The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Minns, L. A.
Right arrow Articles by Kasper, L. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Minns, L. A.
Right arrow Articles by Kasper, L. H.
The Journal of Immunology, 2006, 176: 7589-7597.
Copyright © 2006 by The American Association of Immunologists

TLR9 Is Required for the Gut-Associated Lymphoid Tissue Response following Oral Infection of Toxoplasma gondii

Laurie A. Minns*, Laurence C. Menard*, David M. Foureau*, Sylvie Darche{dagger}, Catherine Ronet{ddagger}, Daniel W. Mielcarz*, Dominique Buzoni-Gatel2,{dagger} and Lloyd H. Kasper1,2,*

* Department of Medicine and Department of Microbiology and Immunology, Dartmouth Medical School, Lebanon, NH 03756; {dagger} Department of Parasitology, Unit of Early Responses to Intracellular Parasites and Immunopathology, Institut Pasteur-INRA, Paris, France; and {ddagger} World Health Organization- Immunology Research and Training Center, Department of Biochemistry, University of Lausanne, Epalinges, Switzerland


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
TLRs expressed by a variety of cells, including epithelial cells, B cells, and dendritic cells, are important initiators of the immune response following stimulation with various microbial products. Several of the TLRs require the adaptor protein, MyD88, which is an important mediator for the immune response following Toxoplasma gondii infection. Previously, TLR9-mediated innate immune responses were predominantly associated with ligation of unmethylated bacterial CpG DNA. In this study, we show that TLR9 is required for the Th1-type inflammatory response that ensues following oral infection with T. gondii. After oral infection with T. gondii, susceptible wild-type (WT; C57BL/6) but not TLR9–/– (B6 background) mice develop a Th1-dependent acute lethal ileitis; TLR9–/– mice have higher parasite burdens than control WT mice, consistent with depressed IFN-{gamma}-dependent parasite killing. A reduction in the total T cell and IFN-{gamma}-producing T cell frequencies was observed in the lamina propria of the TLR9–/– parasite-infected mice. TLR9 and type I IFN production was observed by cells from infected intestines in WT mice. TLR9 expression by dendritic cell populations is essential for their expansion in the mesenteric lymph nodes of infected mice. Infection of chimeric mice deleted of TLR9 in either the hemopoietic or nonhemopoietic compartments demonstrated that TLR9 expression by cells from both compartments is important for efficient T cell responses to oral infection. These observations demonstrate that TLR9 mediates the innate response to oral parasite infection and is involved in the development of an effective Th1-type immune response.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Innate immunity provides the first line of defense against invading pathogens and is essential for survival in the absence of adaptive immune responses. Innate immune recognition relies on a limited number of germline-encoded receptors, such as TLRs, that recognize pathogen-associated molecular patterns of microbial origin (1, 2, 3, 4, 5, 6). To date, 13 members of the TLR family have been characterized in mice. Although TLRs are expressed in a broad range of tissues, the greatest variety of TLR mRNAs is found in professional APCs. A key role of TLRs in innate immunity is the development of the acquired immune response characterized by polarization of naive CD4+ helper T cells toward the Th type I (Th1) or Th2 phenotype.

The classically defined ligand for TLR9, bacterial unmethylated CpG DNA, has an immunomodulatory effect at the cellular level, and TLR9–/– mice are unresponsive to immunostimulatory CpG DNA (7, 8, 9). Human TLR9-conferred responsiveness to CpG-DNA occurs via the recognition of species-specific CpG motifs (10). The engagement of CpG DNA with TLR9 results in the activation of a wide range of transcription factors (i.e., NF-{kappa}B, AP-1, or IFN regulatory factor-7) by MyD88-dependent signaling pathways that ultimately leads to the expression of Th1 proinflammatory cytokines such as IL-12 and type I IFNs (11, 12). Whereas TLR1, TLR2, and TLR4 are cell surface expressed, current opinion is that TLR9 has a predominantly intracellular localization in macrophages and dendritic cells (DC),3 an advantageous position for the recognition of intracellular pathogens (13).

Recent observations indicate that DNA is not the only ligand for TLR9. Plasmodium falciparum blood stage schizonts, soluble schizont extracts, and, most recently, hemozoin pigment activate plasmacytoid DCs and use the TLR9-MyD88 signaling pathway, indicating that TLR9 plays an essential role in recognizing Apicomplexa infections (14, 15).

Oral infection with Toxoplasma gondii in certain strains of mice (C57BL/6) leads to an acute lethal ileitis within 7 days of infection. This experimental model of inflammatory bowel disease is similar to human ileitis with regard to disease localization, histological findings, and immunologic imbalance (16). The death is not related to an uncontrolled parasite replication but is due to an overwhelming Th1-like immune response. CD4 T cells from the lamina propria secrete huge quantities of IFN-{gamma} and TNF-{alpha} that are responsible for the inflammatory process (17). Mice genetically incapable of producing IFN-{gamma} do not develop the lethal ileitis despite a high parasite replication. Indeed the Th1-like immune response, although deleterious if uncontrolled, is necessary to limit parasite replication.

Defective APC responses were observed in MyD88–/– macrophages, neutrophils, and splenic DCs exposed to soluble T. gondii Ag, indicating the essential role of a MyD88-dependent TLR in responding to T. gondii infection (18). Additional reports show intact APC responses in TLR2- and TLR4-deficient mice, suggesting that neither of these MyD88-dependent TLRs are involved in systemic immune responses to T. gondii infection (19). Studies with TLR11 knockout (KO) mice demonstrate that after systemic infection with T. gondii, these mice have a persistently elevated serum titer of both IL-12 and IFN-{gamma}, implying that other TLR pathways are involved in the host innate response to this parasite (20). Taken together, these observations indicate that T. gondii infection triggers an immune response that signals through a MyD88-dependent TLR, which may work independently or in concert with TLR11. In this study, we show for the first time that TLR9 expression by APCs from the hemopoietic and nonhemopoietic compartments is essential for initiating the innate immune response following oral infection with T. gondii and that TLR9 is required for an efficient T cell response in the small intestine.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Mice and parasites

Female 6- to 8-wk-old C57BL/6 mice (wild-type; WT) obtained from The Jackson Laboratory and TLR9–/– mice backcrossed onto a C57BL/6 background (provided by S. Akira, Department of Host Defense, Osaka University, Osaka, Japan; Ref. 9) were bred and housed under approved conditions at the Animal Research Facility at Dartmouth Medical School or at the Institut Pasteur (Paris, France). Bone marrow (BM) chimeric mice were engineered in which only the hemopoietic system or the nonhemopoietic system was impaired for the TLR9 expression. Recipient WT or TLR9–/– mice were lethally irradiated (900 rad) with a Ce137 source. Then, they received i.v. BM cells (1 x 107) recovered from femurs and tibias of donor WT or TLR9–/– mice. The quality of the reconstitution was appreciated 7 wk later by bleeding the chimeric mice and checking by quantitative RT-PCR for TLR9 expression among the blood cells. The chimeric mice were used 7 wk after reconstitution. Mice were infected orally by intragastric gavage with 35 cysts of the 76K T. gondii strain maintained through passage in CBA/J mice. After infection, mice were weighed and mortality was recorded daily. All experiments were performed with 4–6 mice/group and were repeated a minimum of three times; error bars represent the SEM, unless specified otherwise.

Histology

Intestines were immediately fixed in 10% formalin overnight, embedded in paraffin, and sectioned. Sections were stained with H&E and photographed. Histological inflammatory score from 0 to 4 was applied in a blinded fashion as described previously (21): 0, no inflammation; 1, slight infiltrating lymphocytes in the lamina propria with focal acute infiltration; 2, mild infiltrating cells in the lamina propria with increased blood flow and mild edema; 3, diffuse and massive infiltrating cells leading to disturbed mucosal architecture; 4, crypt abscess and superficial necrosis of the intestinal villi.

Purification of intestinal epithelial cells (IEC)

Small intestines were washed with PBS, and Peyer’s patches were removed. Intestines were opened longitudinally and cut into 1-cm long samples. The pieces were incubated in PBS (Ca/Mg free)-EDTA 3 mM under agitation (10 min, 37°C), and the supernatants containing the IECs were collected and washed in RPMI 1640 with 5% FBS. This process was repeated twice. Dithioerythritol was then added to the cells (1.6 mg/10 ml). After incubation (15 min, 37°C), cells were washed twice. Purified IECs were collected at the interface of a Percoll gradient of 60–30% (30 min, 1500 rpm) and washed with RPMI 1640 before use.

Mesenteric lymph node (MLN) DC suspension

DC suspensions from mice were performed as described previously (22). Briefly, MLNs and spleens were collected from mice, excess fat removed, and digested in 1.67 Wunsch U/ml Liberase Cl (Roche, Boehringer Mannheim) and 0.2 mg/ml DNaseI (Sigma-Aldrich) in RPMI 1640 to form a single-cell suspension. Cells were then resuspended in RPMI 1640 10% FBS for further analysis.

Purification of lamina propria lymphocytes (LPL)

LPLs were purified as described previously (23). Briefly, fat and Peyer’s patches were removed from small intestines that were washed twice with PBS. Small intestines were opened longitudinally, cut into 1-cm pieces, and washed twice in 3 mM EDTA in Ca/Mg-free PBS for 10 min at 37°C. Intestine pieces were then washed twice in 1 mM EGTA, 1.5 mM MgCl in RPMI 1640 1% FBS for 10 min at 37°C. Intestine pieces were then digested in Liberase (Roche) 0.14 Wursch U/ml and DNase I (Sigma-Aldrich) at 5 U/ml in RPMI 1640 at 37°C for up to 1 h. Cell suspensions were washed twice in RPMI 1640 10% FBS then laid over Histopaque (density = 1.077) and centrifuged. Cells in the interphase were collected, washed, and used for further assays.

Cell surface fluorescent-activated cell analysis

Single-cell suspensions of typically 1 x 106 cells were stained using conventional methods in PBS 2% FBS with Fc Block (BD Pharmingen) using the following Abs: CD3FITC, CD3APC, CD4FITC, CD4APC, CD45RBPE, CD8betaPE, CD8{alpha}PerCP, CD11cFITC, CD11cAPC, Gr-1PE, MHC class II PE, CD11bPE, B220APC, CD80FITC, CD86FITC, the appropriate isotype controls (BD Pharmingen), and mPDCA (Miltenyi Biotec); cells were analyzed for four-color staining on a BD FACSCalibur (BD Biosciences). Gating for analysis was determined using the appropriate isotype control.

Intracellular cytokine staining

Single-cell suspensions from the LPL or MLN were restimulated ex vivo with 50 ng/ml PMA (Sigma-Aldrich) and 500 ng/ml ionomycin (Sigma-Aldrich) for 2 h in RPMI 1640 10% FBS at 37°C followed by treatment with 10 µg/ml Brefeldin A (Sigma-Aldrich) for 2 h at 37°C. Following surface marker staining using conventional methods, cells were permeabilized using the BD Cytofix/Cytoperm kit (BD Pharmingen) and stained intracellularly with IFN-{gamma} allophycocyanin or IFN-{gamma}PE (BD Pharmingen).

Two-step SYBR green quantitative real-time PCR

A total of 0.5 µg to 2.0 µg (within each experiment, the same quantity of mRNA was used) of QIAgen RNeasy-purified (Qiagen) mRNA was reverse transcribed using SuperScript II RT (Invitrogen Life Technologies). A total of 200 ng of cDNA was amplified using the SYBR green Core reagents or the x2 SYBR green mix (Applied Biosystems) on a Bio-Rad iCycler. Relative expression was normalized to beta-actin and was expressed using the {Delta}CT method, where relative expression = 2–(exp –actin) *1000. The following primers were used: beta-actin, forward AGAGGGAAATCGTGCGTGAC and reverse CAATAGTGATGACCTGGCCGT; IFN-{gamma}, forward TCAAGTGGCATAGATGTGGAAGAA and reverse TGGCTCTGCAGGATTTTCATG (24); TNF-{alpha}, forward CATCTTCTCAAAATTCGAGTGACAA and reverse TGGGAGTAGACAAGGTACAACCC (24); IFN-beta, forward CCATCCAAGAGATGCTCCAG and reverse GTGGAGAGC AGTTGAGGACA (25); and TLR9, forward AGGCTGTCAATGGCTCTCAGTT and reverse TGAACGATTTCCAGTGGTACAAGT (26). For T. gondii parasite burden, the T. gondii B1 gene was amplified from 1 µg of total genomic DNA prepared using the DNeasy kit (Qiagen), and a standard curve for parasite equivalents was generated using a plasmid as described previously: QB1, forward GGAACTGCATCCGTTCATGAG and reverse TCTTTAAAGCGTTCGTGGTC (27).

Statistical analyses

Groups were compared using Prism Statistical Software’s unpaired t test; significance was expressed as p < 0.05 (*), p < 0.01 (**), or p < 0.001 (***).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
TLR9–/– mice are resistant to the ileitis following oral infection with T. gondii

We have reported previously that C57BL/6 mice die within 10 days following oral infection with T. gondii. These mice die of an acute ileitis that is associated with the complete, transmural destruction of the epithelial barrier. The entire ileum of the infected mice is disrupted with sparing of the colon. Microscopically, inflammation associated with large numbers of infiltrating cells and hemorrhages into the small intestine is observed. Histological examination of the small intestine from TLR9–/–-infected mice revealed the absence of inflammatory signs and showed intact integrity of the epithelial barrier similar to that of uninfected control mice (Fig. 1A). Histological scorings of ileum sections from infected mice revealed a significant (p < 0.001) reduction in inflammation (Fig. 1B) as compared with the WT mice. Additionally, TLR9–/– mice had a significantly lower weight loss at day 8 (p < 0.001) and 100% survival by day 15 postinfection compared with the WT-infected controls that had rapid weight loss and succumbed to the inflammation brought on by the infection by day 9. TLR9–/– mice failed to develop ileitis through the completion of these studies, indicating a reduced capacity to mount an inflammatory response following infection (Fig. 1C). To confirm that the absence of inflammation in TLR9–/– mice was not due to decreased infectivity of the mice, parasite burden was assessed using real-time quantitative PCR. TLR9–/– mice had higher parasite burden in the intestine and spleen compared with the WT controls at day 3 postinfection (Fig. 1D) that continued until the WT controls succumbed to the inflammation (data not shown).


Figure 1
View larger version (112K):
[in this window]
[in a new window]
 
FIGURE 1. TLR9–/– mice are resistant to T. gondii-induced ileitis and exhibit higher parasite burdens compared with WT controls. WT (C57BL/6) and TLR9–/– mice were orally infected with 35 cysts of T. gondii, and histological evidence of inflammation was noted at day 7 postinfection. Histological analysis of day 7 postinfection small intestines from TLR9–/– mice showed an absence of inflammation following oral infection with T. gondii (A). Histological scoring revealed a significant decrease in intestinal inflammation in TLR9–/– mice compared with WT controls (B). Following oral infection with 35 T. gondii cysts, TLR9–/– mice were resistant to T. gondii-induced weight loss compared with WT controls; {tau}, 100% mortality at day 9 in WT mice compared with {zeta}, 100% survival at day 15 in TLR9–/– mice (C). Parasite burden as determined by quantitative real-time PCR of the T. gondii B1 gene measured at day 3 postinfection was significantly higher in TLR9–/– mice in the gut and spleen compared with WT controls (D). Data shown are one representative experiment of three independent experiments with at least 5 mice/group.

 
TLR9–/– mice have reduced T cell responses in the lamina propria and impaired Th1 cytokine responses in the small intestine

To characterize the immune response in the small intestines of TLR9–/– mice following oral infection with T. gondii, cytokine mRNA levels were compared using quantitative real-time PCR. TNF-{alpha} levels appeared reduced at days 3 and 7 postinfection; however, the reduction was not significant (Fig. 2A). There was a significant difference in IFN-{gamma} mRNA expression, the hallmark of the Th1-like immune response at day 7 postinfection (p < 0.01) between the WT and TLR9–/– mice (Fig. 2B).


Figure 2
View larger version (45K):
[in this window]
[in a new window]
 
FIGURE 2. Infected TLR9–/– mice have a decreased Th1 response in the small intestine and in the lamina propria. WT and TLR9–/– mice were orally infected with 35 T. gondii cysts, and intestines were measured at day 3 and day 7 postinfection for inflammatory cytokines. SYBR green quantitative real-time PCR of small intestines from infected mice showed a reduction in TNF-{alpha} mRNA and a significant decrease in IFN-{gamma} mRNA (day 7), measured at days 3 and 7 postinfection (A and B). Lymphocytes from the lamina propria were isolated, and the frequency of CD3+CD8+ T cells and CD3+CD4+ T cells were determined by FACS analysis (lamina propria preparations from six mice with three pooled intestines stained and measured three times per independent experiment). An overall increase of CD3+CD4+ cells was observed at day 7 compared with naive controls (day 0) and day 3 postinfection (C). A significant decrease in the CD3+CD4+ population in the lamina propria of TLR9–/– mice was observed at day 7 postinfection compared with the WT controls (C). Cells purified from the lamina propria were restimulated ex vivo with PMA and ionomycin and stained intracellularly with IFN-{gamma}. Following restimulation, TLR9–/– mice displayed a 2-fold reduction of IFN-{gamma}-producing T cells (D), compared with WT controls. Data shown are representative of three independent experiments with 4–6 mice/group

 
To determine whether T cell responses were altered as a result of the TLR9 deletion following oral infection with T. gondii, the frequency of CD3+CD4+ and CD3+CD8+ T cells from the lamina propria was measured by FACS analysis. As expected, by day 7 postinfection there was a significant increase of CD3+CD4+ T cells in the lamina propria of both WT and TLR9–/– mice compared with days 0 and 3 (Fig. 2C). Although there was an overall increase in CD4+ T cells in the lamina propria, TLR9–/– mice exhibited a reduced frequency of CD3+CD4+ T cells compared with the WT controls at day 7 (p < 0.001). Moreover, there was an overall decrease in the percentage of IFN-{gamma}-producing T cells in the lamina propria by both the CD8+ population as well as CD4+ by day 7 postinfection (Fig. 2D). There was no demonstrable change in either IL-4 or IL-10 expression (both by intracellular FACS analysis of cells from the lamina propria and by quantitative real-time PCR of infected small intestines), confirming that the decrease in Th1 cytokine production was not associated with a Th2 shift (data not shown). Analysis of the CD4+CD25+CD45RBlow population in the lamina propria and the MLNs failed to demonstrate a shift in the CD45RBlow T cell population from TLR9–/– mice as compared with control mice (data not shown). These data as well as the observed decrease in total small intestine mRNA for IFN-{gamma} in TLR9–/– mice is consistent with a depressed Th1 type inflammatory response in TLR9–/– mice following oral infection with T. gondii.

TLR9 and type I IFN-beta are expressed in the small intestine by IECs and by cells from the lamina propria in response to T. gondii infection

The small intestine constantly samples a variety of microbial and food Ags. TLR9 is expressed by nonprofessional APC such as epithelial cells (28), and more specifically by the IECs (29). In addition to TLR9 mRNA levels, previous studies have shown that TLR9 engagement can be measured in terms of type I IFN expression (14, 30, 31). Exposure to type I IFNs ({alpha} or beta) results in the phenotypic maturation of DCs (32). Quantitative real-time PCR was performed for IFN-beta and TLR9 to determine their expression level over the course of infection. At early time points, such as 12 h postinfection, elevated mRNA for TLR9 and IFN-beta was observed in the small intestine; TLR9 and IFN-beta mRNA appeared to peak at day 3 postinfection in this oral infection model (Fig. 3A). IECs isolated from mice at serial time points postinfection expressed a basal level of TLR9 and IFN-beta before dropping between 24 h and 3 days postinfection (Fig. 3B). The peak of TLR9 and IFN-beta was again observed at day 4 postinfection. A cyclic pattern in the kinetics of TLR9 expression was also observed from cells in the lamina propria (Fig. 3C). These results are consistent with successive stages of the parasite life cycle of invasion/replication/release followed by reinvasion of host cells.


Figure 3
View larger version (18K):
[in this window]
[in a new window]
 
FIGURE 3. TLR9 and IFN-beta mRNA are expressed by cells from the small intestine and specifically by IECs and cells from the lamina propria following T. gondii infection. WT mice were orally infected with 35 T. gondii cysts; representative sections of intestines, purified IECs, and lamina propria cells were assayed for TLR9 and IFN-beta production. TLR9 and IFN-beta mRNA were expressed by cells from the small intestines as early as 12 h postinfection, then peaked again at day 3 postinfection (A) as evidenced by SYBR green real-time PCR. Ex vivo-purified IECs exhibited a similar kinetic pattern of TLR9 and IFN-beta production (B). Similarly, cells from the lamina propria displayed significantly increased TLR9 and IFN-beta mRNA expression beginning at 12 h postinfection, peaking at 24 h, then cycling again as seen in the other panels (C). Data are representative of two independent experiments with 4 mice/group.

 
DC populations in the MLNs of TLR9–/– mice are reduced compared with B6 mice after infection

The decrease of the inflammatory response in TLR9–/– mice might result from a reduced capacity of DCs to help with the induction of a Th1-like immune response. Because DCs are essential for the switch of the immune response toward a Th1 or Th2 profile, they were more thoroughly examined. TLR9 is expressed by a wide variety of APCs including DCs.

Gut-associated lymphoid tissue (GALT) DCs are distinct from peripheral DCs in terms of subset representation, phenotype, and function (33, 34, 35, 36, 37); MLN DCs can be characterized based on their expression of CD11c and CD8{alpha}. Previous studies have shown that MLN plasmacytoid-like DC can be CD11clow, CD8{alpha}+, B220+, GR-1+, class IIlow, CD80low, and CD86low (34). Separate studies suggest that CD11c+CD8{alpha}+intCD11b+ cells could also be considered plasmacytoid DC (33). MLN CD11c+ CD8{alpha}- DCs can be either nonplasmacytoid or myeloid DCs (36). mPDCA is expressed on peripheral plasmacytoid DCs (38); its expression on GALT DCs had not been described previously. In humans, only plasmacytoid DCs are known to express TLR9, whereas myeloid, plasmacytoid, and conventional DC (pDC) subsets (CD11c+) express TLR9 in mice (8) (39).

Four populations of MLN DCs were analyzed, CD11chighCD8{alpha}+/– (CD11chigh), CD8{alpha}CD11clow (CD8{alpha}- DCs), CD8{alpha}intCD11clow (CD8{alpha}int), and CD8{alpha}highCD11clow (CD8{alpha}high) (Fig. 4A). These subsets were phenotyped for the expression of B220, CD11b, GR-1, mPDCA, MHC class II, CD80, and CD86 (Fig. 4B). Both naive B6 and TLR9–/– mice had similar DC populations in terms of frequency (Fig. 4A) and phenotype (Fig. 4B). The CD11chigh cells are only present under naive conditions in both WT and TLR9–/– mice; these data correlate with previously published work (34). Phenotypically, these cells are B220+/–, CD11blow, GR-1+, mPDCA, MHC class IIhigh, and CD80/CD86+ (Fig. 4B), indicative of a nonplasmacytoid mature DC. The CD8{alpha}- DCs from naive mice are predominantly B220high, CD11blow, GR-1+, mPDCA, MHC class IIhigh, CD80, and CD86+, suggesting a mature nonplasmacytoid or possibly a myeloid-like DC population. Naive CD8{alpha}int DCs had variable expression of B220 and GR-1, mPDCA+, CD11bhigh, MHC class IIint, CD80, and CD86+, suggestive of pDCs. Naive CD8{alpha}high DCs were B220low, mostly CD11blow, GR-1int, mPDCAlow, MHC class IIlow, CD80, and CD86+, also suggestive of a pDC population.


Figure 4
View larger version (76K):
[in this window]
[in a new window]
 
FIGURE 4. DC populations in the MLN expand following oral infection. WT or TLR9–/– mice were orally infected with T. gondii. Cells from the MLN (pooled from 4 mice/group) were isolated and stained for FACS analysis. Live low-density and mid-density cells were gated for analysis of CD11c and CD8{alpha} expression (A). Oral infection results in an overall increase of all DC populations in WT and TLR9–/– mice; however, WT mice have a more robust increase in DC populations, especially the CD8{alpha}int population (A). DCs were further gated on CD11chigh+ (present only in naive conditions), CD8{alpha}CD11c+, CD8{alpha}intD11clow, and CD8{alpha}highCD11clow populations for subsequent phenotypic analysis of B220, CD11b, GR-1, mPDCA, MHC class II, CD80 and CD86 (B). Naive DC populations in the TLR9–/– and WT mice were similar in terms of subset representation as well as phenotype (A and B). After infection, all DC populations had an increase in costimulatory molecules, CD80 and CD86 (B). The CD8{alpha}int cells from WT mice differed from the CD8{alpha}int cells from TLR9–/– mice; in WT mice, these cells were B220high, CD11bhigh, GR-1, mPDCA+, MHC class IIlow, CD80+, CD86+; in TLR9–/– mice, these cells were B220high, CD11bhigh, Gr-1+, mPDCA+, MHC class IIint, CD80+, CD86+ (B). Isotype control, dotted lines, WT mice; gray filled, TLR9–/– mice: black lines. Plots represent one of at least three independent experiments. Five hundred thousand live events were counted for each sample.

 
MLNs from infected WT mice showed higher frequencies of all DC populations compared with the infected TLR9–/– mice (Fig. 4A). Of the DCs from infected mice, the most striking increase was in the CD8{alpha}int population in the B6 mice; these cells were B220int, CD11bhigh, GR-1, mPDCA+, MHC class IIlow, suggesting an expansion or migration of a different set of DCs than were present before infection. This population differs significantly from the CD8{alpha}int cells from the TLR9–/– mice that expressed B220high, mPDCAhigh, and MHC class IIhigh (Fig. 4B), similar to the CD8{alpha}int DCs present in naive mice. These results suggest that this subset of DCs may require TLR9 for their expansion and/or migration into the MLN of parasite-infected mice. In both WT and TLR9–/– mice, after infection the CD11clow subsets expressed mPDCA and expression of costimulatory molecules CD80 and CD86 (Fig. 4B) and a modest increase in IL-12(p40/p70) expression (data not shown). Both intracellular and extracellular TLR9 were detected in B6 mice on DCs from the MLN (data not shown).

TLR9 expressed by the cells from both the hemopoietic and nonhemopoietic compartments is essential for the immune response following oral infection of T. gondii

TLR9 chimeric mice were generated to identify whether nonhemopoietic cells, such as epithelial cells, or the hemopoietic cells were responsible for initiating the T cell response following oral infection with T. gondii. Our studies focused on the CD4+ T cells from the lamina propria because we showed in this study as well as previously (17, 40, 41), that these CD4+ T cells infiltrated the lamina propria and produced copious amounts of IFN-{gamma} following oral infection. We observed a reduced frequency of IFN-{gamma}-producing CD4+ cells from the lamina propria in irradiated WT mice that were reconstituted with BM from TLR9–/– mice (Fig. 5A) (the nonhemopoietic cells from these TLR9–/–, whereas the hemopoietic cells are TLR9–/–). These results were similar to the observed reduction of IFN-{gamma}-producing CD4+ in TLR9–/– mice (Fig. 5A). In chimeric mice where the nonhemopoietic system contained a TLR9–/– phenotype and the hemopoietic system a WT one (irradiated TLR9–/– mice reconstituted with BM from WT mice), there was also a reduction of IFN-{gamma}-producing CD4+ cells from the lamina propria (Fig. 5A), similar to what was observed in TLR9–/– mice. WT mice reconstituted with WT BM were also used as controls and responded similarly to the WT mice (data not shown). These results indicate that there is no endogenous defect in T cells from TLR9–/– mice and that the TLR9-dependent Ag responses in the nonhemopoietic as well as the hemopoietic compartments are essential for the initiation of both the innate and adaptive immune response following oral infection with T. gondii. Histological analyses of the chimeric mouse intestines revealed a mixed phenotype in the TLR9–/– mice reconstituted with WT BM and in the WT mice reconstituted with TLR9–/– BM (Fig. 5B), further implicating a role for APCs from both the hemopoietic and nonhemopoietic compartments.


Figure 5
View larger version (39K):
[in this window]
[in a new window]
 
FIGURE 5. IFN-{gamma}-producing CD4+ T cells results from activation of TLR9-expressing cells in both the hemopoietic and nonhemopoietic compartments. Day 7 postinfection, ex vivo-restimulated CD4+ T cells from the lamina propria from 4 mice/group, performed twice, had reduced intracellular IFN-{gamma} levels when irradiated B6 mice were reconstituted with BM from TLR9–/– and when irradiated TLR9–/– mice were reconstituted with BM from B6 mice (A). Histological scoring of intestines from chimeric mice revealed an intermediate phenotype with regard to inflammation (B).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
TLRs expressed by cells of the mucosal epithelium and associated lymphoid tissue play an essential role in the defense against microbes by recognizing conserved bacterial molecules. Previous studies as well as unpublished observations in our laboratory indicate that neither TLR4 nor TLR2 participate in the innate mucosal response to this parasite, although signaling through the MyD88 pathway is essential. We report that TLR9 expression in susceptible WT mice is critical to the initiation of innate immune response and, subsequently, the adaptive immune response to this obligate intracellular pathogen and that both the hemopoietic and nonhemopoietic compartments are involved in Ag presentation. TLR9 expression on mucosal tissues and its role in the protection against various microbes has been well characterized. It is now appreciated that TLR9 can engage a wide range of microbial infections including bacteria (42, 43), viral (44, 45), and parasitic (8, 9, 15). TLR9 has been localized to several tissues and cell types, including the gastric mucosa, tonsils (29, 46), IECs, Paneth cells in the gut mucosa, B cells, and several DC populations (2, 15, 39, 47, 48, 49).

TLR9 expression has been previously described on several cell types including epithelial cells, B cells, and professional APC. Small intestine, ex vivo-purified IECs, and cells from the lamina propria exhibit an early up-regulation of TLR9 and IFN-beta (a measure of TLR9 activation) mRNA, followed by a second up-regulation by day 3 postinfection with T. gondii. Type I IFNs are thought to be important in the phenotypic maturation of DCs, where they may work in an autocrine manner (32). These data indicate that TLR9 is expressed on cells from the nonhemopoietic compartment (i.e., the Paneth cells and/or enterocytes) in response to oral T. gondii infection.

TLR9 may exert different downstream effects depending on the TLR9-ligand interaction (50, 51, 52, 53). TLR9 was shown to respond to non-CpG DNA resulting in a Th2 type instead of a Th1 type immune response (53), further indicating that TLR9 is important in polarizing the immune system to different antigenic stimuli. These different functions of activation might contribute to microbial clearance but also could lead to an increase in autoreactive B or T cell stimulation potentially enhancing the inflammatory processes that contribute to the immunopathology of several diseases, including acute ileitis. We examined whether TLR9–/– mice displayed a Th2 profile following oral infection with T. gondii. mRNA analyses of IL-4, IL-10, and IL-13 show no significant increase in Th2 cytokines compared with WT controls (data not shown). Additional analyses of T cells using intracellular cytokine staining confirmed mRNA analyses, adding further support that TLR9–/– mice are deficient in inducing a Th1 response as opposed to shifting toward a Th2 response.

DC responses, in terms of IL-12p40 production from soluble T. gondii Ag, were shown to be associated with the newly identified MyD88-dependent TLR11; however, a small amount of IL-12 and IFN-{gamma} were still present in the serum of infected TLR11–/– mice (20), indicating that another MyD88-dependent TLR must be involved in the immune response to T. gondii. Although multiple TLRs are up-regulated in the intestine of T. gondii-infected mice, mice lacking the expression of TLR4 or TLR2 were still susceptible to the development of ileitis and died within a week of severe ileitis, (our unpublished observation), indicating a comparable immune response to orally infected WT mice. Taken together, these studies indicate that T. gondii infection triggers a MyD88-dependent TLR that may act independently or in concert with TLR11 to induce the IFN-{gamma} response by T cells from the lamina propria.

Systemically and in the GALT, the balance between mounting an effective immune response vs a tolerogenic effect to several different Ags depends largely upon the APC presenting the Ag and the T cells that respond (54). DCs help the immune system to maintain a tenuous yet crucial balance between attacking pathogens and sparing the body’s own tissue through educating T cells as to the appropriate targets. Different GALT DC subsets may accomplish these different functions (54, 55). GALT DCs are distinct from peripheral DCs; our data indicate that in the MLN, CD11clow of variable CD8{alpha} expression might be plasmacytoid-like DCs. Although an increase in the CD11clow populations was observed after infection, the most pronounced increase was present in the CD8{alpha}int population. The increase of CD8{alpha}int cells and also the up-regulation of costimulatory molecules CD80 and CD86 provides sufficient evidence to suggest that these DCs are important for initiating the inflammation in B6 mice after oral T. gondii infection. Our data is consistent with previous studies using an oral cholera toxin model of inflammation; in this model, CD8{alpha}int DCs both accumulate in the MLNs following cholera toxin treatment and are immunostimulatory to naive CD4+ T cells (33).

CD4 T cells (CD45RBhigh, CD25), isolated from the lamina propria, were identified as a major player in the inflammatory process (41). Following infection, CD4+ T cells migrate into the lamina propria, where they act as critical effector cells secreting copious amounts of Th1-type cytokines such as IFN-{gamma}, which we and others have identified as being critical in the development of the mucosal inflammatory process (16, 17). By day 7 postinfection, we observed a modest reduction in the overall numbers of CD3+ T cells (both the CD8+ and CD4+) in TLR9–/– mice compared with the WT controls. Quantification of these lamina propria T cells shows that T cells of a regulatory phenotype (CD4+CD25+CD45RBlow) are not involved in the lack of inflammation observed in TLR9–/– mice (data not shown). TLR9–/– mice display decreased IFN-{gamma} levels both in the small intestine and by the CD4+ T cells isolated from the lamina propria of TLR9–/– mice compared with WT controls. The reduction of IFN-{gamma}-producing T cells in the lamina propria following oral infection does not appear to be due to an endogenous defect in the ability of TLR9–/– T cells to mount an IFN-{gamma} response because TLR9–/–-irradiated mice reconstituted with WT BM also have reduced IFN-{gamma} production.

mRNA analysis of purified B cell populations from the GALT reveals that TLR9 expression is not dramatically affected in this compartment during infection (data not shown). Double chimeric mice (irradiated WT B6 mice reconstituted with BM cells from B cell KO mice (50%) and from TLR9 KO mice (50%)) display no difference in susceptibility as compared with the WT mice (data not shown). This evidence rules out a crucial role of TLR9 expression by the B cell population.

In this study, we show that TLR9 deficiency results in a 50% reduction in IFN-{gamma} production, a level sufficient to prevent histological evidence of inflammation, yet insufficient to completely abrogate inflammatory cytokine production. It is likely that the immune response to T. gondii requires multiple pathogen-associated molecular patterns receptors because TLR11 and now TLR9 appear to play important roles in IFN-{gamma} responses, confirming previous reports that TLRs are redundant and may recognize multiple ligands from the same (1, 2, 3, 4, 5, 6, 20, 56). In this study we show that in TLR9–/– mice, the decrease in inflammation is associated with a defect of DC stimulation and/or migration into the MLN and, subsequently, a lack of Ag presentation for T cell activation following oral infection with T. gondii. In summary, this study identifies TLR9 as a critical receptor for the parasite and essential for the development of an efficient T cell response in the small intestine.


    Acknowledgments
 
We thank John DeLong, Rachel DuPont, Jacqueline Y. Channon, and Niles P. Donegan for technical support and critical review of the manuscript.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Address correspondence and reprint requests to Dr. Lloyd H. Kasper, Department of Microbiology and Immunology, Dartmouth Medical School, 1 Medical Center Drive, Lebanon, NH 03756. E-mail address: lloyd.kasper{at}dartmouth.edu Back

2 D.B.-G. and L.H.K. share senior authorship. Back

3 Abbreviations used in this paper: DC, dendritic cell; KO, knockout; WT, wild type; BM, bone marrow; IEC, intestinal epithelial cell; MLN, mesenteric lymph node; LPL, lamina propria lymphocyte; GALT, gut-associated lymphoid tissue; int, intermediate. Back

Received for publication March 9, 2005. Accepted for publication March 31, 2006.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Akira, S., K. Takeda, T. Kaisho. 2001. Toll-like receptors: critical proteins linking innate and acquired immunity. Nat. Immunol. 2: 675-680. [Medline]
  2. Akira, S., H. Hemmi. 2003. Recognition of pathogen-associated molecular patterns by TLR family. Immunol. Lett. 85: 85-95. [Medline]
  3. Takeda, K., T. Kaisho, S. Akira. 2003. Toll-like receptors. Annu. Rev. Immunol. 21: 335-376. [Medline]
  4. Takeda, K., S. Akira. 2004. TLR signaling pathways. Semin. Immunol. 16: 3-9. [Medline]
  5. Takeda, K., S. Akira. 2004. Microbial recognition by Toll-like receptors. J. Dermatol. Sci. 34: 73-82. [Medline]
  6. Takeda, K., S. Akira. 2005. Toll-like receptors in innate immunity. Int. Immunol. 17: 1-14. [Abstract/Free Full Text]
  7. Rutz, M., J. Metzger, T. Gellert, P. Luppa, G. B. Lipford, H. Wagner, S. Bauer. 2004. Toll-like receptor 9 binds single-stranded CpG-DNA in a sequence- and pH-dependent manner. Eur. J. Immunol. 34: 2541-2550. [Medline]
  8. Wagner, H.. 2004. The immunobiology of the TLR9 subfamily. Trends Immunol. 25: 381-386. [Medline]
  9. Hemmi, H., O. Takeuchi, T. Kawai, T. Kaisho, S. Sato, H. Sanjo, M. Matsumoto, K. Hoshino, H. Wagner, K. Takeda, S. Akira. 2000. A Toll-like receptor recognizes bacterial DNA. Nature 408: 740-745. [Medline]
  10. Bauer, S., K. C., Hacker, H., Redecke, V., Hausmann, S., Akira, S., Wagner, H., Lipford, G. B. 2001. Human TLR9 confers responsiveness to bacterial DNA via species-specific CpG motif recognition. Proc. Natl. Acad. Sci. USA 98: 9237–9242.
  11. Kim, J. M., N. I. Kim, Y. K. Oh, Y. J. Kim, J. Youn, M. J. Ahn. 2005. CpG oligodeoxynucleotides induce IL-8 expression in CD34+ cells via mitogen-activated protein kinase-dependent and NF-{kappa}B-independent pathways. Int. Immunol. 17: 1525-1531. [Abstract/Free Full Text]
  12. Honda, K., H. Yanai, T. Mizutani, H. Negishi, N. Shimada, N. Suzuki, Y. Ohba, A. Takaoka, W. C. Yeh, T. Taniguchi. 2004. Role of a transductional-transcriptional processor complex involving MyD88 and IRF-7 in Toll-like receptor signaling. Proc. Natl. Acad. Sci. USA 101: 15416-15421. [Abstract/Free Full Text]
  13. Nishiya, T., A. L. DeFranco. 2004. Ligand-regulated chimeric receptor approach reveals distinctive subcellular localization and signaling properties of the Toll-like receptors. J. Biol. Chem. 279: 19008-19017. [Abstract/Free Full Text]
  14. Pichyangkul, S., K. Yongvanitchit, U. Kum-arb, H. Hemmi, S. Akira, A. M. Krieg, D. G. Heppner, V. A. Stewart, H. Hasegawa, S. Looareesuwan, et al 2004. Malaria blood stage parasites activate human plasmacytoid dendritic cells and murine dendritic cells through a Toll-like receptor 9-dependent pathway. J. Immunol. 172: 4926-4933. [Abstract/Free Full Text]
  15. Coban, C., K. J. Ishii, T. Kawai, H. Hemmi, S. Sato, S. Uematsu, M. Yamamoto, O. Takeuchi, S. Itagaki, N. Kumar, et al 2005. Toll-like receptor 9 mediates innate immune activation by the malaria pigment hemozoin. J. Exp. Med. 201: 19-25. [Abstract/Free Full Text]
  16. Liesenfeld, O.. 1999. Immune responses to Toxoplasma gondii in the gut. Immunobiology 201: 229-239. [Medline]
  17. Mennechet, F. J., L. H. Kasper, N. Rachinel, W. Li, A. Vandewalle, D. Buzoni-Gatel. 2002. Lamina propria CD4+ T lymphocytes synergize with murine intestinal epithelial cells to enhance proinflammatory response against an intracellular pathogen. J. Immunol. 168: 2988-2996. [Abstract/Free Full Text]
  18. Del Rio, L., B. A. Butcher, S. Bennouna, S. Hieny, A. Sher, E. Y. Denkers. 2004. Toxoplasma gondii triggers myeloid differentiation factor 88-dependent IL-12 and chemokine ligand 2 (monocyte chemoattractant protein 1) responses using distinct parasite molecules and host receptors. J. Immunol. 172: 6954-6960. [Abstract/Free Full Text]
  19. Scanga, C. A., J. Aliberti, D. Jankovic, F. Tilloy, S. Bennouna, E. Y. Denkers, R. Medzhitov, A. Sher. 2002. Cutting edge: MyD88 is required for resistance to Toxoplasma gondii infection and regulates parasite-induced IL-12 production by dendritic cells. J. Immunol. 168: 5997-6001. [Abstract/Free Full Text]
  20. Yarovinsky, F., D. Zhang, J. F. Andersen, G. L. Bannenberg, C. N. Serhan, M. S. Hayden, S. Hieny, F. S. Sutterwala, R. A. Flavell, S. Ghosh, A. Sher. 2005. TLR11 activation of dendritic cells by a protozoan profilin-like protein. Science 308: 1626-1629. [Abstract/Free Full Text]
  21. Bouma, G., A. Kaushiva, W. Strober. 2002. Experimental murine colitis is regulated by two genetic loci, including one on chromosome 11 that regulates IL-12 responses. Gastroenterology 123: 554-565. [Medline]
  22. Vremec, D., M. Zorbas, R. Scollay, D. J. Saunders, C. F. Ardavin, L. Wu, K. Shortman. 1992. The surface phenotype of dendritic cells purified from mouse thymus and spleen: investigation of the CD8 expression by a subpopulation of dendritic cells. J. Exp. Med. 176: 47-58. [Abstract/Free Full Text]
  23. Arstila, T., T. P. Arstila, S. Calbo, F. Selz, M. Malassis-Seris, P. Vassalli, P. Kourilsky, D. Guy-Grand. 2000. Identical T cell clones are located within the mouse gut epithelium and lamina propia and circulate in the thoracic duct lymph. J. Exp. Med. 191: 823-834. [Abstract/Free Full Text]
  24. Overbergh, L., D. Valckx, M. Waer, C. Mathieu. 1999. Quantification of murine cytokine mRNAs using real time quantitative reverse transcriptase PCR. Cytokine 11: 305-312. [Medline]
  25. Schiavoni, G., F. Mattei, T. Di Pucchio, S. M. Santini, L. Bracci, F. Belardelli, E. Proietti. 2000. Cyclophosphamide induces type I interferon and augments the number of CD44hi T lymphocytes in mice: implications for strategies of chemoimmunotherapy of cancer. Blood 95: 2024-2030. [Abstract/Free Full Text]
  26. Sweet, M. J., C. C. Campbell, D. P. Sester, D. Xu, R. C. McDonald, K. J. Stacey, D. A. Hume, F. Y. Liew. 2002. Colony-stimulating factor-1 suppresses responses to CpG DNA and expression of Toll-like receptor 9 but enhances responses to lipopolysaccharide in murine macrophages. J. Immunol. 168: 392-399. [Abstract/Free Full Text]
  27. Burg, J. L., C. M. Grover, P. Pouletty, J. C. Boothroyd. 1989. Direct and sensitive detection of a pathogenic protozoan, Toxoplasma gondii, by polymerase chain reaction. J. Clin. Microbiol. 27: 1787-1792. [Abstract/Free Full Text]
  28. Platz, J., C. Beisswenger, A. Dalpke, R. Koczulla, O. Pinkenburg, C. Vogelmeier, R. Bals. 2004. Microbial DNA induces a host defense reaction of human respiratory epithelial cells. J. Immunol. 173: 1219-1223. [Abstract/Free Full Text]
  29. Schmausser, B., M. Andrulis, S. Endrich, S. K. Lee, C. Josenhans, H. K. Muller-Hermelink, M. Eck. 2004. Expression and subcellular distribution of Toll-like receptors TLR4, TLR5 and TLR9 on the gastric epithelium in Helicobacter pylori infection. Clin. Exp. Immunol. 136: 521-526. [Medline]
  30. Asselin-Paturel, C., G. Brizard, K. Chemin, A. Boonstra, A. O’Garra, A. Vicari, G. Trinchieri. 2005. Type I interferon dependence of plasmacytoid dendritic cell activation and migration. J. Exp. Med. 201: 1157-1167. [Abstract/Free Full Text]
  31. Ito, T., Y. H. Wang, Y. J. Liu. 2005. Plasmacytoid dendritic cell precursors/type I interferon-producing cells sense viral infection by Toll-like receptor (TLR) 7 and TLR9. Springer Semin. Immunopathol. 26: 221-229. [Medline]
  32. Montoya, M., G. Schiavoni, F. Mattei, I. Gresser, F. Belardelli, P. Borrow, D. F. Tough. 2002. Type I interferons produced by dendritic cells promote their phenotypic and functional activation. Blood 99: 3263-3271. [Abstract/Free Full Text]
  33. Anjuere, F., C. Luci, M. Lebens, D. Rousseau, C. Hervouet, G. Milon, J. Holmgren, C. Ardavin, C. Czerkinsky. 2004. In vivo adjuvant-induced mobilization and maturation of gut dendritic cells after oral administration of cholera toxin. J. Immunol. 173: 5103-5111. [Abstract/Free Full Text]
  34. Bilsborough, J., T. C. George, A. Norment, J. L. Viney. 2003. Mucosal CD8{alpha}+ DC, with a plasmacytoid phenotype, induce differentiation and support function of T cells with regulatory properties. Immunology 108: 481-492. [Medline]
  35. Bilsborough, J., J. L. Viney. 2004. Gastrointestinal dendritic cells play a role in immunity, tolerance, and disease. Gastroenterology 127: 300-309. [Medline]
  36. Cruickshank, S. M., N. R. English, P. J. Felsburg, S. R. Carding. 2005. Characterization of colonic dendritic cells in normal and colitic mice. World J. Gastroenterol. 11: 6338-6347. [Medline]
  37. Rescigno, M., G. Rotta, B. Valzasina, P. Ricciardi-Castagnoli. 2001. Dendritic cells shuttle microbes across gut epithelial monolayers. Immunobiology 204: 572-581. [Medline]
  38. Krug, A., A. R. French, W. Barchet, J. A. Fischer, A. Dzionek, J. T. Pingel, M. M. Orihuela, S. Akira, W. M. Yokoyama, M. Colonna. 2004. TLR9-dependent recognition of MCMV by IPC and DC generates coordinated cytokine responses that activate antiviral NK cell function. Immunity 21: 107-119. [Medline]
  39. Edwards, A. D., S. S. Diebold, E. M. Slack, H. Tomizawa, H. Hemmi, T. Kaisho, S. Akira, C. Reis e Sousa. 2003. Toll-like receptor expression in murine DC subsets: lack of TLR7 expression by CD8{alpha}+ DC correlates with unresponsiveness to imidazoquinolines. Eur. J. Immunol. 33: 827-833. [Medline]
  40. Kasper, L., N. Courret, S. Darche, S. Luangsay, F. Mennechet, L. Minns, N. Rachinel, C. Ronet, D. Buzoni-Gatel. 2004. Toxoplasma gondii and mucosal immunity. Int. J. Parasitol. 34: 401-409. [Medline]
  41. Mennechet, F. J., L. H. Kasper, N. Rachinel, L. A. Minns, S. Luangsay, A. Vandewalle, D. Buzoni-Gatel. 2004. Intestinal intraepithelial lymphocytes prevent pathogen-driven inflammation and regulate the Smad/T-bet pathway of lamina propria CD4+ T cells. Eur. J. Immunol. 34: 1059-1067. [Medline]
  42. Ashkar, A. A., R. KL. 2002. Toll-like receptor 9, CpG DNA and innate immunity. Curr. Mol. Med. 2: 545-556. [Medline]
  43. Schetter, C., J. Vollmer. 2004. Toll-like receptors involved in the response to microbial pathogens: development of agonists for Toll-like receptor 9. Curr. Opin. Drug Discov. Devel. 7: 204-210. [Medline]
  44. Abe, T., H. Hemmi, H. Miyamoto, K. Moriishi, S. Tamura, H. Takaku, S. Akira, Y. Matsuura. 2005. Involvement of the Toll-like receptor 9 signaling pathway in the induction of innate immunity by baculovirus. J. Virol. 79: 2847-2858. [Abstract/Free Full Text]
  45. Malmgaard, L., J. Melchjorsen, A. G. Bowie, S. C. Mogensen, S. R. Paludan. 2004. Viral activation of macrophages through TLR-dependent and -independent pathways. J. Immunol. 173: 6890-6898. [Abstract/Free Full Text]
  46. Eaton-Bassiri, A., S. B. Dillon, M. Cunningham, M. A. Rycyzyn, J. Mills, R. T. Sarisky, M. L. Mbow. 2004. Toll-like receptor 9 can be expressed at the cell surface of distinct populations of tonsils and human peripheral blood mononuclear cells. Infect. Immun. 72: 7202-7211. [Abstract/Free Full Text]
  47. Rumio, C., D. Besusso, M. Palazzo, S. Selleri, L. Sfondrini, F. Dubini, S. Menard, A. Balsari. 2004. Degranulation of Paneth cells via Toll-like receptor 9. Am. J. Pathol. 165: 373-381. [Abstract/Free Full Text]
  48. Rachmilewitz, D., K. Katakura, F. Karmeli, T. Hayashi, C. Reinus, B. Rudensky, S. Akira, K. Takeda, J. Lee, K. Takabayashi, E. Raz. 2004. Toll-like receptor 9 signaling mediates the anti-inflammatory effects of probiotics in murine experimental colitis. Gastroenterology 126: 520-528. [Medline]
  49. Kato, A., T. Ogasawara, T. Homma, J. Batchelor, S. Imai, H. Wakiguchi, H. Saito, K. Matsumoto. 2004. CpG oligodeoxynucleotides directly induce CXCR3 chemokines in human B cells. Biochem. Biophys. Res. Commun. 320: 1139-1147. [Medline]
  50. Jurk, M., B. Schulte, A. Kritzler, B. Noll, E. Uhlmann, T. Wader, C. Schetter, A. M. Krieg, J. Vollmer. 2004. C-class CpG ODN: sequence requirements and characterization of immunostimulatory activities on mRNA level. Immunobiology 209: 141-154. [Medline]
  51. He, B., X. Qiao, A. Cerutti. 2004. CpG DNA induces IgG class switch DNA recombination by activating human B cells through an innate pathway that requires TLR9 and cooperates with IL-10. J. Immunol. 173: 4479-4491. [Abstract/Free Full Text]
  52. Vollmer, J., J. S. Jepsen, E. Uhlmann, C. Schetter, M. Jurk, T. Wader, M. Wullner, A. M. Krieg. 2004. Modulation of CpG oligodeoxynucleotide-mediated immune stimulation by locked nucleic acid (LNA). Oligonucleotides 14: 23-31. [Medline]
  53. Vollmer, J., R. D. Weeratna, M. Jurk, U. Samulowitz, M. J. McCluskie, P. Payette, H. L. Davis, C. Schetter, A. M. Krieg. 2004. Oligodeoxynucleotides lacking CpG dinucleotides mediate Toll-like receptor 9 dependent T helper type 2 biased immune stimulation. Immunology 113: 212-223. [Medline]
  54. Mowat, A. M.. 2003. Anatomical basis of tolerance and immunity to intestinal antigens. Nat. Rev. Immunol. 3: 331-341. [Medline]
  55. Mowat, A. M.. 2005. Dendritic cells and immune responses to orally administered antigens. Vaccine 23: 1797-1799. [Medline]
  56. Pasare, C., R. Medzhitov. 2005. Toll-like receptors: linking innate and adaptive immunity. Adv. Exp. Med. Biol. 560: 11-18. [Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
C.-H. Ju, A. Chockalingam, and C. A. Leifer
Early Response of Mucosal Epithelial Cells during Toxoplasma gondii Infection
J. Immunol., December 1, 2009; 183(11): 7420 - 7427.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
E. Gaudreault and J. Gosselin
Leukotriene B4 Potentiates CpG Signaling for Enhanced Cytokine Secretion by Human Leukocytes
J. Immunol., August 15, 2009; 183(4): 2650 - 2658.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
F. Hkima Abou Fakher, N. Rachinel, M. Klimczak, J. Louis, and N. Doyen
TLR9-Dependent Activation of Dendritic Cells by DNA from Leishmania major Favors Th1 Cell Development and the Resolution of Lesions
J. Immunol., February 1, 2009; 182(3): 1386 - 1396.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
Y. Yamada, A. Sanchez-Aguilera, E. B. Brandt, M. McBride, N. J. H. Al-Moamen, F. D. Finkelman, D. A. Williams, J. A. Cancelas, and M. E. Rothenberg
FIP1L1/PDGFR{alpha} synergizes with SCF to induce systemic mastocytosis in a murine model of chronic eosinophilic leukemia/hypereosinophilic syndrome
Blood, September 15, 2008; 112(6): 2500 - 2507.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
W. Sukhumavasi, C. E. Egan, A. L. Warren, G. A. Taylor, B. A. Fox, D. J. Bzik, and E. Y. Denkers
TLR Adaptor MyD88 Is Essential for Pathogen Control during Oral Toxoplasma gondii Infection but Not Adaptive Immunity Induced by a Vaccine Strain of the Parasite
J. Immunol., September 1, 2008; 181(5): 3464 - 3473.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
G. Plitas, B. M. Burt, H. M. Nguyen, Z. M. Bamboat, and R. P. DeMatteo
Toll-like receptor 9 inhibition reduces mortality in polymicrobial sepsis
J. Exp. Med., June 9, 2008; 205(6): 1277 - 1283.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
D. F. LaRosa, J. S. Stumhofer, A. E. Gelman, A. H. Rahman, D. K. Taylor, C. A. Hunter, and L. A. Turka
T cell expression of MyD88 is required for resistance to Toxoplasma gondii
PNAS, March 11, 2008; 105(10): 3855 - 3860.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
C. W. Lee, W. Sukhumavasi, and E. Y. Denkers
Phosphoinositide-3-Kinase-Dependent, MyD88-Independent Induction of CC-Type Chemokines Characterizes the Macrophage Response to Toxoplasma gondii Strains with High Virulence
Infect. Immun., December 1, 2007; 75(12): 5788 - 5797.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. C. Menard, L. A. Minns, S. Darche, D. W. Mielcarz, D. M. Foureau, D. Roos, F. Dzierszinski, L. H. Kasper, and D. Buzoni-Gatel
B Cells Amplify IFN-{gamma} Production By T Cells via a TNF-{alpha}-Mediated Mechanism
J. Immunol., October 1, 2007; 179(7): 4857 - 4866.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
U. Bhan, N. W. Lukacs, J. J. Osterholzer, M. W. Newstead, X. Zeng, T. A. Moore, T. R. McMillan, A. M. Krieg, S. Akira, and T. J. Standiford
TLR9 Is Required for Protective Innate Immunity in Gram-Negative Bacterial Pneumonia: Role of Dendritic Cells
J. Immunol., September 15, 2007; 179(6): 3937 - 3946.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
F. Debierre-Grockiego, M. A. Campos, N. Azzouz, J. Schmidt, U. Bieker, M. G. Resende, D. S. Mansur, R. Weingart, R. R. Schmidt, D. T. Golenbock, et al.
Activation of TLR2 and TLR4 by Glycosylphosphatidylinositols Derived from Toxoplasma gondii
J. Immunol., July 15, 2007; 179(2): 1129 - 1137.
[Abstract] [Full Text] [PDF]


Home page
GutHome page
M M Heimesaat, A Fischer, H-K Jahn, J Niebergall, M Freudenberg, M Blaut, O Liesenfeld, R R Schumann, U B Gobel, and S Bereswill
Exacerbation of murine ileitis by Toll-like receptor 4 mediated sensing of lipopolysaccharide from commensal Escherichia coli
Gut, July 1, 2007; 56(7): 941 - 948.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
U. Schleicher, J. Liese, I. Knippertz, C. Kurzmann, A. Hesse, A. Heit, J. A.A. Fischer, S. Weiss, U. Kalinke, S. Kunz, et al.
NK cell activation in visceral leishmaniasis requires TLR9, myeloid DCs, and IL-12, but is independent of plasmacytoid DCs
J. Exp. Med., April 16, 2007; 204(4): 893 - 906.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. M. Heimesaat, S. Bereswill, A. Fischer, D. Fuchs, D. Struck, J. Niebergall, H.-K. Jahn, I. R. Dunay, A. Moter, D. M. Gescher, et al.
Gram-Negative Bacteria Aggravate Murine Small Intestinal Th1-Type Immunopathology following Oral Infection with Toxoplasma gondii
J. Immunol., December 15, 2006; 177(12): 8785 - 8795.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Minns, L. A.
Right arrow Articles by Kasper, L. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Minns, L. A.
Right arrow Articles by Kasper, L. H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS