The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rutschmann, S.
Right arrow Articles by Beutler, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rutschmann, S.
Right arrow Articles by Beutler, B.
The Journal of Immunology, 2006, 176: 7525-7532.
Copyright © 2006 by The American Association of Immunologists

PanR1, a Dominant Negative Missense Allele of the Gene Encoding TNF-{alpha} (Tnf), Does Not Impair Lymphoid Development1

Sophie Rutschmann*, Kasper Hoebe*, Jonathan Zalevsky{dagger}, Xin Du*, Navjiwan Mann*, Bassil I. Dahiyat{dagger}, Paul Steed{dagger} and Bruce Beutler2,*

* Department of Immunology, Scripps Research Institute, La Jolla, CA 92037; and {dagger} Xencor, Monrovia, CA 91016


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
A dominant hypomorphic allele of Tnf, PanR1, was identified in a population of G1 mice born to N-ethyl-N-nitrosourea-mutagenized sires. Macrophages from homozygotes produced no detectable TNF bioactivity, although normal quantities of immunoreactive TNF were secreted. The phenotype was confined to a critical region on mouse chromosome 17, and then ascribed to a C->A transversion at position 3480 of the Tnf gene, corresponding to the amino acid substitution P138T. As a result of subunit exchange, the protein exerts a dominant-negative effect on normal TNF trimers, interfering with the trimer/receptor interaction. Homozygotes are highly susceptible to infection by Listeria monocytogenes, confirming the essential role of TNF in innate immune defense. However, PanR1 mutant mice show normal architecture of the spleen and Peyer’s patches, suggesting that TNF is not essential for the formation of these lymphoid structures.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Tumor necrosis factor {alpha} is an important mediator of inflammation and endotoxic shock (1), and is also seen as a regulator of cell death or survival, depending upon circumstance (2, 3, 4, 5). TNF deficiency impairs both innate and adaptive immune responses, causing susceptibility to infection by diverse microbes (for example, Listeria monocytogenes (6, 7, 8, 9, 10, 11, 12) or Mycobacterium bovis (13)). Its various functions have been validated by the use of TNF-neutralizing agents in the treatment of inflammatory diseases (14, 15, 16), by studies of animals with targeted mutations in genes encoding TNF, its receptors, or signal-transducing proteins (3, 17), and by linking human diseases to defects in TNF signaling (18).

TNF is produced as a 26-kDa transmembrane protein (TmTNF)3 that can be cleaved by membrane-bound metalloprotease(s), including the TNF-{alpha}-converting enzyme (TACE) (19, 20), to release a 17-kDa soluble TNF (solTNF) that forms trimers (21). Both the membrane-associated and soluble forms of the protein are biologically active, interacting with two types of surface receptors on target cells: the p55-TNF (Tnfrsf1a) and p75-TNF (Tnfrsf1b) receptors. It has been proposed that solTNF is disproportionately important in the pathogenesis of chronic inflammatory diseases (22), and that signaling initiated by transmembrane TNF is sufficient to resolve inflammation (23, 24) and to confer resistance to infection (9, 25).

Members of the lymphotoxin/TNF superfamily have been shown to be required for secondary lymphoid organ development and maintenance (4, 26, 27). In particular, spleen and Peyer’s patches (PP) of Tnf- or Tnfrsf1a-deficient mice are devoid of primary B cell follicles, follicular dendritic cell (FDC) networks, and germinal centers (GC), whereas the lymph nodes of these mice are present (9, 10, 28, 29, 30, 31, 32, 33). In lymphotoxin-{alpha} (Lta), lymphotoxin-beta (Ltb), or their receptor-deficient mice, more dramatic phenotypes are observed, including the absence of lymph nodes and PP, as well as highly disorganized splenic architecture (34).

791 G1 animals born to N-ethyl-N-nitrosourea (ENU)-mutagenized sires were examined to detect defective production of TNF bioactivity by macrophages in response to TLR stimuli. We identified a G1 mouse with macrophages that produced very low levels of TNF bioactivity. The so-called pan-resistant (PanR1) phenotype was transmissible, and the mutation was propagated for positional cloning.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 Disclosures
 References
 
Animals

The C57BL/6J and Tnftm1Gkl (Tnf–/–) (9) mice were purchased from The Jackson Laboratory. The C3H/HeN mice were purchased from Taconic Farms. All of the animals were maintained under specific pathogen-free conditions in the Scripps Research Institute animal facility. All experimental procedures were conducted in accordance with institutional guidelines for animal care and use.

ENU mutagenesis and breeding

Six-week-old C57BL/6J males were treated with ENU administered in three weekly doses (90 mg/kg body weight) by i.p. injection. After 12 wk of recovery from infertility, each mouse is bred to C57BL/6J females to produce a maximum of 20 G1 offspring.

TNF bioassay

Mice were injected i.p. with 2 ml of 3% Brewer’s thioglycolate broth, and macrophages were harvested under anesthesia at day 3 by peritoneal lavage with PBS. Cells are counted and plated in DMEM, 5% FCS, and 2% penicillin/streptomycin at a density of 5 x 105 cells/well in a 96-well plate. Cells are stimulated for 4 h at 37°C with the TLR agonists indicated in Fig. 1. The supernatants (conditioned medium) were collected and assayed for TNF activity in a L929 cell bioassay using MTT to measure cell viability (35). TNF concentration in the conditioned medium was calculated using a standard curve generated with mouse rTNF. For the inhibition assays, serial dilution of LPS-conditioned medium was incubated for 30 min with either an anti-mouse TNF mAb (Pierce Endogen) or an anti-mouse Lta mAb (BD Pharmingen), and then assayed in a L929 cell bioassay. To ascertain the bioactivity of membrane-associated TNF, macrophages were stimulated with LPS in the presence of 200 µM TACE inhibitor TNF{alpha} processing inhibitor 2 (TAPi-2) (BIOMOL), washed to remove soluble TNF, fixed in paraformaldehyde 1.6%, washed, and assayed directly on L929 cells.


Figure 1
View larger version (20K):
[in this window]
[in a new window]
  		FIGURE 1. PanR1 reduces TNF activity produced in response to TLR activation. A, TNF activity as measured in an L929 bioassay. Thioglycolate-elicited peritoneal macrophages from wild-type (B6 = C57BL/6J) or heterozygous mutant (PanR1/+) mice were left untreated (medium) or activated by TLR agonists at the stated concentrations. n = 6–9 mice per group. B, TNF activity produced by wild-type, PanR1/+, and PanR1/PanR1 macrophages in response to increasing concentrations of LPS. n = 2–4 mice per group. C, TNF bioactivity in LPS-conditioned medium alone, or with anti-TNF or anti-Lta mAb. Each bar represents the average obtained for two to four mice of each genotype, assayed in quadruplicate. All error bars indicate SD.

 
Genomic linkage analysis and genotyping

PanR1/PanR1 mice were mated to C3H/HeN mice, and the offspring were backcrossed to C3H/HeN animals. The progeny of this generation was phenotyped and genotyped for mapping. A total of 59 microsatellites markers was used for genome-wide linkage analysis. Genotyping was performed with the following primers: CTGAAGACAGCTTCCCACACTG and AAGTGGAGGAGCAGCTGGAGTG on genomic DNA.

Bacterial strain and infections

Bioluminescent L. monocytogenes strain 10403S (Xenogen) was prepared as described elsewhere (36). For the infections, L. monocytogenes was cultured in brain-heart infusion broth at 37°C, resuspended in PBS, and inoculated via the tail vain in 8- to 10-wk male or female mice. The injected concentration was further confirmed by CFU counting. Bioluminescence imaging was performed using an IVIS Imaging System (Xenogen). Mice were anesthetized 2 days after infection by isofluorane inhalation, shaved, and bioluminescence was recorded for 1 min at a pixel binning of 10.

Crystal structures

TNF trimer and Lta/Tnfrsf1a interaction structures were obtained from the Research Collaboratory Structural Bioinformatic protein data bank (<www.rcsb.org/pdb/>).

ELISA

ELISAs were performed using the BioSource International cytoset mouse TNF ELISA.

TNF intracellular staining

Staining of intracellular TNF was performed using the BD Biosciences Fixation and Permeabilization Solution Kit with BD GolgiPlug on LPS-activated macrophages from C57BL/6J and TnfPanR1/PanR1 mice. TNF was detected by flow cytometry analysis with FITC anti-TNF Ab (BD Biosciences).

Trimer exchange assay

Fixed amounts (20 ng/ml) of TNF from homozygous TnfPanR1/PanR1 LPS-conditioned medium or murine wild-type TNF were incubated with increasing amount of FLAG-tagged wild-type human TNF in PBS/1% BSA/0.02% Tween 20. Heterocomplexes were detected using an anti-mouse TNF Ab (R&D Systems) and an anti-FLAG M2 detection Ab (Sigma-Aldrich).

Receptor-binding assay

ELISA plates were coated with 2 µg/ml mouse Tnfrsf1a-Fc chimera protein (R&D Systems). Nonspecific binding was blocked in PBS/3% BSA for 2 h, and incubated with LPS-conditioned medium from PanR1 homozygous, heterozygous, or C57BL/6J macrophages for 2 h. Bound TNF was revealed with a biotin-conjugated anti-mouse TNF mAb (BioSource International) and streptavidin HRP (Pierce).

Detection of T cell-dependent adaptive immune responses

Six- to 8-wk-old mice were challenged i.p. with 100 µg of NP20-keyhole limpet hemocyanin (Biosearch Technologies) adsorbed to alum (Pierce) in 0.2 ml of PBS. Spleen and PP were harvested 8 days later, embedded in OCT compound (Sakura Finetek), and frozen in ice-cold 2-methylbutane. Cryostat sections were cut at 5 µm thickness, thaw mounted on gelatinized slides, air dried, fixed for 10 min in ice-cold acetone, and stored at –80°C. Sections were rehydrated in PBS for 30 min, blocked in PBS/5% FCS/purified CD16/CD32 Ab (eBioscience) for 30 min, and further incubated with the Abs diluted in PBS/5% FCS. Subsequently, slides were washed in PBS and mounted with the Immuno-Fluore Mounting Medium (MP Biomedicals). Pictures were taken on a krypton/aragon laser confocal system (MRC1024; Bio-Rad). Image processing was conducted with a Laser-Sharp computer software. The following reagents were used: PE-CD45R/B220 (eBioscience), FITC-CD90.2/Thy-1.2 (BD Biosciences), biotin-conjugated anti-FDC-M2 (ImmunoKontact), biotin-conjugated anti-mucosal addressin cell adhesion molecule-1 (MAdCAM-1; eBioscience), biotinylated peanut agglutinin (Vector Laboratories), and purified anti-MOMA-1 (Serotec). Biotin-conjugated Abs were detected with streptavidin-FITC or streptavidin-PE conjugates (BD Pharmingen), the purified anti-MOMA Ab with anti-rat FITC secondary Ab (Serotec).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 Disclosures
 References
 
The PanR1 mutation affects TNF activity

The PanR1 phenotype was identified as a dominant trait in which TNF activity was reduced in the medium of thioglycolate-elicited peritoneal macrophages (conditioned medium) following stimulation of TLRs 1, 2, 3, 4, 6, or 9 (Fig. 1A). In homozygotes, TNF activity was undetectable following TLR stimulation (<0.1% the activity present in wild-type samples; Fig. 1B), whereas in heterozygotes, TNF bioactivity reaches one-eighth the wild-type values, consistent with a dominant-negative effect of mutant subunits on TNF trimer (Fig. 1B and data not shown) (37). TNF activity was abolished when LPS-conditioned medium was preincubated with an anti-TNF mAb, but was unaffected by an anti-Lta mAb that specifically inhibits Lta activity (38, 39), indicating that the latter cytokine makes a minimal contribution to the observed bioactivity (Fig. 1C). Finally, IL-6 was expressed at wild-type levels in these mice (data not shown). Because this cytokine, like TNF, is induced in an NF-{kappa}B-dependent manner (40), the PanR1 mutation was believed to affect a distal component of the TLR signaling pathway or TNF itself.

PanR1 is a mutation in Tnf

Based on 375 meioses, the PanR1 mutation was mapped to chromosome 17, proximal to the markers D17Mit51 and D17Mit93 (Fig. 2A), a region that contains the Tnf gene. A single base transversion 805 C->A (GenBank accession NM_013693] was identified in the fourth exon of Tnf, predicting the amino acid substitution P138T (Fig. 2B). P138 is a surface-accessible residue that interrupts an {alpha}-helical element separating two beta sheets (Fig. 2C) in close proximity to residues that have been shown to interact with the Tnfrsf1a receptor (region IV) (Fig. 2D) (37, 41, 42, 43).


Figure 2
View larger version (51K):
[in this window]
[in a new window]
  		FIGURE 2. Cloning, sequencing, and representation of the PanR1 mutation. A, Based on the analysis of 59 microsatellites in 375 meiotic recombination events, the PanR1 locus was confined to chromosome 17, proximal to the markers D17Mit51 and D17Mit93. B, DNA sequence of the gene coding for TNF in a C57BL/6J wild-type control (upper panel) and a PanR1 homozygous mouse (lower panel). The mutation is a C to A transversion that results in a proline to threonine substitution at aa 138. C, The 1.4Å resolution structure of the mouse TNF trimer (41 ). Only the backbone is represented, except for residue P138. The subunits are shown in blue, pink, and green; proline 138 in yellow; and region IV in red (aa 138–146, previously defined as important for receptor binding (37 41 42 43 )). D, Structure of the soluble human Tnfrsf1a (in green) and the human Lta (in blue) complex (one molecule of each kind) (42 ). Only the backbone is represented, except for the interacting amino acids, as demonstrated by crystallization and/or by point mutagenesis (Tnfrsf1a aa 67–81 (42 ) and TNF/Lta region I aa 30–32/47–49, respectively, and region IV aa 140–158/155–163, respectively (37 42 43 53 54 55 )). I154, the equivalent of P138 in Lta, as well as the adjacent proline (P155), are represented in yellow and red, respectively.

 
P138T affects the bioactivity of both TmTNF and solTNF

In response to LPS stimulation, TnfPanR1/PanR1, TnfPanR1/+, and wild-type macrophages secrete equivalent amounts of immunoreactive TNF (Fig. 3A). Moreover, TNF does not accumulate to high levels within LPS-stimulated mutant cells, and when either wild-type or mutant cells are stimulated in the presence of brefeldin A, comparable intracellular accumulation of the protein is observed (Fig. 3B). Hence, the mutation does not interfere with secretion of soluble TNF.


Figure 3
View larger version (15K):
[in this window]
[in a new window]
  		FIGURE 3. P138T does not affect TNF protein expression or secretion, but reduces both TmTNF and solTNF bioactivity. A, The concentration of TNF in medium control or in LPS-conditioned medium from C57BL/6J, TnfPanR1/+, and TnfPanR1/PanR1 macrophages was measured by ELISA. Each column represents an average of three mice; the error bars represent the SD. ND = nondetectable. B, Detection of intracellular and membrane-bound TNF. Macrophages from wild-type and TnfPanR1/PanR1 mice were unstimulated or activated with LPS in the presence or absence of brefeldin A, stained for intracellular TNF, and analyzed by flow cytometry. C, solTNF and TmTNF bioactivities were tested by stimulating Tnf–/–, TnfPanR1/PanR1, TnfPanR1/+, or wild-type macrophages with LPS or LPS and the TACE inhibitor TAPI-2. solTNF was tested in the LPS-conditioned medium, whereas TmTNF activity was measured directly by incubating the paraformaldehyde-fixed LPS/TAPI-2-activated macrophages on L929 cells. Each column represents the average of serial dilutions of four mice samples per genotype, assayed in duplicates. All error bars indicate SD.

 
To examine the effect of P138T on TmTNF and solTNF bioactivity, macrophages from mice bearing a deletion of the first exon and part of the first intron of Tnf (Tnf–/–), TnfPanR1/PanR1, TnfPanR1/+, and wild-type mice were activated with LPS alone, or LPS together with the TACE inhibitor TAPI-2 (LPS/TAPI-2) (Fig. 3C). SolTNF activity was measured in LPS-conditioned medium, whereas TmTNF activity was assayed by incubating paraformaldehyde-fixed LPS/TAPI-2-activated macrophages on L929 cells. TNF bioactivity in the conditioned medium (solTNF), as well as in the cell samples (TmTNF), was found to be decreased in TnfPanR1/PanR1, TnfPanR1/+ samples as compared with wild-type controls, indicating that the P138T mutation affects both forms of the protein.

The P138T mutation interferes with the ability of the TNF trimer to bind the Tnfrsf1a receptor

To determine whether the P138T mutation affects trimer formation, we tested the ability of P138T-TNF to interact with human TNF (Fig. 4A). Conditioned medium from LPS-stimulated TnfPanR1/PanR1 macrophages was mixed with increasing amounts of human FLAG-tagged TNF, and heterocomplexes were identified with anti-mouse TNF capture and anti-FLAG detection Ab. Under these experimental conditions, only mixed heterotrimers, consisting of both human and mouse TNF monomers, produce an ELISA signal. The results indicate that subunits of wild-type and P138T-TNF are equally efficient in exchanging with subunits of human TNF.


Figure 4
View larger version (21K):
[in this window]
[in a new window]
  		FIGURE 4. P138T interferes with TNF/Tnfrsf1a interaction, but not with TNF trimerization. A, Fixed concentrations of TNF from wild-type or TnfPanR1/PanR1 LPS-conditioned medium were incubated with increasing amount of wild-type human FLAG-TNF. Complexes were detected by sandwich ELISA using a capture anti-mouse TNF and a detecting anti-FLAG Ab. This combination allows the detection of FLAG-human/mouse TNF heterocomplexes only. B, Fixed concentration (20 ng/ml) of TNF from wild-type, TnfPanR1/PanR1, or TnfPanR1/+ LPS-conditioned medium, or a medium control was incubated for 2 h with an immobilized Tnfrsf1a-Fc chimeric receptor, equivalent to those described elsewhere (56 ). Complexes were detected with a biotin-conjugated monoclonal anti-mouse TNF-streptavidin-HRP system. Each column represents the results of two binding assays in triplicates. Error bars show SD.

 
To examine whether the P138T mutation could affect the ability of mutant trimers to engage the receptor, TNF from TnfPanR1/PanR1, TnfPanR1/+, and wild-type LPS-conditioned medium was incubated with an immobilized chimeric molecule in which the mouse Tnfrsf1a ectodomain was fused to an IgG Fc fragment. Bound TNF was revealed using an anti-mouse TNF Ab (Fig. 4B). The binding of TNF to its receptor was decreased in both homozygous and heterozygous samples, suggesting that the P138T mutation interferes with the ability of the TNF trimer to engage the receptor.

PanR1 mice are susceptible to L. monocytogenes infections

To study the impact of the PanR1 mutation in vivo, we challenged Tnf–/–, TnfPanR1/PanR1, and TnfPanR1/+ with luminescent L. monocytogenes, and monitored both survival and bacterial load for several days. When infected with an inoculum of bacteria known to be sublethal for wild-type mice (105 CFU/mouse), the Tnf–/– positive controls succumbed to infection within 5 days (Fig. 5A). Interestingly, TnfPanR1/PanR1 and TnfPanR1/+ mice were less susceptible, showing 10 and 50% survival 7 days postinfection, respectively. Survival of PanR1 homozygotes differed significantly from that of wild-type mice (p = 0.004), and also from that of Tnf–/– mice (p = 0.005). Survival of PanR1 heterozygote mice differed significantly from that of TnfPanR1/PanR1 (p = 0.04), but not from that of wild-type controls. Mortality was correlated with microbial burden. In Tnf–/– mice, the luminescence 2 days postinfection was significantly higher than in TnfPanR1/PanR1 mice, heterozygous, or wild-type mice. Taken together, these results demonstrate that PanR1 mutant mice show exaggerated susceptibility to L. monocytogenes infections, but also show that they are not as severely susceptible as mice made deficient for part of the Tnf locus.


Figure 5
View larger version (16K):
[in this window]
[in a new window]
  		FIGURE 5. PanR1 mutant mice are susceptible to L. monocytogenes infection. Mice were injected i.v. with 105 CFU of luminescent L. monocytogenes. A, Survival was scored over time, and B, luminescence was measured using an IVIS Imaging System (Xenogen) 2 days postinfection. The results are representative of several independent experiments. Values of p refer to differences in survival of mutant animals vs wild-type controls. Note that the survival rates for Tnf–/– and TnfPanR1/PanR1 mice are significantly different (p = 0.005). n is the starting number of mice per group; p values were obtained by a t test analysis. B, ***, p < 0.001 as compared with the C57BL/6 values.

 
Effect of the PanR1 mutation on development of the spleen and PP

To determine the effect of the P138T mutation on lymphoid organ architecture, we immunized TnfPanR1/PanR1, TnfPanR1/+, C57BL/6J, and Tnf–/– mice with a T cell-dependent Ag and compared their PP and spleens. In TnfPanR1/PanR1 and TnfPanR1/+ mice, wild-type numbers of dome-shaped PP were found, as compared with the reduced numbers of flat PP found in Tnf–/– mice (Fig. 6A). Further analysis of TnfPanR1/PanR1 and TnfPanR1/+ PP indicates that B cell follicles clearly segregated from the T cell-rich areas (Fig. 6B, row 1), and that GC develop normally in PP upon immunization (Fig. 6B, row 2). On the contrary, Tnf–/– PP consist in B cell-rich lymphoid aggregates without defined T cell zones and completely lack GC (Fig. 6B, rows 1 and 2).


Figure 6
View larger version (57K):
[in this window]
[in a new window]
  		FIGURE 6. PanR1 does not affect PP or the overall splenic lymphoid architecture. A, PP were counted in 6- to 8-wk-old mice. Each number corresponds to the number of PP observed in a single mouse. B, TnfPanR1/PanR1 and TnfPanR1/+ PP and spleen architecture is overall normal. Row 1, Frozen sections of PP from immunized mice were stained with B (anti-B220, red) and T (anti-Thy-1.2, green) lymphocyte-specific Ab. Note the flattened appearance of the patches and the absence of defined B cell follicles interdigited with T cell areas in Tnf–/– mice as compared with what is seen in wild-type, TnfPanR1/+, or TnfPanR1/PanR1 tissues. For each genotype, several PP from two to four mice were analyzed, and representative images are shown. Row 2, PP sections were stained with peanut agglutinin (PNA), which stains GC. Rows 3 and 4, Spleens of TnfPanR1/PanR1 and TnfPanR1/+ show normal formation of B cell follicles. Spleen sections were stained with anti-B220 (red) and anti-Thy-1.2 (green) Ab, row 4 being a magnification on the B-T cell-rich area border. Note the absence of B cell follicles, as well as the poorly defined B/T lymphocyte margin in Tnf–/– tissues, contrasting with the C57BL/6J and TnfPanR1/PanR1 and TnfPanR1/+ organs. Row 5, Spleen sections were stained with PNA to reveal GC formation upon immunization. Note the complete absence of GC in Tnf–/– spleens. Row 6, Staining with an anti-MAdCAM Ab reveals the absence of MAdCAM+ marginal sinus lining cells in Tnf–/–, as compared with TnfPanR1/PanR1 and TnfPanR1/+ mutant tissues. Row 7, Spleen sections were stained with an anti-MOMA-1-specific Ab, showing a normal presence of the metallophilic macrophages in TnfPanR1/PanR1 and TnfPanR1/+ mice. Row 8, The spleen sections were stained with an anti-FDC-M2 Ab. Note that in TnfPanR1/PanR1 and TnfPanR1/+ mutants the FDC network is present, but that the number of dendritic cells seems to be reduced as compared with wild-type controls.

 
In TnfPanR1/PanR1 and TnfPanR1/+ spleens, B cells were organized in primary follicles and clearly segregated from the T cells, whereas Tnf–/– controls only showed a ring-like structure of B cells partially mixing with the T cell area (Fig. 6B, rows 3 and 4). Upon immunization, GC did develop in TnfPanR1/PanR1 and TnfPanR1/+ spleens, but not in Tnf–/– controls (Fig. 6B, row 5). Moreover, the P138T mutation did not affect the integrity of the marginal zone, as shown by specific stainings against MAdCAM-1+ marginal sinus lining cells or MOMA+ marginal zone metallophilic macrophages (Fig. 6B, rows 6 and 7, respectively). As previously reported, and as observed in our controls, these two cell types are almost completely lost in Tnf–/– spleens. Finally, staining with an Ab specific for FDC indicated that the P138T mutation decreased the cell density in the FDC network as compared with wild-type controls, but not as much as what is observed in Tnf–/– controls that completely lack FDC network (Fig. 6B, row 8). Taken together, these results indicate that the P138T mutation does not affect formation and maintenance of PP, GC, splenic B cell follicles, and marginal zone, but does interfere to a certain degree with FDC network formation in the spleen.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
Disclosures
 References
 
TnfPanR1 (P138T) is the only dominant-negative allele of Tnf observed in vivo to date. It exists on a defined and sequenced genetic background, and is caused by a single nucleotide change. It offers a new means of examining the role of TNF without the confounding influence of linked mutations or cis-acting effects that might result from gene targeting. In the present study, we have used the mutation to analyze the contribution made by TNF to the host response to L. monocytogenes infection as well as to the development of lymphoid organs. However, the same allele could be used to determine the role of TNF in many other biological processes.

TNF monomers are elongated molecules composed of 10 antiparallel beta-strands that fold to form a sandwich of two beta-pleated sheets (44, 45, 46). The crystal structure of Lta (which exhibits a conformation similar to that of TNF (47)) bound to Tnfrsf1a, as well as the study of point mutations in Tnf, has defined four main regions involved in ligand-receptor interaction (regions I to IV) (37, 41, 42, 43). P138, and its equivalent amino acid in Lta (I154), are both located in the tight turn preceding region IV. It is conceivable that the replacement of P138 with a more bulky amino acid, like threonine, modifies the tertiary structure of region IV, disrupting the interaction with Tnfrsf1a without interfering with the ability of the molecule to engage in trimers. Our results are consistent with this interpretation. As observed with samples from activated homozygous PanR1 cells, mutant subunits undergo exchange with human wild-type subunits, leading to the formation of heterotrimers (Fig. 4A), demonstrating that P138T does not prevent TNF trimerization. The diminished activity of trimers containing one or more mutant subunits results from failure of interaction with Tnfrsf1a, reducing it to almost undetectable levels in homozygous mutant samples, and to intermediate levels in heterozygous samples (Fig. 4B).

TNF and its receptor have been shown to offer protection against numerous intracellular pathogens (6, 7, 8, 9, 10, 12, 25, 48, 49, 50). Moreover, TmTNF can offer protection independent of solTNF (9, 25). The P138T mutation disrupts both TmTNF and solTNF activity, as indicated by direct measurement of TmTNF- or solTNF-mediated L929 cell lysis (Fig. 3C). Moreover, the mutation has a clear immunocompromising effect in vivo. TnfPanR1/PanR1 mice show a higher susceptibility to L. monocytogenes infections than wild-type controls, but not than Tnf–/– mice. Three major hypotheses might account for this discrepancy. First, the Tnf–/– allele used in our study exists on a mixed C57BL/6J x 129/Sv genetic background. We tested the Tnf–/– controls for 19 independent microsatellites spread over the genome and found that 2 of them (located on chromosomes 11 and 17) were of 129/Sv origin (data not shown), indicating that even after the targeted locus has been backcrossed to C57BL/6J repeatedly, genetic elements from the 129/Sv strain are still present. Because 129/Sv mice are more sensitive to L. monocytogenes infections than C57BL/6J mice as a result of genetic differences yet unknown (51), a direct comparison between the susceptibility phenotype of the Tnf deficiency and the PanR1 point mutation described in this study (which exists on a pure C57BL/6J background) is problematic. Second, it is known that Lta, Ltb, and Tnf are all located within an 11-Kbp region on mouse chromosome 17, and it has been shown that both Lta and Ltb play a significant role in the innate immune response against L. monocytogenes infections (52). It is then easily conceivable that Tnf gene targeting might produce variable cis-acting effects on the transcription of other genes, which could result in an increased susceptibility to the infection, while the point mutation described in this study would not be expected to do so. Finally, it is possible that the P138T variant is not entirely bereft of biological activity, although we conservatively estimate that each mutant trimer has <0.1% the activity of a wild-type trimer, and that this remaining activity could account for the slightly higher resistance of TnfPanR1/PanR1 mice to the infection as compared with the Tnf–/– controls used in this study.

Spleen and PP architecture are severely affected in mice with targeted deletions of the gene encoding TNF. However, not all of the phenotypic effects reported in these deficient strains are consistent (9, 10, 28, 29, 30, 31). Most notably, the size, number, and architecture of PP in Tnf–/– mice have been controversial. Reduced numbers of disorganized PP have been reported in some of these strains (28, 29, 31), while absence of these same organs has been reported in others (29). The P138T mutation does not affect the development of PP or the formation of GC in these secondary lymphoid organs upon immunization (Fig. 6). Also, the integrity of B cell follicles, marginal zone, as well as the formation of GC in the spleen do not seem to be affected by the P138T mutation, as compared with Tnf–/– mice in which all of these structures are disrupted. Interestingly, the P138T mutation does affect the formation of the FDC network, but not as much as what is observed in a mouse made deficient for part of the TNF locus. Here again, the importance of Lta, Ltb, as well as the Lta/b heterotrimer receptor Ltb receptor for lymphoid organs development has been well documented (34), and we can speculate that an even modest effect of the TNF locus targeting on the expression of these genes can synergize with the complete lack of TNF, exacerbating the lymphoid organ development defect observed in these mice. In contrast, we cannot completely exclude that a minimal amount of active TNF in the PanR mutants, even <0.1%, could be sufficient to permit secondary lymphoid organ development and architecture maintenance, but might not be sufficient to permit the normal development of the FDC network.

The germline mutation reported in this work will permit analysis of the contribution that TNF makes to numerous biological processes, without the confounding influence of an undefined genetic background. The dominant-negative effect of the mutation also reveals a new variant that may influence TNF activity in vivo, and provides an animal model to test its efficacy.


   Acknowledgments
 
We thank Suzanne Mudd and Sosathya Sovath for the sequencing, Ben Croker for the help with immunohistochemistry, and Jessica Van Leeuwen for the animal care.


   Disclosures
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
References
 
The authors have no financial conflict of interest.


   Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 S.R. is supported by a Human Frontier Science Program fellowship. This work was supported by National Institutes of Health Grants AI054523 and GM060031. Back

2 Address correspondence and reprint requests to Dr. Bruce Beutler, The Scripps Research Institute, La Jolla, CA 92037. E-mail address: bruce{at}scripps.edu Back

3 Abbreviations used in this paper: TmTNF, 26-kDa transmembrane protein TNF; ENU, N-ethyl-N-nitrosourea; FDC, follicular dendritic cell; GC, germinal center; Lta, lymphotoxin-{alpha}; Ltb, lymphotoxin-beta; MAdCAM, mucosal addressin cell adhesion molecule; PP, Peyer’s patch; solTNF, 17-kDa soluble TNF; TACE, TNF{alpha}-converting enzyme; TAPi-2, TNF{alpha} processing inhibitor 2. Back

Received for publication November 16, 2005. Accepted for publication April 4, 2006.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Beutler, B., I. W. Milsark, A. C. Cerami. 1985. Passive immunization against cachectin/tumor necrosis factor protects mice from lethal effect of endotoxin. Science 229: 869-871. [Abstract/Free Full Text]
  2. Beutler, B., A. Cerami. 1989. The biology of cachectin/TNF: a primary mediator of the host response. Annu. Rev. Immunol. 7: 625-655. [Medline]
  3. Chen, G., D. V. Goeddel. 2002. TNF-R1 signaling: a beautiful pathway. Science 296: 1634-1635. [Abstract/Free Full Text]
  4. Hehlgans, T., K. Pfeffer. 2005. The intriguing biology of the tumor necrosis factor/tumor necrosis factor receptor superfamily: players, rules and the games. Immunology 115: 1-20. [Medline]
  5. Locksley, R. M., N. Killeen, M. J. Lenardo. 2001. The TNF and TNF receptor superfamilies: integrating mammalian biology. Cell 104: 487-501. [Medline]
  6. Garcia, I., Y. Miyazaki, K. Araki, M. Araki, R. Lucas, G. E. Grau, G. Milon, Y. Belkaid, C. Montixi, W. Lesslauer, et al 1995. Transgenic mice expressing high levels of soluble TNF-R1 fusion protein are protected from lethal septic shock and cerebral malaria, and are highly sensitive to Listeria monocytogenes and Leishmania major infections. Eur. J. Immunol. 25: 2401-2407. [Medline]
  7. Havell, E. A.. 1987. Production of tumor necrosis factor during murine listeriosis. J. Immunol. 139: 4225-4231. [Abstract]
  8. Havell, E. A.. 1989. Evidence that tumor necrosis factor has an important role in antibacterial resistance. J. Immunol. 143: 2894-2899. [Abstract]
  9. Pasparakis, M., L. Alexopoulou, V. Episkopou, G. Kollias. 1996. Immune and inflammatory responses in TNF {alpha}-deficient mice: a critical requirement for TNF {alpha} in the formation of primary B cell follicles, follicular dendritic cell networks and germinal centers, and in the maturation of the humoral immune response. J. Exp. Med. 184: 1397-1411. [Abstract/Free Full Text]
  10. Pfeffer, K., T. Matsuyama, T. M. Kundig, A. Wakeham, K. Kishihara, A. Shahinian, K. Wiegmann, P. S. Ohashi, M. Kronke, T. W. Mak. 1993. Mice deficient for the 55 kd tumor necrosis factor receptor are resistant to endotoxic shock, yet succumb to L. monocytogenes infection. Cell 73: 457-467. [Medline]
  11. Plitz, T., U. Huffstadt, R. Endres, E. Schaller, T. W. Mak, H. Wagner, K. Pfeffer. 1999. The resistance against Listeria monocytogenes and the formation of germinal centers depend on a functional death domain of the 55 kDa tumor necrosis factor receptor. Eur. J. Immunol. 29: 581-591. [Medline]
  12. Rothe, J., W. Lesslauer, H. Lotscher, Y. Lang, P. Koebel, F. Kontgen, A. Althage, R. Zinkernagel, M. Steinmetz, H. Bluethmann. 1993. Mice lacking the tumor necrosis factor receptor 1 are resistant to TNF-mediated toxicity but highly susceptible to infection by Listeria monocytogenes. Nature 364: 798-802. [Medline]
  13. Kindler, V., A. P. Sappino, G. E. Grau, P. F. Piguet, P. Vassalli. 1989. The inducing role of tumor necrosis factor in the development of bactericidal granulomas during BCG infection. Cell 56: 731-740. [Medline]
  14. Feldmann, M.. 2002. Development of anti-TNF therapy for rheumatoid arthritis. Nat. Rev. Immunol. 2: 364-371. [Medline]
  15. Feldmann, M., R. N. Maini. 2001. Anti-TNF {alpha} therapy of rheumatoid arthritis: what have we learned?. Annu. Rev. Immunol. 19: 163-196. [Medline]
  16. Sands, B. E.. 2004. Why do anti-tumor necrosis factor antibodies work in Crohn’s disease?. Rev. Gastroenterol. Disord. 4: (Suppl. 3):S10-S17. [Medline]
  17. Mak, T. W., W. C. Yeh. 2002. Signaling for survival and apoptosis in the immune system. Arthritis Res. 4: (Suppl. 3):S243-S252. [Medline]
  18. Galon, J., I. Aksentijevich, M. F. McDermott, J. J. O’Shea, D. L. Kastner. 2000. TNFRSF1A mutations and autoinflammatory syndromes. Curr. Opin. Immunol. 12: 479-486. [Medline]
  19. Black, R. A., C. T. Rauch, C. J. Kozlosky, J. J. Peschon, J. L. Slack, M. F. Wolfson, B. J. Castner, K. L. Stocking, P. Reddy, S. Srinivasan, et al 1997. A metalloproteinase disintegrin that releases tumor-necrosis factor-{alpha} from cells. Nature 385: 729-733. [Medline]
  20. Moss, M. L., S. L. Jin, M. E. Milla, D. M. Bickett, W. Burkhart, H. L. Carter, W. J. Chen, W. C. Clay, J. R. Didsbury, D. Hassler, et al 1997. Cloning of a disintegrin metalloproteinase that processes precursor tumor-necrosis factor-{alpha}. Nature 385: 733-736. [Medline]
  21. Kriegler, M., C. Perez, K. DeFay, I. Albert, S. D. Lu. 1988. A novel form of TNF/cachectin is a cell surface cytotoxic transmembrane protein: ramifications for the complex physiology of TNF. Cell 53: 45-53. [Medline]
  22. Ruuls, S. R., R. M. Hoek, V. N. Ngo, T. McNeil, L. A. Lucian, M. J. Janatpour, H. Korner, H. Scheerens, E. M. Hessel, J. G. Cyster, et al 2001. Membrane-bound TNF supports secondary lymphoid organ structure but is subservient to secreted TNF in driving autoimmune inflammation. Immunity 15: 533-543. [Medline]
  23. Canault, M., F. Peiretti, C. Mueller, F. Kopp, P. Morange, S. Rihs, H. Portugal, I. Juhan-Vague, G. Nalbone. 2004. Exclusive expression of transmembrane TNF-{alpha} in mice reduces the inflammatory response in early lipid lesions of aortic sinus. Atherosclerosis 172: 211-218. [Medline]
  24. Mueller, C., N. Corazza, S. Trachsel-Loseth, H. P. Eugster, M. Buhler-Jungo, T. Brunner, M. A. Imboden. 1999. Noncleavable transmembrane mouse tumor necrosis factor-{alpha} (TNF{alpha}) mediates effects distinct from those of wild-type TNF{alpha} in vitro and in vivo. J. Biol. Chem. 274: 38112-38118. [Abstract/Free Full Text]
  25. Olleros, M. L., R. Guler, N. Corazza, D. Vesin, H. P. Eugster, G. Marchal, P. Chavarot, C. Mueller, I. Garcia. 2002. Transmembrane TNF induces an efficient cell-mediated immunity and resistance to Mycobacterium bovis bacillus Calmette-Guerin infection in the absence of secreted TNF and lymphotoxin-{alpha}. J. Immunol. 168: 3394-3401. [Abstract/Free Full Text]
  26. Fu, Y. X., D. D. Chaplin. 1999. Development and maturation of secondary lymphoid tissues. Annu. Rev. Immunol. 17: 399-433. [Medline]
  27. Mebius, R. E.. 2003. Organogenesis of lymphoid tissues. Nat. Rev. Immunol. 3: 292-303. [Medline]
  28. Korner, H., M. Cook, D. S. Riminton, F. A. Lemckert, R. M. Hoek, B. Ledermann, F. Kontgen, B. Fazekas de St Groth, J. D. Sedgwick. 1997. Distinct roles for lymphotoxin-{alpha} and tumor necrosis factor in organogenesis and spatial organization of lymphoid tissue. Eur. J. Immunol. 27: 2600-2609. [Medline]
  29. Kuprash, D. V., A. V. Tumanov, D. J. Liepinsh, E. P. Koroleva, M. S. Drutskaya, A. A. Kruglov, A. N. Shakhov, E. Southon, W. J. Murphy, L. Tessarollo, et al 2005. Novel tumor necrosis factor-knockout mice that lack Peyer’s patches. Eur. J. Immunol. 35: 1592-1600. [Medline]
  30. Marino, M. W., A. Dunn, D. Grail, M. Inglese, Y. Noguchi, E. Richards, A. Jungbluth, H. Wada, M. Moore, B. Williamson, et al 1997. Characterization of tumor necrosis factor-deficient mice. Proc. Natl. Acad. Sci. USA 94: 8093-8098. [Abstract/Free Full Text]
  31. Pasparakis, M., L. Alexopoulou, M. Grell, K. Pfizenmaier, H. Bluethmann, G. Kollias. 1997. Peyer’s patch organogenesis is intact yet formation of B lymphocyte follicles is defective in peripheral lymphoid organs of mice deficient for tumor necrosis factor and its 55-kDa receptor. Proc. Natl. Acad. Sci. USA 94: 6319-6323. [Abstract/Free Full Text]
  32. Le Hir, M., H. Bluethmann, M. H. Kosco-Vilbois, M. Muller, F. di Padova, M. Moore, B. Ryffel, H. P. Eugster. 1996. Differentiation of follicular dendritic cells and full antibody responses require tumor necrosis factor receptor-1 signaling. J. Exp. Med. 183: 2367-2372. [Abstract/Free Full Text]
  33. Neumann, B., A. Luz, K. Pfeffer, B. Holzmann. 1996. Defective Peyer’s patch organogenesis in mice lacking the 55-kD receptor for tumor necrosis factor. J. Exp. Med. 184: 259-264. [Abstract/Free Full Text]
  34. Tumanov, A. V., D. V. Kuprash, S. A. Nedospasov. 2003. The role of lymphotoxin in development and maintenance of secondary lymphoid tissues. Cytokine Growth Factor Rev. 14: 275-288. [Medline]
  35. Garrelds, I. M., F. J. Zijlstra, C. J. Tak, I. L. Bonta, I. Beckmann, S. Ben-Efraim. 1993. A comparison between two methods for measuring tumor necrosis factor in biological fluids. Agents Actions 38: C89-C91. Spec No. [Medline]
  36. Portnoy, D. A., P. S. Jacks, D. J. Hinrichs. 1988. Role of hemolysin for the intracellular growth of Listeria monocytogenes. J. Exp. Med. 167: 1459-1471. [Abstract/Free Full Text]
  37. Steed, P. M., M. G. Tansey, J. Zalevsky, E. A. Zhukovsky, J. R. Desjarlais, D. E. Szymkowski, C. Abbott, D. Carmichael, C. Chan, L. Cherry, et al 2003. Inactivation of TNF signaling by rationally designed dominant-negative TNF variants. Science 301: 1895-1898. [Abstract/Free Full Text]
  38. Browning, J. L., I. D. Sizing, P. Lawton, P. R. Bourdon, P. D. Rennert, G. R. Majeau, C. M. Ambrose, C. Hession, K. Miatkowski, D. A. Griffiths, et al 1997. Characterization of lymphotoxin-{alpha} beta complexes on the surface of mouse lymphocytes. J. Immunol. 159: 3288-3298. [Abstract]
  39. Mackay, F., P. R. Bourdon, D. A. Griffiths, P. Lawton, M. Zafari, I. D. Sizing, K. Miatkowski, A. Ngam-ek, C. D. Benjamin, C. Hession, et al 1997. Cytotoxic activities of recombinant soluble murine lymphotoxin-{alpha} and lymphotoxin-{alpha} beta complexes. J. Immunol. 159: 3299-3310. [Abstract]
  40. Pahl, H. L.. 1999. Activators and target genes of Rel/NF-{kappa}B transcription factors. Oncogene 18: 6853-6866. [Medline]
  41. Baeyens, K. J., H. L. De Bondt, A. Raeymaekers, W. Fiers, C. J. De Ranter. 1999. The structure of mouse tumor-necrosis factor at 1.4 A resolution: towards modulation of its selectivity and trimerization. Acta Crystallogr. D Biol. Crystallogr. 55: 772-778. [Medline]
  42. Banner, D. W., A. D’Arcy, W. Janes, R. Gentz, H. J. Schoenfeld, C. Broger, H. Loetscher, W. Lesslauer. 1993. Crystal structure of the soluble human 55 kd TNF receptor-human TNF beta complex: implications for TNF receptor activation. Cell 73: 431-445. [Medline]
  43. Yamagishi, J., H. Kawashima, N. Matsuo, M. Ohue, M. Yamayoshi, T. Fukui, H. Kotani, R. Furuta, K. Nakano, M. Yamada. 1990. Mutational analysis of structure-activity relationships in human tumor necrosis factor-{alpha}. Protein Eng. 3: 713-719. [Abstract/Free Full Text]
  44. Eck, M. J., S. R. Sprang. 1989. The structure of tumor necrosis factor-{alpha} at 2.6 A resolution: implications for receptor binding. J. Biol. Chem. 264: 17595-17605. [Abstract/Free Full Text]
  45. Jones, E. Y., D. I. Stuart, N. P. Walker. 1989. Structure of tumor necrosis factor. Nature 338: 225-228. [Medline]
  46. Sprang, S. R., M. J. Eck. 1992. The 3-D structure of TNF. B. Beutler, ed. Tumor Necrosis Factor: The Molecules and Their Emerging Role in Medicine 11-32. Raven, New York.
  47. Eck, M. J., M. Ultsch, E. Rinderknecht, A. M. de Vos, S. R. Sprang. 1992. The structure of human lymphotoxin (tumor necrosis factor-beta) at 1.9-A resolution. J. Biol. Chem. 267: 2119-2122. [Abstract/Free Full Text]
  48. Flynn, J. L., M. M. Goldstein, J. Chan, K. J. Triebold, K. Pfeffer, C. J. Lowenstein, R. Schreiber, T. W. Mak, B. R. Bloom. 1995. Tumor necrosis factor-{alpha} is required in the protective immune response against Mycobacterium tuberculosis in mice. Immunity 2: 561-572. [Medline]
  49. Peschon, J. J., D. S. Torrance, K. L. Stocking, M. B. Glaccum, C. Otten, C. R. Willis, K. Charrier, P. J. Morrissey, C. B. Ware, K. M. Mohler. 1998. TNF receptor-deficient mice reveal divergent roles for p55 and p75 in several models of inflammation. J. Immunol. 160: 943-952. [Abstract/Free Full Text]
  50. Kolls, J., K. Peppel, M. Silva, B. Beutler. 1994. Prolonged and effective blockade of tumor necrosis factor activity through adenovirus-mediated gene transfer. Proc. Natl. Acad. Sci. USA 91: 215-219. [Abstract/Free Full Text]
  51. Cheers, C., I. F. McKenzie. 1978. Resistance and susceptibility of mice to bacterial infection: genetics of listeriosis. Infect. Immun. 19: 755-762. [Abstract/Free Full Text]
  52. Roach, D. R., H. Briscoe, B. M. Saunders, W. J. Britton. 2005. Independent protective effects for tumor necrosis factor and lymphotoxin {alpha} in the host response to Listeria monocytogenes infection. Infect. Immun. 73: 4787-4792. [Abstract/Free Full Text]
  53. Van Ostade, X., J. Tavernier, T. Prange, W. Fiers. 1991. Localization of the active site of human tumor necrosis factor (hTNF) by mutational analysis. EMBO J. 10: 827-836. [Medline]
  54. Van Ostade, X., P. Vandenabeele, J. Tavernier, W. Fiers. 1994. Human tumor necrosis factor mutants with preferential binding to and activity on either the R55 or R75 receptor. Eur. J. Biochem. 220: 771-779. [Medline]
  55. Zhang, X. M., I. Weber, M. J. Chen. 1992. Site-directed mutational analysis of human tumor necrosis factor-{alpha} receptor binding site and structure-functional relationship. J. Biol. Chem. 267: 24069-24075. [Abstract/Free Full Text]
  56. Peppel, K., D. Crawford, B. Beutler. 1991. A tumor necrosis factor (TNF) receptor-IgG heavy chain chimeric protein as a bivalent antagonist of TNF activity. J. Exp. Med. 174: 1483-1489. [Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Proc. Natl. Acad. Sci. USAHome page
B. A. Croker, B. R. Lawson, S. Rutschmann, M. Berger, C. Eidenschenk, A. L. Blasius, E. M. Y. Moresco, S. Sovath, L. Cengia, L. D. Shultz, et al.
Inflammation and autoimmunity caused by a SHP1 mutation depend on IL-1, MyD88, and a microbial trigger
PNAS, September 30, 2008; 105(39): 15028 - 15033.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
J. Zalevsky, T. Secher, S. A. Ezhevsky, L. Janot, P. M. Steed, C. O'Brien, A. Eivazi, J. Kung, D.-H. T. Nguyen, S. K. Doberstein, et al.
Dominant-Negative Inhibitors of Soluble TNF Attenuate Experimental Arthritis without Suppressing Innate Immunity to Infection
J. Immunol., August 1, 2007; 179(3): 1872 - 1883.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rutschmann, S.
Right arrow Articles by Beutler, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rutschmann, S.
Right arrow Articles by Beutler, B.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS