 100: 4565-4573. [Abstract/Free Full Text]
  25. Cao, Z., J. Xiong, M. Takeuchi, T. Kurama, D. V. Goeddel. 1996. TRAF6 is a signal transducer for interleukin-1. Nature 383: 443-446. [Medline]
  26. Schwandner, R., K. Yamaguchi, Z. Cao. 2000. Requirement of tumor necrosis factor-associated factor (TRAF) 6 in interleukin 17 signal transduction. J. Exp. Med. 191: 1233-1239. [Abstract/Free Full Text]
  27. Shalom-Barak, T., J. Quach, M. Lotz. 1998. Interleukin-17-induced gene expression in articular chondrocytes is associated with activation of mitogen-activated protein kinases and NF-{kappa}B. J. Biol. Chem. 273: 27467-27473. [Abstract/Free Full Text]
  28. Johnson, G. L., H. G. Dohlman, L. M. Graves. 2005. MAPK kinase kinases (MKKKs) as a target class for small-molecule inhibition to modulate signaling networks and gene expression. Curr. Opin. Chem. Biol. 9: 325-331. [Medline]
  29. Imai, T., M. Baba, M. Nishimura, M. Kakizaki, S. Takagi, O. Yoshie. 1997. The T cell-directed CC chemokine TARC is a highly specific biological ligand for CC chemokine receptor 4. J. Biol. Chem. 272: 15036-15042. [Abstract/Free Full Text]
  30. Imai, T., D. Chantry, C. J. Raport, C. L. Wood, M. Nishimura, R. Godiska, O. Yoshie, P. W. Gray. 1998. Macrophage-derived chemokine is a functional ligand for the CC chemokine receptor 4. J. Biol. Chem. 273: 1764-1768. [Abstract/Free Full Text]
  31. Bonecchi, R., G. Bianchi, P. P. Bordignon, D. D’Ambrosio, R. Lang, A. Borsatti, S. Sozzani, P. Allavena, P. A. Gray, A. Mantovani, F. Sinigaglia. 1998. Differential expression of chemokine receptors and chemotactic responsiveness of type 1 T helper cells (Th1s) and Th2s. J. Exp. Med. 187: 129-134. [Abstract/Free Full Text]
  32. Sallusto, F., D. Lenig, C. R. Mackay, A. Lanzavecchia. 1998. Flexible programs of chemokine receptor expression on human polarized T helper 1 and 2 lymphocytes. J. Exp. Med. 187: 875-883. [Abstract/Free Full Text]
  33. Kawasaki, S., H. Takizawa, H. Yoneyama, T. Nakayama, R. Fujisawa, M. Izumizaki, T. Imai, O. Yoshie, I. Homma, K. Yamamoto, K. Matsushima. 2001. Intervention of thymus and activation-regulated chemokine attenuates the development of allergic airway inflammation and hyperresponsiveness in mice. J. Immunol. 166: 2055-2062. [Abstract/Free Full Text]
  34. Ikeda, K., H. Nakajima, K. Suzuki, S.-I. Kagami, K. Hirose, A. Suto, Y. Saito, I. Iwamoto. 2003. Mast cell produce interleukin-25 upon Fc{epsilon}RI-mediated activation. Blood 101: 3594-3596. [Abstract/Free Full Text]
  35. Gratchev, A., J. Kzhyshkowska, K. Duperrier, J. Utical, F. W. Velten, S. Goerdt. 2004. The receptor for interleukin-17E is induced by Th2 cytokines in antigen-presenting cells. Scand. J. Immunol. 60: 233-237. [Medline]



This article has been cited by other articles:


Home page
 J. Immunol.Home page
E. Claudio, S. U. Sonder, S. Saret, G. Carvalho, T. R. Ramalingam, T. A. Wynn, A. Chariot, A. Garcia-Perganeda, A. Leonardi, A. Paun, et al.
The Adaptor Protein CIKS/Act1 Is Essential for IL-25-Mediated Allergic Airway Inflammation
J. Immunol., February 1, 2009; 182(3): 1617 - 1630.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
S. Swaidani, K. Bulek, Z. Kang, C. Liu, Y. Lu, W. Yin, M. Aronica, and X. Li
The Critical Role of Epithelial-Derived Act1 in IL-17- and IL-25-Mediated Pulmonary Inflammation
J. Immunol., February 1, 2009; 182(3): 1631 - 1640.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
Y. J. Yang, W. Chen, S. O. Carrigan, W.-M. Chen, K. Roth, T. Akiyama, J.-i. Inoue, J. S. Marshall, J. N. Berman, and T.-J. Lin
TRAF6 Specifically Contributes to Fc{epsilon}RI-mediated Cytokine Production but Not Mast Cell Degranulation
J. Biol. Chem., November 14, 2008; 283(46): 32110 - 32118.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
E. A. Rickel, L. A. Siegel, B.-R. P. Yoon, J. B. Rottman, D. G. Kugler, D. A. Swart, P. M. Anders, J. E. Tocker, M. R. Comeau, and A. L. Budelsky
Identification of Functional Roles for Both IL-17RB and IL-17RA in Mediating IL-25-Induced Activities
J. Immunol., September 15, 2008; 181(6): 4299 - 4310.
[Abstract] [Full Text] [PDF]

Home page
 JEMHome page
X. O. Yang, S. H. Chang, H. Park, R. Nurieva, B. Shah, L. Acero, Y.-H. Wang, K. S. Schluns, R. R. Broaddus, Z. Zhu, et al.
Regulation of inflammatory responses by IL-17F
J. Exp. Med., May 12, 2008; 205(5): 1063 - 1075.
[Abstract] [Full Text] [PDF]

Home page
 JEMHome page
C. M. Tato, A. Laurence, and J. J. O'Shea
Helper T cell differentiation enters a new era: Le Roi est mort; vive le Roi!
J. Exp. Med., April 17, 2006; 203(4): 809 - 812.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Maezawa, Y.
Right arrow Articles by Iwamoto, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Maezawa, Y.
Right arrow Articles by Iwamoto, I.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS