|
|
||||||||
Surgery Branch, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
-chain receptor in combination with unique receptors expressed on T cells. In addition to acting to promote the proliferation and effector function of CD8+ and CD4+ T cells, IL-2 has been shown to delay the contraction phase of T cells responding to viral infection (1) as well as play a role in the reversal of T cell anergy or tolerance (2, 3). The administration of IL-2 to patients with metastatic melanoma and renal cancer resulted in objective responses in 1015% of treated patients (4, 5, 6, 7). In addition, the adoptive transfer of tumor-infiltrating lymphocytes (TIL)3 cultured in vitro with IL-2 administered following lymphodepleting chemotherapy leads to objective clinical responses in
50% of treated patients refractory to treatment with IL-2 alone (8, 9). The engagement of costimulatory molecules on T cells with their ligands, found predominantly on APCs, also plays a critical role in enhancing T cell activation. The interaction of the costimulatory molecule CD27 with its ligand CD70 plays a key role in T lymphocyte activation, proliferation, survival, and differentiation (10, 11, 12, 13). In both the human and mouse, CD27 is constitutively expressed on naive and memory T cells as well as on subsets of activated B cells, NK cells, and hemopoietic progenitor cells; however, expression of CD27 is down-regulated in late effector stage T cells (14, 15, 16, 17). In contrast, little or no expression of CD70 is found on quiescent T, B, and dendritic cells; however, activation has been found to transiently up-regulate expression of this marker on these cell types (13, 18).
Signaling through CD27 can lead to a modest delay in the contraction phase of influenza-specific CD8+ T cells in peripheral blood and spleen after viral infection (10), and several studies indicate that the lack of costimulatory signals can lead to the induction of T cell anergy as well as apoptosis (19, 20, 21). Transfection of tumors with CD70 leads to enhanced anti-tumor immune responses (22, 23), and stimulation of CD27 through CD70 has been shown to support clonal expansion of tumor-specific T cells (24, 25). These observations suggest that engagement of CD27 may play an important role in regulating responses to a variety of antigenic stimuli.
The findings presented in this study provide evidence that signaling mediated by the interaction between the CD27 and CD70 molecules expressed on CD8+ T cells may play an important role in IL-2-mediated T cell activation. Examination of the expression of CD27 and CD70 on samples of tumor-reactive TILs that were adoptively transferred as part of a human clinical trial also suggested that the expression of these molecules on CD8+ T cells in TILs may play a role in the response to adoptive immunotherapy.
| Materials and Methods |
|---|
|
|
|---|
Samples of PBMCs were obtained from patients with metastatic melanoma after the administration of tumor-reactive TIL or IL-2 in clinical protocols approved by the Institutional Review Board of the National Cancer Institute. The in vitro cultured TIL cell lines used to treat patients were established from tumor fragments by culturing dissociated cells in 3,000 IU/ml rhIL-2 and then expanded using anti-CD3 Abs in the presence of PBMC feeder cells.
Cell culture and activation
All experiments were performed in X-VIVO 15 (Cambrex) containing 5% human serum medium in the presence or absence of IL-2. PBMC samples from normal blood donors or IL-2-treated patients were cultured in various concentrations of IL-2 for up to 12 days, and analysis was performed as indicated in Results. For the CD70 blocking experiment PBMCs were thawed or obtained directly from pheresis procedures on patients, the indicated concentrations of Ab and IL-2 were added into 106/ml T cells at the same time, and cell cycle analysis or FACS analysis was conducted at day 4. The separation of CD27+ and CD27 cells was performed by initially culturing TILs in medium without IL-2 for 2 days. Anti-CD27-PE bead staining and anti-PE bead staining were subsequentially performed, followed by passage through an MS separation column from Miltenyi Biotec. The CD27 cells were obtained from the cells that had passed through during CD27+ cell selection and were then passed through an LD column (Miltenyi Biotec). The peptide stimulation experiment was done by pulsing with indicated concentrations of MART-12635 (27L) for 18 h, and cytokine release was measured by ELISA. The total number of CD27+CD8+ T cells in TIL samples were evaluated by washing cells twice with medium without IL-2 and culturing the TILs in IL-2-free medium for 2 days, followed by Ab staining and FACS analysis.
Antibodies and FACS analysis
Characterization of the expression of TCR
-chain variable region expression on TIL was conducted using
-chain variable region Abs obtained from Beckman Coulter and Pierce. Anti-CD27, anti-CD70, and anti-CD8 were purchased from BD Biosciences. For evaluation of the levels of IL-2 binding to T cells, cells were stained with streptavidin-FITC using reagents from the recombinant human IL-2 Fluorokine (rhIL-2F) kit (R&D Systems) (26). Blocking Ab for human CD70 (clone BU69) was purchased from Ancell. FACS analysis was performed by using CellQuest software (BD Biosciences).
Real-time RT-PCR
Total RNA was isolated from CD27+ purified and CD27 purified cells, respectively, using RNeasy columns (Qiagen). RT-PCR was performed using the ThermoScript RT-PCR system (Invitrogen Life Sciences). Four microliters of RT-PCR products were used for the quantitative PCR using a commercially available TaqMan kit and probes and primers for CD27 (Hs00386811) and CD28 (Hs01007422) (Applied Biosystems). A full-length TCR
-chain was used for the internal control for all the assays. The C
-specific primers were GAGGGTCTCGGCCACCTT and AGGCGACAGTTCAGGTCAAGA, and the probe was 5'-FAM-TGGCAGAACCCCCGCAACCAACCAC-TAMRA-3'. The samples were run on a Chromo 4 detector with a PTC-200 Peltier thermal cycler (MJ Research)
Cell cycle analysis
T cells (106/ml) under different conditions were washed and fixed in 70% ethanol for at least 1 h at 4°C, and the cells were washed twice with PBS. One milliliter of propidium iodide staining solution (50 µg/ml) was added to the cell pellet and mixed well, 50 µl of RNase A stock solution (10 µg/ml) was added, and cells were incubated for 3 h or longer at 4°C, followed by flow cytometric analysis. A lymphocyte gate and doublet discrimination gate was used, and data were analyzed using ModFit LT version 3.1 software (Verity Software House).
cDNA-microarray analysis of CD27+ and CD27 T cells from patients TILs
RNA was isolated from CD27+ and CD27 populations of patients TILs as described above in the paragraph titled Real-time RT PCR and indirectly labeled via a single round of linear amplification with the Amino Allyl MessageAmp antisense RNA kit (Ambion). The cyanine dye-labeled samples were combined and hybridized overnight to a 22,000 gene-long oligo array (version 2.0; Operon Biotechnologies) supplied by the Laboratory of Molecular Technology (National Cancer Institute, Frederick, MD). Data image files were obtained using a GenePix 4000B scanner (Axon) and imported into GeneSpring version 7.0 (Silicon Genetics) for data analysis.
| Results |
|---|
|
|
|---|
To examine the influence of IL-2 on the expression of CD27 and CD70, naive PBMCs were initially cultured in relatively low-dose (300 IU/ml) or high-dose (3000 IU/ml) rhIL-2. Only a small percentage of CD8+ T cells from peripheral blood expressed CD70 prior to in vitro culture (Fig. 1A). The frequency of CD8+ cells expressing CD70 was progressively up-regulated over a period of 12 days of in vitro culture in IL-2 (Fig. 1A, upper row), which was paralleled by an increase in the level of CD70 expression on the CD8+ T cells (data not shown). The expression of CD70 on CD8+ T cells following IL-2 treatment increased in all 12 patients who were analyzed and was more notable in cultures conducted in relatively high doses of IL-2 than in those conducted with low-dose IL-2 (Fig. 1A, upper row). The up-regulation of CD70 expression on CD8+ cells in vitro was inversely related to the loss of CD27 expression (Fig. 1A, bottom row).
|
15 and 5%, respectively, to nearly 40% of the CD8+ T cells in peripheral blood, whereas smaller increases were observed for the samples obtained from three additional patients. The maximum levels of CD70 expression were observed during a period of lymphopenia during which the absolute lymphocyte count dropped nearly 20-fold on average (from 1662 to 85 µl/ml) compared with the pretreatment level. Despite the large decrease in the absolute lymphocyte count, the absolute counts of CD70+CD8+ cells dropped only 2-fold (from 69 to 31 µl/ml) from pretreatment levels in peripheral blood. As the lymphocyte count started to recover in peripheral blood, the percentage of CD70-expressing CD8+ T cells declined to levels similar to those seen before treatment. The peak of CD70 expression correlated with a nadir in the expression of CD27 on the surface of CD8+ T cells during the lymphopenia that is routinely observed during IL-2 treatment (Fig. 1B, bottom row). This was followed by a gradual recovery of peripheral CD8+ T cells that expressed CD27 over a period of 36 weeks following the initial IL-2 infusion when CD70 expression levels were declining. Overall, these results indicated that there was an inverse relationship between the expression of CD70 and CD27 on CD8+ T cells and that IL-2 played a direct role in influencing the expression of these markers both in vitro and in vivo. Effects of IL-2 on expression of CD27 and CD70 on activated CD8+ effector T cells
The observation that IL-2 treatment alone was capable of modulating the expression levels of CD70 and CD27 on CD8+ T cells in peripheral blood led to further studies examining the expression levels of these markers on in vitro cultured effector CD8+ from patients with melanoma. The majority of CD8+ T cells in TILs grown in IL-2 from 10 patients expressed significant levels of CD70, whereas only
20% of the T cells expressed CD27 (data not shown). The withdrawal of IL-2 for a period of 2 days resulted in substantial up-regulation in CD27 expression on CD8+ T cells present in some TIL cultures. An example is shown in Fig. 2A. The overall increase in CD27 expression on TIL following IL-2 withdrawal for 2 days was statistically significant (p < 0.01, n = 10). The association between the expression of CD27 and CD70 on in vivo persistent T cells following adoptive transfer was then examined. Expression of CD27 progressively increased during a period of 2 mo on two dominant T cell clonotypes derived from TILs that persisted in the peripheral blood of two patients following adoptive transfer. Again, there appeared to be a negative correlation between CD27 and CD70 expression on the persisting T cells (Fig. 2B). These observations were consistent with the findings reported above indicating that in vitro culture in the absence of IL-2 resulted in up-regulation of CD27 expression and down-regulation of CD70 expression, because IL-2 levels present in peripheral blood are only elevated in vivo for a period of 23 days following TIL transfer when high-dose IL-2 was administered. Taken together, these results suggested that IL-2 plays a direct role in modulating the expression of both CD27 and CD70 on CD8+ T cells.
|
The involvement of IL-2 in regulating expression of CD70 and CD27 was then investigated further by testing whether IL-2 binding correlated with the expression of these markers following in vitro culture of PBMCs in low-dose (300 IU/ml) or high-dose (3,000 IU/ml) IL-2 for 12 days. IL-2 has been shown to bind to IL-2R
with low affinity, to the IL-2 R
complex with intermediate affinity, and to the IL-2R

complex with high affinity (27, 28). Before the initiation of in vitro PBMC cultures, binding of rhIL-2F to CD8+ T cells was not detected (data not shown), and <10% of the CD8+ T cells from peripheral blood expressed CD70 at this time (Fig. 1A, upper row). Incubation of PBMCs with high-dose IL-2 for five days resulted in the generation of a subpopulation of T cells that was capable of binding rhIL-2F in four of the five samples that were examined (Fig. 3A), and this binding was correlated with the expression of CD25 (data not shown). High-dose IL-2 appeared to be more effective than low-dose IL-2 at enhancing the levels of IL-2 receptor expression on CD70+CD8+ cells, which is consistent with the observation that essentially all of the unstimulated peripheral CD8+ T cells expressed only the intermediate affinity IL-2
receptor complex. In addition, the CD70 T cells did not bind to IL-2, and only a subset of the CD70+ T cells bound detectable levels of IL-2. This heterogeneous response may result from differences in the susceptibility of naive vs memory cells to be activated by IL-2 alone, and differences between the responses of PBMCs obtained from different donors may reflect differences in the pool of activated vs naive cells present in these samples. When cell cycle analysis was conducted on gated populations of CD8+ T cells, the cells that demonstrated detectable binding to rhIL-2F contained a significantly higher percentage of cells in S phase than cells that failed to bind to IL-2 (p < 0.005; n = 5) (Fig. 3B).
|
IL-2 mediates T cell proliferation through the interaction of CD27 and CD70
It appeared that IL-2 preferentially bound to CD70+CD8+ T cells and promoted significant proliferation of CD8+ cells. To determine whether the interaction of CD70 with CD27 played a direct role in mediating T cell proliferation, TILs were incubated with a blocking Ab directed against CD70 in the presence of high-dose IL-2 (3,000IU/ml) for 2 days. Anti-CD70 Ab blocked CD70 expression (98.1%) and inhibited proliferation of the cultures by nearly 40%, (Table I); however, prolonged incubation with anti-CD70 led to significant apoptosis as compared with control Ab (data not shown). These results suggested that the ability of IL-2 to mediate T cell proliferation may be mediated in part through the interaction of CD27 with CD70.
|
The ability of CD27+ and CD27 T cells to secrete IL-2 following Ag activation was then examined, because previous studies conducted with CD8+ T cells demonstrated preferential secretion of IL-2 by CD27+ T cells in response to a viral epitope (11). Cultures of TILs containing a high frequency of T cells reactive with the melanoma Ag MART-1 were incubated in the absence of IL-2 for 4 days, and the CD27+ cells and CD27 cells were then isolated. The results of a quantitative RT-PCR assay indicated that the T cells lacking cell surface expression of CD27 also contained low levels of mRNA encoding CD27 mRNA relative to CD27+ T cells (date not shown). Isolated CD27+ T cells secreted significantly higher levels of IL-2 than CD27 T cells following incubation with target cells pulsed with 0.1 µg/ml MART-1 peptide (Fig. 4A, left panel), whereas IFN-
release was only slightly higher from CD27+CD8+ cells than from CD27CD8+ cells with
1 µg/ml peptide (Fig. 4A, right panel). The analysis of cells present in S phase also indicated that, when cultured in the absence of exogenous IL-2 for 2 days, the percentage of cycling CD27+ TIL cells was significantly higher than the percentage of cycling CD27 T cells, whereas a significant difference was not observed between these populations when they were cultured in the presence of IL-2 (Fig. 4B).
|
|
To evaluate the potential relevance of these observations for adoptive immunotherapy, the expression levels of CD27 and CD70 were examined on CD8+ TIL cells that were administered to a series of melanoma patients following nonmyeloablative chemotherapy. Previous results demonstrated that
50% of the patients treated in this trial responded to therapy (8, 9) and that the in vivo persistence of transferred TIL cells was associated with clinical response (31). As shown above, IL-2 can modulate CD27 and CD70 expression; thus, the majority of TIL samples expressed very low levels of CD27 when they were cultured in high-dose IL-2. Cultures of TILs were withdrawn from IL-2 for 2 days, and comparisons were then conducted between CD8+ T cell clonotypes in the TILs that were previously shown to either persist or not persist in vivo in patients following TIL transfer (31). Persistent clonotypes expressed relatively higher levels of CD27+ cells than nonpersistent clonotypes in the same patient (p < 0.05; n = 6) (Fig. 5), although considerable overlap existed between persisting and nonpersisting clonotypes among the patients. Bulk samples of TILs that were administered to patients who either did or did not respond to therapy were then withdrawn from IL-2 for 2 days, and the cellular phenotype was assessed. The results of this analysis indicated that the mean number of CD27+CD8+ and CD70+CD8+T cells in these IL-2-deprived TIL cultures was significantly higher in patients that showed an objective clinical response to cell transfer (p = 0.004 and p = 0.01, respectively; n = 33) (Table III). Neither the total number of infused T cells nor CD8+ T cells differed significantly between responders and nonresponders (Table III), and no significant differences were observed between the expression of the costimulatory molecule CD28 and its corresponding ligand CD80 in the same TIL samples (data not shown). These observations suggest that analysis of the expression of CD27 and CD70 may be useful for the selection of effective TILs for use in adoptive immunotherapy.
|
|
| Discussion |
|---|
|
|
|---|
-chain, result from cooperative signals mediated both through the T cell Ag receptor as well as through the IL-2R itself; however, the relative role of signals delivered through these pathways has not been fully elucidated. Human tumor-reactive effector T cells have been shown to proliferate extensively in vitro in the presence of high-dose IL-2 alone (33). In addition, between 15 and 20% of melanoma and renal cancer patients treated with high-dose IL-2 alone respond to therapy (6), which may reflect the ability of IL-2 to maintain the proliferation of T cells that were activated by prior exposure to tumor Ags.
Interactions between the costimulatory receptor CD27 and its ligand, CD70, have also been found to play a key role in T lymphocyte activation, proliferation, survival, and differentiation (10, 11, 12, 13). The intracytoplasmic domain of CD27 triggered by CD70 mediates these effects through activation of Jun kinase and NF-
B, which is required for optimal effector/memory CD8 T cell generation (34).
This study explores the effects of IL-2 on the expression of CD70 and its receptor, CD27, on CD8+ T cells, as well as the role of stimulation mediated through the CD27 pathway in regulating the proliferation and function of effector T cells. Incubation of PBMCs with IL-2 in vitro resulted in the up-regulation of CD70 expression on CD8+ cells and down-regulation of CD27 expression. This outcome did not appear to result from the selective death of CD27+ T cells, as significant levels of apoptosis were not observed in the CD27+ T cells that were present in these cultures (data not shown). Cells that possess a similar phenotype were observed in vivo in patients receiving high-dose IL-2 therapy at the time when IL-2 is present at detectable levels in peripheral blood. Expression of IL-2R
(CD25) was not detected on CD8+ T cells before the up-regulation of CD70; thus, it appears that relatively high concentrations of IL-2 can up-regulate CD70 expression by signaling through the intermediate affinity IL-2R
receptor, which has previously been shown to activate T cells (35, 36, 37).
Previous investigations demonstrated that CD27 expression is down-regulated on the surface of activated T cells following interaction with CD70. In CD70 transgenic mice that constitutively express CD70 on B cells, CD27 was down-regulated because of the continuous interaction of CD70 with CD27+CD8+ T cells (10). In another report, the incubation of CD8+ T cell with anti-CD70 Ab interfered with the down-regulation of CD27 that was normally observed following Ag activation (11). The results of the present study suggest that down-regulation of CD27 expression on CD8+ T cells from peripheral blood following incubation with IL-2 may have resulted from interactions with CD70 expressed on T cells, which was associated with the acquisition of effector functions on those cells. This hypothesis was supported by the observation that the withdrawal of IL-2 from activated effector CD8+ T cells was associated with the up-regulation of CD27 and the down-regulation of CD70 expression. A similar phenotypic change was observed on CD8+ T cells present in the peripheral blood of IL-2-treated patients soon after the termination of IL-2 administration.
Additional experiments were then conducted to evaluate the nature of the interaction of CD27 with CD70 expressed on CD8+ T cells. The incubation of in vitro cultured effector CD8+ T cells that expressed CD70 with an anti-CD70 blocking Ab significantly inhibited the proliferation of these cells, even in the presence of high-dose IL-2, but did not alter the expression of markers such as CD25 (data not shown). These findings suggest that this Ab interfered with delivery of a signal through the CD27 molecule rather than delivering a direct signal by the cross-linking of CD70 molecules on the surface of T cells. Studies conducted on PBMCs that were cultured in vitro with IL-2 indicated that the subset of CD70+ cells that bound to rhIL-2F proliferated more extensively than cells that failed to bind to the rhIL-2F. The population of CD70+CD8+ T cells that bound high levels of IL-2 also appeared to selectively down-regulate CD27 expression (data not shown), indicating that the delivery of a strong signal through the IL-2 receptor may play an important role in the down-regulation of CD27 expression by CD70. These observations suggest that engagement of CD27 by CD70 molecules expressed on T cells represents a down-stream mediator of the activation of T cells by IL-2.
The expression of CD27 was then examined on TILs that were adoptively transferred to patients, as this might provide an indication of the size of the effector/memory pool in these polyclonal populations of cells. Previous studies had demonstrated that the differentiation of T cells to end stage effector cells was associated with stable down-regulation of CD27 expression (14, 15, 16, 17). The fact that IL-2, as well as TCR activation, transiently down-regulated CD27 expression on TILs hampered evaluation of the stage of differentiation of cells present in these polyclonal populations. However, the withdrawal of IL-2 from in vitro TIL cultures that had been grown continuously in the presence of IL-2 resulted in up-regulation of the expression of CD27 on a variable percentage of the T cells present in these cultures. The percentage of T cells that up-regulated CD27 expression varied widely between TILs, and for some cultures little or no up-regulation was observed. The minimal levels of CD27 expression that were observed on some TILs following IL-2 withdrawal may have resulted from the large percentages of end stage effector T cells present in these cultures.
Additional studies were then conducted to evaluate the properties of CD27+CD8+ T cell present within TILs. When TILs were cultured for 2 days in vitro in the absence of IL-2, CD27+CD8+ T cells proliferated to a greater extent than CD27CD8+ T cells. Previous studies have demonstrated that central memory cells possess an enhanced ability to secrete IL-2 (38), and results presented in this study demonstrate that CD27+CD8+ cells secreted higher levels of IL-2 than CD27CD8+ cells following Ag activation. These factors may help to account for the selective ability of CD27+CD8+ T cells to survive in vivo following adoptive transfer under conditions where common
-chain cytokines such as IL-2 are limiting (17, 39). In this study, several genes that are selectively expressed in proliferating cells (29, 30) were up-regulated selectively in CD27+CD8+ T cells isolated from TILs. In contrast, the most highly expressed genes that were selectively up-regulated in CD27CD8+ T cells included several genes involved with T cell activation and apoptosis, characteristics that have been associated with late stage effector T cells.
The potential relevance of these findings to clinical observations was then evaluated. Previous studies (31) suggested that the persistence of adoptively transferred T cells was associated with their proliferative capacity as well as with their ability to mediate tumor regression. Examination of individual clonotypes present within bulk TILs that persisted in patients peripheral blood following cell transfer revealed that these cells, when cultured before transfer in the absence of IL-2 for 2 days, expressed higher levels of CD27 than clonotypes that did not persist. An evaluation of the bulk TILs obtained from 33 patients treated with TILs following nonmyeloablative chemotherapy, including 16 responders and 17 nonresponders, demonstrated that the mean of total number of CD27+CD8+ T cells present in the TILs that were administered to responders were significantly higher than those administered to nonresponders. The expression of CD70 on cells cultured before transfer in the absence of IL-2 for 2 days also appeared to be significantly higher in TILs that were administered to responders than to nonresponders, implying that the pool of activated memory/effector cells present in TILs that were administered to responders was larger than in TILs that were administered to nonresponders. The expression of CD70 in vivo on other cells, such as B cells and dendritic cells that are present in patients that received adoptive TIL transfer, may also act to costimulate T cells that express CD27. The expression of CD70 on the transferred T cells alone, however, may provide a sufficient signal to promote the in vivo survival and proliferation of transferred CD8+ cells that are also capable of expressing CD27, as suggested by the in vitro studies presented in this report as well as by additional studies (40). In addition, in mouse model systems the expression of CD27 appeared to be associated with T cell accumulation at tissue effector sites and the survival of activated CD8+ T cells in vivo, whereas expression of CD28 was not associated with T cell migration (41). It is difficult to determine the relative roles of CD27 and CD70 expression in mediating the function of adoptively transferred T cells, but the expression of both the costimulatory receptor and ligand on T cells may enhance the in vivo function of these cells. These observations provide potential explanations for the association between CD27 expression in TILs and patient response to adoptive immunotherapy.
In summary, IL-2 is a crucial cytokine that modulates CD8+ T cell responses in immunotherapy. Our results suggested that IL-2 may function, at least in part, by promoting CD8+ T cell effector function through the interaction of CD27 with CD70. In addition, evaluation of the pool of T cells present in patients TILs that express CD27 and CD70 may facilitate the identification of effective TILs for use in patient treatment.
| Acknowledgments |
|---|
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This research was supported by the Intramural Research Program of the National Institutes of Health, National Cancer Institute, Center for Cancer Research. ![]()
2 Address correspondence and reprint requests to Dr. Paul F. Robbins, Surgery Branch, National Cancer Institute, National Institutes of Health, Building 10, Room 2B42, 10 Center Drive, Bethesda, MD 20892. E-mail address: paul_robbins{at}nih.gov ![]()
3 Abbreviations used in this paper: TIL, tumor infiltrating lymphocyte; rhIL-2F, recombinant human IL-2 Fluorokine. ![]()
Received for publication December 29, 2005. Accepted for publication March 16, 2006.
| References |
|---|
|
|
|---|
,
, and
c receptors. Science 310: 1159-1163.
B activation pathways by NF-
B-inducing kinase. Immunity 21: 477-489. [Medline]
chain of the interleukin-2 receptor. Proc. Natl. Acad. Sci. USA 94: 3168-3171. This article has been cited by other articles:
![]() |
M. Hashimoto-Okada, T. Kitawaki, N. Kadowaki, S. Iwata, C. Morimoto, T. Hori, and T. Uchiyama The CD70-CD27 interaction during the stimulation with dendritic cells promotes naive CD4+ T cells to develop into T cells producing a broad array of immunostimulatory cytokines in humans Int. Immunol., June 25, 2009; (2009) dxp056v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. MARKEL, T. COHEN-SINAI, M. J. BESSER, K. OVED, O. ITZHAKI, R. SEIDMAN, A. J. TREVES, E. FRIDMAN, Y. KEISARI, Z. DOTAN, et al. Preclinical Evaluation of Adoptive Cell Therapy for Patients with Metastatic Renal Cell Carcinoma Anticancer Res, January 1, 2009; 29(1): 145 - 154. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Dudley and S. A. Rosenberg Clinical Trials Investigating Adoptive Cell Therapy Combined with Lymphodepletion for Patients with Advanced Cancer ASCO Educational Book, January 1, 2009; 2009(1): 516 - 520. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Ansen, M. O. Butler, A. Berezovskaya, A. P. Murray, K. Stevenson, L. M. Nadler, and N. Hirano Dissociation of Its Opposing Immunologic Effects Is Critical for the Optimization of Antitumor CD8+ T-Cell Responses Induced by Interleukin 21 Clin. Cancer Res., October 1, 2008; 14(19): 6125 - 6136. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Huarte, J. R. Cubillos-Ruiz, Y. C. Nesbeth, U. K. Scarlett, D. G. Martinez, X. A. Engle, W. F. Rigby, P. A. Pioli, P. M. Guyre, and J. R. Conejo-Garcia PILAR is a novel modulator of human T-cell expansion Blood, August 15, 2008; 112(4): 1259 - 1268. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-S. Cummings, C. Cairo, C. Armstrong, C. E. Davis, and C. D. Pauza Impacts of HIV infection on V{gamma}2V{delta}2 T cell phenotype and function: a mechanism for reduced tumor immunity in AIDS J. Leukoc. Biol., August 1, 2008; 84(2): 371 - 379. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. S. Hinrichs, R. Spolski, C. M. Paulos, L. Gattinoni, K. W. Kerstann, D. C. Palmer, C. A. Klebanoff, S. A. Rosenberg, W. J. Leonard, and N. P. Restifo IL-2 and IL-21 confer opposing differentiation programs to CD8+ T cells for adoptive immunotherapy Blood, June 1, 2008; 111(11): 5326 - 5333. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Coccoris, E. Swart, M. A. de Witte, J. W. J. van Heijst, J. B. A. G. Haanen, K. Schepers, and T. N. M. Schumacher Long-Term Functionality of TCR-Transduced T Cells In Vivo J. Immunol., May 15, 2008; 180(10): 6536 - 6543. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Hwang, J. R. Lukens, and T. N. J. Bullock Cognate Memory CD4+ T Cells Generated with Dendritic Cell Priming Influence the Expansion, Trafficking, and Differentiation of Secondary CD8+ T Cells and Enhance Tumor Control J. Immunol., November 1, 2007; 179(9): 5829 - 5838. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |