The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Carlyle, J. R.
Right arrow Articles by Makrigiannis, A. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Carlyle, J. R.
Right arrow Articles by Makrigiannis, A. P.
The Journal of Immunology, 2006, 176: 7511-7524.
Copyright © 2006 by The American Association of Immunologists

Molecular and Genetic Basis for Strain-Dependent NK1.1 Alloreactivity of Mouse NK Cells1

James R. Carlyle2,*, Aruz Mesci*, Belma Ljutic3,*, Simon Belanger{dagger}, Lee-Hwa Tai{dagger}, Etienne Rousselle{dagger}, Angela D. Troke{dagger}, Marie-France Proteau{dagger} and Andrew P. Makrigiannis2,{dagger}

* Department of Immunology, University of Toronto, Sunnybrook and Women’s Research Institute, Toronto, ON, Canada; {dagger} Laboratory of Molecular Immunology, Institut de Recherches Cliniques de Montréal, Montréal, QC, Canada


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
NK1.1 alloantigen expression can be used to define NK cells in certain mouse strains, such as B6 (NKR-P1C) and SJL (NKR-P1B). However, BALB/c NK cells do not react with the anti-NK1.1 mAb, PK136. To investigate the NK1.1 phenotype of BALB/c NK cells, we have undertaken NK1.1 epitope mapping and genomic analysis of the BALB/c Nkrp1 region. Bacterial artificial chromosome library analysis reveals that, unlike the Ly49 region, the Nkrp1-Ocil/Clr region displays limited genetic divergence between B6 and BALB/c mice. In fact, significant divergence is confined to the Nkrp1b and Nkrp1c genes. Strikingly, the B6 Nkrp1d gene appears to represent a divergent allele of the Nkrp1b gene in BALB/c mice and other strains. Importantly, BALB/c NK cells express abundant and functional Nkrp1 transcripts, and the BALB/c NKR-P1B receptor functionally binds Ocil/Clr-b ligand. However, the BALB/c NKR-P1B/C sequences differ from those of the known NK1.1 alloantigens, and epitope mapping demonstrates that directed mutation of a single amino acid in the NKR-P1BBALB protein confers NK1.1 reactivity. Thus, PK136 mAb recognizes, in part, a distal C-terminal epitope present in NKR-P1BSw/SJL and NKR-P1CB6, but absent in NKR-P1A/D/FB6 and NKR-P1B/CBALB. Allelic divergence of the Nkrp1b/c gene products and limited divergence of the BALB/c Nkrp1-Ocil/Clr region explain a longstanding confusion regarding the strain-specific NK1.1 alloantigen reactivity of mouse NK cells.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
NK cells are large granular lymphocytes capable of recognizing and killing transformed, infected, Ab-coated, transplanted, and stressed cells (1, 2). Historically, NK cells from selected mouse strains have been phenotypically defined using NK-1 alloantigen-specific antisera (3) or the anti-NK1.1 mAb, PK136 (4). The NK1.1 alloantigen is now known to identify NK cells from CE, B6, NZB, C58, Ma/My, ST, SJL, FVB, and Swiss outbred mice, but not BALB/c, AKR, CBA, C3H, DBA, or 129 mice (3, 4, 5, 6, 7). In fact, the NK1.1 alloantigen was originally identified by immunizing BALB/c-background [(C3H x BALB)F1] host mice with donor CE splenocytes (3), and the same immunization protocol was used to generate the PK136 mAb (4). Immunologically, this precludes the possibility that BALB/c (self) NK cells would react with anti-NK1.1 alloantibodies or PK136 mAb; thus, by definition, BALB/c NK cells are NK1.1 (3, 4, 8). Due to conventional use of the B6 mouse strain and initial molecular cloning of an NK1.1 Ag from B6 NK cells (9), anti-NK1.1 reactivity has since become popularized as representing the product of the Nkrp1c gene; however, the Nkrp1b gene product also reacts with PK136 mAb (5, 6).

Nonetheless, the underlying molecular basis for the lack of NK1.1 reactivity of NK cells from BALB/c and other mouse strains remains an enigma. Previous studies have suggested that BALB/c NK cells either lack or possess low-level expression of the Nkrp1 genes, as detected by Northern blotting (10); however, no genetic basis for a BALB/c defect in Nkrp1 expression has been established. Thus, lack of NK1.1 reactivity could be due to deletion of Nkrp1 genes, defective gene expression, or allelic polymorphism in BALB/c mice. Extreme variation in gene content between the BALB/c and B6 haplotypes has been observed previously for the related Ly49 gene family (11). This suggests that other NK gene complex (NKC)4 regions, including the Nkrp1-Ocil/Clr region, also may be subject to rapid evolutionary divergence and/or polymorphism.

Importantly, since cognate NKR-P1 ligands have recently been identified (12, 13, 14), a BALB/c defect in NKR-P1 expression could be functionally significant for NK cell function and innate immunity. Moreover, while ligands for the stimulatory NKR-P1A/C receptors remain elusive, ligands for the inhibitory NKR-P1B/D receptors (12) and stimulatory NKR-P1F (13) receptors have been identified as products of the Ocil/Clr family of genes (15, 16, 17), which are intermingled with the Nkrp1 genes themselves in the NKC (18). Thus, determination of the gene content of the BALB/c Nkrp1-Ocil/Clr region and the basis of the BALB/c defect in NK1.1 expression could have implications for the importance of the NKR-P1–Ocil/Clr system in self-nonself discrimination in mice and other species. Therefore, we have undertaken NK1.1 epitope mapping and genomic analysis of the BALB/c Nkrp1 region to determine the functional significance of the NKR-P1 recognition system in NK1.1 mouse strains.

In this study, we demonstrate that the BALB/c genome possesses a full complement of Nkrp1 and Ocil/Clr genes, including novel family members present in both B6 and BALB/c mice. Furthermore, BALB/c NK cells possess normal Nkrp1 expression relative to B6 NK cells, and the BALB/c NKR-P1B receptor functionally binds cognate Ocil/Clr-b ligand. Absent NK1.1 reactivity of BALB/c NK cells can be explained by Nkrp1 allelic divergence, specifically a single amino acid substitution (S191T) present in the BALB/c NKR-P1B/C receptors. In fact, divergence between the B6 and BALB/c Nkrp1-Ocil/Clr regions appears to be localized to the Nkrp1b/c genes, and the B6 Nkrp1d gene appears to be an allele of the Nkrp1b gene found in BALB/c and other mouse strains. These results confirm the importance of the NKR-P1–Ocil/Clr recognition system across strain boundaries, and suggest that this mode of self-nonself discrimination is conserved in other NK1.1 mouse strains, as well as other species.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Mice

Mice were purchased from the Charles River Laboratories National Cancer Institute–Frederick Animal Production Area (Frederick, MD), and/or maintained in our own animal facilities.

Cells

BWZ.36 cells (19) were obtained from Dr. N. Shastri (University of California, Berkeley, CA). The 293T cells were obtained from Dr. D. Raulet (University of California, Berkeley, CA). Cells were grown in complete DMEM-HG (high glucose, 10% FCS). All cells were maintained at 37°C in a humidified 5% CO2 atmosphere.

Expression constructs and NKR-P1 mutants

Mouse Nkrp1b (National Institutes of Health–Swiss–Sw) and Nkrp1a/c/d (C57BL/6–B6) constructs were generated previously (5). Mouse Nkrp1e/f cDNAs were amplified from NK libraries using the following primers: P1E-F, ATGGACACAGAAAGGATCTACCTC; P1E-R, TCAGGAGTCATGAAATATGGTTTC; and P1F-F, ATGGACACATCAAAGGTCCATG; P1F-R, TCAGACATGTATCAGGGTCTTTTG. Rat Nkrp1a/b cDNA clones (20) were generously provided by Dr. R. G. Miller (Ontario Cancer Institute, Toronto, ON). Site-directed mutagenesis was performed by the method of gene splicing by overlap extension of DNA ends, as described previously (12). Briefly, known Nkrp1 sequences were amplified by PCR using specific 5' or 3' outside primers and complementary internal primers with specified point mutations; the resulting products were then mixed and amplified using the outside primers alone to obtain the full-length mutant cDNA. All PCR products were directly cloned into pcDNA3.1/V5/HIS/TOPO (Invitrogen Life Technologies), and constructs were sequenced to confirm their identities. The resulting constructs were cotransfected into 293T cells using Effectene reagent (Qiagen) with a pCMV-GFP-nuclear localization sequence reporter, or subcloned into the pMSCV2.2-CMV-IRES-GFP (pMCIG) retroviral vector (12) before transfection into 293T cells. Transfection efficiencies were monitored by GFP expression, and transfection results are shown gated on GFP+ cells for all contstructs tested.

Flow cytometry and cell sorting

Cells were stained as described previously (21). Stained cells were analyzed using a FACSCalibur flow cytometer (BD Biosciences) or were sorted on a FACSDiVa (BD Biosciences). Sorted cells were >99% pure, as determined by postsort analysis.

Receptor fusions, retroviral infections, and BWZ assay

A pMSCV2.2-CMV-IRES-GFP (pMCIG) retroviral vector (12) was modified to include a CD3{zeta}/NKRP1B cassette (intracellular region of CD3{zeta}, membrane proximal and transmembrane regions of NKR-P1B). The CD3{zeta}/NKRP1B fusion cassette was generated by gene SOEing using the following primers: SALCD3Z-F, GTCGACATGAGAGCAAAATTCAGCAGGAGT G; CD3ZP1B-R, GCGAGGGCACCGACAGCGAGGGGCCAGGGTCTGC; CD3ZP1B-F, ACCCTGGCCCCTCGCTGTCGGTGCCCTCGCTGGCATC; XHOP1BTM-R, CTCGAGTGATGATTTTTGTACTGATAG. The resulting product was TOPO TA-cloned (Invitrogen Life Technologies) and cut with SalI and XhoI (New England Biolabs), then ligated into pMCIG that had been linearized with XhoI and treated with CIP. cDNA inserts were subcloned into the modified cassette vector, pMC3BIG, using XhoI and NotI sites. BWZ.36 cells were infected with retroviral supernatants (24–48 h) from transient triple-transfected 293T cells, as described previously (12), then sorted at day 3–4 following infection. Stable BWZ transductants were analyzed using plate-bound mAb or cell mixtures, as described previously (12).

cDNA libraries

BALB/c DX5+ NK cell (22) and BALB/c-congenic C.B-17/SCID LAK (23) cDNA libraries were reported previously. The NKC of C.B-17/SCID (BALB/c.C57BL/Ka-Igh-1b scid/scid) mice has been confirmed to be BALB/c in gene content (Ref. 24 and data not shown). A (B6 x BALB/c)F1 LAK library was generously provided by Dr. R. G. Miller (Ontario Cancer Institute, Toronto, ON). A B6 DX5+ NK cell cDNA library was provided by Dr. H. Arase (Osaka University, Japan).

Evaluation of BAC gene content

BAC clones from the CHORI-28 BALB/c library (BACPAC Resources) containing Nkrp1 or Ocil/Clr genes were identified and size-estimated as described previously (25). The gene content of BACs was determined by PCR and sequencing of products. Briefly, ~10 ng of BAC DNA was subjected to PCR (94°C 30 s, 57°C 30 s, 72°C 1 min, 30 cycles) with primers capable of amplifying known and predicted BALB/c fragments of Nkrp1 and Ocil/Clr gene sequences (primers are shown in Table I). PCR products were separated on 1% agarose gels and visualized with ethidium bromide. PCR products of each size were cloned by TOPO TA-cloning into pCR2.1 (Invitrogen Life Technologies) and sequenced in-house using T7 and M13 reverse primers. All BAC PCR amplifications were performed using Taq polymerase on enriched, high-copy BAC DNA. Importantly, no mutations were detected between distinct PCR (i.e., at least two clones of each product from separate PCR were sequenced). Partial exon sequence allowed the identification of the Nkrp1 or Ocil/Clr gene that was amplified from each BAC clone. The partial gene sequences from the BALB/c BACs were deposited in GenBank under the following accession numbers: Nkrp1a (exons 3–5, DQ143102); Nkrp1b (exons 3–5, DQ143103); Nkrp1c (exon 1, DQ143106); Nkrp1c (exons 3–5, DQ336140); Nkrp1e (exon 2, DQ143104); Nkrp1f (exons 3–5, DQ143105); Nkrp1g (exons 3–5, DQ336141); Clr-a (exons 3–4, DQ143108); Clr-b (exons 3–4, DQ143111); Clr-c (3' end, DQ143114); Clr-d (exons 4–5, DQ143107); Clr-e (exons 4–5, DQ143109); Clr-f (exons 3–4, DQ143110); Clr-g (exons 3–4, DQ143112); and Clr-h (exons 3–4, DQ143113). Sequence-confirmed gene fragments were used in Southern blot analyses of BAC DNA to confirm Nkrp1-Ocil/Clr gene content as described previously (25).


View this table:
[in this window]
[in a new window]
 
Table I. Primers used to amplify Nkrp1-Ocil/Clr-related genes from BAC clones and cDNA

 
RT-PCR and cDNA library PCR

Full-length cDNA clones were obtained using fresh cDNA isolated from d6 BALB/c LAK cells (plastic-adherent IL-2 lymphokine-activated killer cells). RNA was isolated using TRIzol (Invitrogen Life Technologies) and reverse-transcribed into cDNA with SuperScript first-strand cDNA synthesis kit (Invitrogen Life Technologies). PCR conditions, visualization, cloning, and sequencing were performed as outlined above. Library cDNA PCR was performed using primers specific for either the full-length Nkrp1a/b/c coding regions (5) or the corresponding extracellular/3'-untranslated regions (21), under limiting cycle conditions (25 cycles PCR with 50 ng cDNA library, representing ~10–20 ng cDNA equivalents). For mammalian expression studies, PCR products were cloned directly into pcDNA3.1/V5/HIS/TOPO (Invitrogen Life Technologies) and sequenced to confirm identity and orientation. All cDNA PCR amplifications were performed using Expand High Fidelity enzyme (Roche Diagnostics), and sequences were determined from multiple clones from at least two separate PCR. Sequences were deposited in GenBank under the following accession numbers: Nkrp1aBALB, DQ237927; Nkrp1bBALB, DQ237928; Nkrp1cBALB, DQ237929; Nkrp1eBALB, DQ237930; and Nkrp1fBALB, DQ237931). Phylogenetic analysis was performed as described previously (26).

BAC end-sequence characterization

BAC DNA (1 µg) was sequenced in-house with T7 and SP6 primers. Based on end-sequence results, primers were designed to PCR-amplify the respective BAC ends. Products were cloned using a TOPO-pCR2.1 kit (Invitrogen) and sequences were confirmed. Cloned end-sequence fragments were radioactively labeled and used as probes in Southern blots of EcoRI-digested BAC DNA.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Divergence of the BALB/c and B6 Nkrp1-Ocil/Clr regions

One simple explanation for the NK1.1 phenotype of BALB/c NK cells is that the two genes known to confer NK1.1 reactivity, Nkrp1b and Nkrp1c, like Ly49d and Ly49h, may not be present in the BALB/c genome (11). BALB/c NK cells have been reported to be deficient in Nkrp1 transcripts, as detected by Northern blotting (10). Thus, lack of NK1.1 reactivity of BALB/c NK cells could be due to deletion of Nkrp1 genes or defective gene expression.

To investigate this possibility, we constructed a physical map of the BALB/c Nkrp1-Ocil/Clr region. To this end, a BALB/c genomic library, CHORI-28, was probed with a mixture of known Nkrp1 and Ocil/Clr cDNAs. Positive BAC clones were isolated and further screened by PCR using gene-specific primers for the known Nkrp1 and Ocil/Clr genes (Table I). PCR products were sequenced to confirm gene identity, and Southern blots of EcoRI-digested BACs were probed to confirm the presence of specific genes in each BAC clone (Table II). In some instances, the primer pairs cross-amplified closely related sequences (see Table I), resulting in the discovery of new gene fragments. One such novel sequence, cross-amplified using Clr-b primers, corresponds to an exon-3/intron-3/exon-4 (e3-i3-e4) genomic fragment resembling a near-identical (>99%) match to a sequence available from the latest B6 genome assembly (designated Clr-h; GenBank accession no. XM487965). The matching region in the B6 genome does not correspond to the location of any other known Clr gene. This suggests that the Clr-h sequence represents a new Clr family member conserved in the B6 and BALB/c genomes. In addition, a new gene was detected in the region between Clr-f and Nkrp1c based on Southern hybridization using an Nkrp1f probe. This sequence also resembles a near-identical (>99%) match in the B6 genome (designated Nkrp1g; GenBank accession no. XM355818) that does not correspond to the location of any other known Nkrp1 gene. Thus, two new genes, Clr-h and Nkrp1g, are conserved in the B6 and BALB/c genomes.


View this table:
[in this window]
[in a new window]
 
Table II. Gene content of BALB/c BAC clonesa

 
With the exception of the Nkrp1c and Nkrp1d primers, all primer pairs amplified the BALB/c allele of the intended gene. As a positive control, all B6-derived primers amplified the intended target sequence when B6 genomic DNA was used as a template. Sequencing of the BALB/c Nkrp1a/e/f and Clr-a/b/c/d/e/f/g gene fragments showed that all were highly related to their B6 counterparts (>98% identity). Three different primer pairs specific for Nkrp1cB6 gave variable results when BALB/c BACs were used as templates (see Table I): one set failed to produce any product; a second set cross-amplified Nkrp1e; and a third set cross-amplified both Nkrp1e and an exon-1 sequence identical with a known BALB/c Nkrp1 gene fragment, designated as gene-40 (GenBank accession no. X64720) (10). Although this latter fragment resembles Nkrp1a exon 1 in coding sequence, it was distinct from the Nkrp1aBALB sequence that we identified; therefore, because the gene-40 designation is synonymous with the Nkrp1c transcript in B6 mice, this sequence was designated Nkrp1cBALB. Primers specific for Nkrp1d amplified a product with a coding sequence very similar to that of the known Nkrp1b gene from Sw and SJL mice. This was surprising, considering that the Nkrp1b gene product is responsible for NK1.1 reactivity in Sw, SJL, and other mouse strains (5, 6, 7, 12).

In contrast with genomic PCR, PCR of cDNA libraries derived from BALB/c NK cells revealed the existence of an Nkrp1c-like transcript; however, only a partial extracellular domain fragment could be amplified, due to the location of the primers (data not shown). Southern analysis using this cDNA product, new fragments derived from the cDNA, and the previous genomic Nkrp1cBALB exon-1 fragment as probes (Fig. 1 and data not shown) revealed that the Nkrp1c-like gene resided centromeric to Nkrp1bBALB, approximating the location of Nkrp1c relative to Nkrp1d in the B6 genome (27). Hybridization with Nkrp1bBALB and Nkrp1cBALB probes showed that several BACs contained these genes (Fig. 1). Similarly, hybridization of the same BALB/c BACs with Nkrp1dB6 and Nkrp1cB6 probes revealed the same bands, albeit with weaker intensity (Fig. 1).


Figure 1
View larger version (45K):
[in this window]
[in a new window]
 
FIGURE 1. Identification of BALB/c genomic clones containing Nkrp1b/c. BALB/c BAC clones previously found to contain Nkrp1 sequences (by PCR) were confirmed in their gene content by Southern blotting. BAC DNA was digested with EcoRI, gel-separated, and transferred. The blot was consecutively hybridized with the indicated probes. For simplicity, only BACs positive for Nkrp1b or Nkrp1c are shown. Probes Nkrp1cB6 exons 3–5, Nkrp1dB6 exons 3–5, Nkrp1cBA exon 1, and Nkrp1bBA exons 3–5 are derived from BAC or genomic DNA. Probes Nkrp1cBA exons 3–5 and Nkrp1cBA exon 5–6 are derived from cDNA. BA, BALB/c; ex, exon.

 
A physical map for the BALB/c Nkrp1-Ocil/Clr gene cluster

A relative gene order of Nkrp1a, Clr-h, Clr-f, Nkrp1g, Nkrp1c, Nkrp1b, Clr-g, Clr-d, Clr-e, Clr-c, Nkrp1f, Clr-a, Nkrp1e, Clr-b, and Cd69 was revealed after assembling the BACs in order of gene content (Table II). There are some ambiguities in this assembly. Notably, the order of Clr-h and Clr-f in the BALB/c genome is unknown because of their identification on shared BACs; however, in the B6 genomic database, Clr-h lies centromeric to Clr-f and is transcribed in the opposite orientation. Similarly, Clr-c and Nkrp1f also were found on the same BACs, but their order is known in the B6 haplotype, with Clr-c lying centromeric to Nkrp1f.

To generate a physical map of the approximate relative location of each gene on the chromosome, the size of each BAC clone was ascertained by pulsed-field gel electrophoresis (Fig. 2 and data not shown). Using the gene content and size of each BAC, the approximate location of each gene on chromosome 6 of BALB/c mice was predicted (Fig. 2). The BALB/c Nkrp1-Ocil/Clr region is predicted to be ~640 kb in length (Nkrp1a exon 3 to Clr-b exon 4), with a possible range from 575 to 700 kb (Fig. 2). In previous gene-mapping studies, the entire B6 Nkrp1-Ocil/Clr cluster was predicted to be ~700 kb in length (16, 27); however, the exact length is unknown, as the B6 genome assembly for this region contains several gaps.


Figure 2
View larger version (23K):
[in this window]
[in a new window]
 
FIGURE 2. BAC contig overlap and construction of a physical map for the BALB/c Nkrp1-Ocil/Clr gene cluster. The BAC gene content from Table II and BAC sizing data (pulsed-field gel electrophoresis; data not shown) were integrated to produce a map of the relative location of all known BALB/c Nkrp1-Ocil/Clr genes. BACs are represented by horizontal lines, with the name and size of each given on the left side. •, the start of exon 4 of the indicated genes. The spacing between genes was based on the average of possible maximum and minimum sizes imposed by the BAC size and gene content. The scale bar (top) is demarcated in kilobases. The markers 387p19-SP6' and 358o7-SP6', represented by empty circles, are the end sequences of BACs 387p19 and 358o7, respectively. After cloning, these BAC end sequence fragments were used as probes to show that BACs 387p19 and 358o7 overlap, despite not sharing any Nkrp1-Ocil/Clr genes.

 
Determination of Nkrp1-Ocil/Clr haplotypes in different inbred mouse strains

Direct comparison of the gene content between BALB/c and B6 mice shows that at least 13 genes are conserved, including Nkrp1c and the novel, but shared, Clr-h and Nkrp1g genes (Fig. 3). The only BALB/c-specific gene was Nkrp1b, but this gene corresponded to the approximate location of Nkrp1d in the B6 genome (Fig. 2), and both the Nkrp1bBALB and Nkrp1dB6 probes hybridized to the same genes (Fig. 1). Thus, it is likely that the two designations actually represent different alleles of the same gene, especially since their transmembrane and cytoplasmic coding sequences are identical. Therefore, like the B6 and BALB/c Ly49 gene clusters, the Nkrp1-Ocil/Clr regions represented in these mice possess shared genes and have presumably diverged from an ancestral haplotype. However, unlike the Ly49 gene repertoire, that of the Nkrp1-Ocil/Clr genes appears to be highly conserved, perhaps with the exception of a seemingly directed divergence of Nkrp1b and Nkrp1c. These similarities and differences are apparent in Southern analyses of genomic DNA (Fig. 4A). The RFLP patterns generated by the Nkrp1f and Clr-f probes are similar in the two mouse strains, but the banding patterns resulting from the Nkrp1cB6 probe are distinct (Fig. 4A). Hybridization of the Nkrp1cB6 and Clr-f probes was conducted at lower stringency than that of Nkrp1f and confirms that the number of Nkrp1 and Ocil/Clr genes, as evidenced by cross-hybridizing genes, is similar in these two strains.


Figure 3
View larger version (19K):
[in this window]
[in a new window]
 
FIGURE 3. Comparison of gene content in the B6 and BALB Nkrp1-Ocil/Clr regions. The mouse NKC is depicted at the top, with major groups of NK cell receptor genes shown. Note that additional genes are present but are not shown for simplicity. Immediately below is an expanded view of the known genes in the B6 Nkrp1-Ocil/Clr region, and on the bottom, a diagram of the BALB/c region. Rectangles represent genes, and the arrows indicate transcriptional orientation.

 

Figure 4
View larger version (57K):
[in this window]
[in a new window]
 
FIGURE 4. Inference of Nkrp1-Ocil/Clr haplotypes in different inbred mouse strains by RFLP analysis. (A–C) Genomic DNA samples from the indicated mouse strains were digested with EcoRI, separated, and transferred to nylon membranes. The membranes were probed with the indicated probes containing exons 3–5. In A, DNA samples from three different animals of each strain are shown. Hybridization with the Nkrp1cB6 and Clr-fBALB probes was performed at less stringent conditions so that all Nkrp1- and Ocil/Clr-related fragments could be detected.

 
The only other well-characterized Ly49 strain haplotype, represented by the 129 group of inbred mice, is a third distinct haplotype more complex than that of either B6 or BALB/c mice (26). To determine whether the 129 strain Nkrp1-Ocil/Clr cluster is similar or divergent, genomic Southern blot analyses were performed (Fig. 4). Hybridization with Nkrp1bBALB and Nkrp1cB6 probes revealed that the 129-derived genomic DNA gave an identical RFLP pattern to that of BALB/c, suggesting the 129 and BALB/c strains share a similar Nkrp1-Ocil/Clr haplotype, in contrast with their Ly49 regions (Fig. 4B). In a third experiment, hybridization with the Nkrp1bBALB probe suggests that BALB/c, 129/Sv, 129S1, and FVB inbred mice have a similar Nkrp1 haplotype, one that is distinct from that of B6 mice (Fig. 4C). Hybridization with a Clr-hBALB probe shows that this gene is present in all five mouse strains (Fig. 4C). Interestingly, the same probe cross-hybridized to one band at 5.8 kb in the BALB/c and 129-group mice (most likely Clr-g and Clr-d, see Table II), but in B6 and FVB mice, a doublet (5.9 and 6.0 kb) was detected (Fig. 4C). Collectively, these data suggest that the commonly used inbred mouse strains have one of at least three distinct Nkrp1-Ocil/Clr haplotypes, represented by B6 (group 1), BALB/c and the 129-group (group 2), and FVB (group 3). These findings extend earlier work showing that the BALB/c and 129-strain Nkrp1 haplotypes belong to one of four RFLP groups, based on previous analysis of the Nkrp1a locus (28). In any case, BALB/c mice are not deficient in Nkrp1 gene content, so the lack of NK1.1 reactivity of BALB/c NK cells is not due to deletion of either the Nkrp1b or Nkrp1c genes.

BALB/c NK cells express abundant Nkrp1b and Nkrp1c transcripts

To obtain cDNA clones of the Nkrp1 genes from BALB/c mice, RT-PCR was performed on fresh BALB/c A-LAK cDNA and BALB/c NK cell cDNA libraries using multiple primer sets. This approach yielded full-length or near full-length cDNA clones for Nkrp1aBALB, Nkrp1bBALB, Nkrp1cBALB, Nkrp1eBALB, and Nkrp1fBALB (Fig. 5 and data not shown). This was unexpected, given that BALB/c NK cells were reported previously to lack detectable Nkrp1 expression in Northern blotting experiments (10). To determine whether Nkrp1b/c expression was specifically deficient in BALB/c mice, RT-PCR was applied to both BALB/c and B6 NK cell cDNA libraries using limited amounts of cDNA and amplification cycles. The Nkrp1 primer sets used have been previously reported, one set corresponding to the extracellular/3'-untranslated region (EC/UTR) (21), a second set corresponding to the full-length coding sequence (FL/CDS) regions (5). As shown in Fig. 5, Nkrp1 transcripts were easily detected in both strains. However, while the EC/UTR primers yielded a significant signal for Nkrp1cBALB, a FL/CDS Nkrp1cBALB signal could not be detected. This has been observed before for Sw strain NK cells (5, 21), and suggests that the primer sets used may be divergent compared with the Nkrp1cBALB sequence. Interestingly, note that the Nkrp1b FL/CDS primer set amplifies Nkrp1bSw (5), Nkrp1bSJL (6), and Nkrp1bBALB (Fig. 5; see below), whereas it also cross-amplifies Nkrp1dB6 (5, 6). Therefore, to confirm the cDNA identities, and determine the discrepancy of the Nkrp1cBALB results, all PCR products were sequenced.


Figure 5
View larger version (35K):
[in this window]
[in a new window]
 
FIGURE 5. PCR analysis of Nkrp1 transcript expression in BALB/c vs B6 NK cDNA libraries and fresh tissues. A, Limited cycle PCR analysis with high-fidelity polymerase was applied to clone BALB/c strain Nkr-p1 cDNA sequences. Shown for comparison are Nkr-p1 amplifications performed using a B6 NK cell cDNA library in parallel. Two sets of primers were used: EC/UTR primers correspond to the extracellular and 3'-untranslated region; FL/CDS primers correspond to the full-length coding sequence regions. The signals shown for Nkr-p1b/d are combined, as the primers amplify both sequences. B, Amplification of full-length Nkrp1c sequences from B6, BALB/c, and (B6xBALB)F1 LAK libraries using the upstream 5'-Nkrp1a and 3'-Nkrp1c primer combination. All PCR products were sequenced to confirm identity. C, RT-PCR analysis of Nkrp1-Ocil/Clr transcripts in fresh tissues. cDNA from B6 and BALB/c splenocytes (splen.), BALB/c GM-CSF-cultured bone marrow dendritic cells (DC), and BALB/c NK cells enriched from IL-2 cultured splenocytes (ALAK) are shown. NT, no template. All PCR products were cloned and sequenced to confirm their identity. Primers (see Table I) were designed based on available sequence to amplify only the BALB/c allele (Nkrp1cBALB, exons 3–5), or both B6 and BALB alleles (Nkrp1g, exons 3–5; Clr-b, full-length coding region; Clr-h, exons 1–5).

 
Sequencing results revealed that the EC/UTR Nkrp1cBALB PCR product was most highly related to the known Nkrp1cB6 sequence in overall BLAST score, followed by Nkrp1dB6, and Nkrp1bSw/SJL. Moreover, it shared 196 bp of nucleotide identity to the gene-40 partial sequence derived from BALB/c LAK cells (GenBank accession no. X64720) (10). As mentioned previously, the gene-40 sequence is also identical over 89 bp to the genomic Nkrp1cBALB exon-1 probe, confirming its Nkrp1cBALB designation. However, this sequence closely resembles Nkrp1a in its 5' region, which could confound attempts to amplify the full-length cDNA by PCR using the Nkrp1c 5' primer. Therefore, to take advantage of the sequence similarity, we used PCR amplification of cDNA libraries using a P1A-5'/P1C-3' combination of FL/CDS primers.

Interestingly, full-length transcripts for Nkrp1cBALB were detected equally in BALB/c, B6, and F1 LAK libraries by this method (Fig. 5B). Moreover, primers spanning exons 3–5 were capable of specifically detecting Nkrp1cBALB transcripts in fresh BALB/c but not B6 NK cells (Fig. 5C). Sequencing confirmed that the Nkrp1cBALB EC/UTR product, the P1A-5'/P1C-3' product, the Nkrp1cBALB exon 3–5 product, and the gene-40 sequence (GenBank accession no. X64720) (10) were all identical with one another. These results confirm the existence of a full-length coding Nkrp1c cDNA in BALB/c NK cells. However, comparison of the Nkrp1cBALB cDNA with the published Nkrp1cB6 cDNA reveals that they differ by 20 nonsynonymous substitutions in the extracellular coding region alone (Fig. 6A). Such divergent sequences would be expected to confound attempts using Northern blotting to compare expression of Nkrp1c transcripts between the two mouse strains (10). Notably, the similarity of the Nkrp1cBALB 5' region to Nkrp1aB6 is reminiscent of Ly49O129/C57L, which resembles Ly49AB6 upstream and Ly49DB6 downstream (29, 30).


Figure 6
View larger version (56K):
[in this window]
[in a new window]
 
FIGURE 6. Novel BALB/c and B6 Nkrp1-Ocil/Clr sequences. A, Alignment of the predicted coding sequences for the known Nkrp1 cDNAs is shown. Included are related sequences from various mouse strains: B6, C57BL/6; BA, BALB/c; SJ, Swiss/SJL; 29, 129. NKR-P1 functional features are highlighted at the top: ITIM, underlined; CxCP Lck-recruitment motif, boldface; charged transmembrane residue position, arrow. B, The coding sequence of Nkrp1-related cDNAs from mice (B6, BALB, Swiss/SJL), rats, humans, and chickens was aligned using ClustalX software (<ftp://ftp-igbmc.u-strasbg.fr/pub/ClustalX/>) and bootstrap analysis of 1000 data sets was performed with PHYLIP. The bootstrap values for each grouping are shown as a percentage. The phylogram branch lengths indicate the similarity between different cDNAs and the scale-bar indicates the percent divergence. The putative coding sequence for Nkrp1eB6 was artificially spliced together from genomic data. Nkrp1gB6 is a transcript predicted from the B6 genome (XM355818) and is 100% identical with the available Nkrp1g exons (3–5) from the BALB/c mouse. All genes shown are known from newly isolated or previously published cDNAs. The Nkrp1f coding sequence in B6 and BALB mice is identical. C, All known Clr-like cDNA sequences from B6 mice, rats, humans, and chickens were analyzed as described in B. Clr-h is a transcript predicted from the B6 genome (XM487965) and is 99% identical with the new Clr-like exon 3–4 fragment reported in this study.

 
In contrast with Nkrp1cBALB, the Nkrp1aBALB sequence differs from its B6 counterpart by only two nonsynonymous substitutions in its extracellular coding region, and the Nkrp1bBALB cDNA sequence is ~99% identical with Nkrp1bSw/SJL, differing by only three nonsynonymous substitutions in its extracellular coding region (Fig. 6A). The ITIM motif in the Nkrp1bBALB coding sequence is intact, and it lacks a charged residue in its transmembrane region, so this cDNA is predicted to code for a functional inhibitory transmembrane receptor. A near full-length (exon 5 deleted) in-frame cDNA clone of Nkrp1eBALB was also isolated by this method (Fig. 6A); in contrast, Nkrp1e is only known from single genomic exons in B6 mice (27). The Nkrp1fBALB cDNA sequence is identical with the published Nkrp1fB6 sequence (Fig. 6A). Three independent primer sets failed to amplify an Nkrp1gB6/BALB cDNA (Fig. 5C and data not shown), so this gene may represent a pseudogene, at least in the strains tested.

When these Nkrp1 sequences (and the B6 Ocil/Clr sequences) are compared over their coding regions, the Nkrp1bBALB and Nkrp1bSw/SJL sequences are closely associated with each other and with Nkrp1dB6 (Fig. 6B). The Nkrp1cBALB sequence is most closely related to the allelic sequence, Nkrp1cB6. All other BALB/c Nkrp1 genes are closely related to their B6 alleles. The novel gene, Clr-h, groups with the Clr-b/c/d/g clade (Fig. 6C). All Clr genes are shown without allele designation, as the BALB/c full-length coding sequences were not available for direct comparison.

Thus, while our results using RT-PCR differ from previous Northern blot analysis of Nkrp1 transcript expression in BALB/c mice, our sequencing analysis confirms and extends previous findings, where our Nkrp1a/b/cBALB sequences correspond to the BALB/c partial sequences of gene 2 (GenBank accession no. X64723), gene 34 (GenBank accession no. X64719), and gene 40 (GenBank accession no. X64720), respectively (10). Thus, BALB/c mice are not deficient in Nkrp1 expression, they simply possess divergent Nkrp1 sequences compared with those of B6 mice.

BALB/c NKR-P1B/C proteins lack NK1.1 reactivity due to allelic divergence

Our results demonstrate that BALB/c mice possess a full Nkrp1 gene content and normal Nkrp1b/c transcript expression in NK/LAK cells when compared with NK1.1+ mouse strains, suggesting that the basis of NK1.1 alloreactivity between these mouse strains may be due to divergence in NKR-P1 protein sequences. As shown in Fig. 7, NK1.1 reactivity is specific to NKR-P1BSw/SJL and NKR-P1CB6 among known NKR-P1 proteins from both mice and rats. However, sequence alignment of these proteins does not directly reveal an amino acid sequence unique to NK1.1+ vs NK1.1 isoforms (Fig. 7A and data not shown). Therefore, we limited our analysis to the mouse NKR-P1 isoforms, and further focused on differences between the mouse NKR-P1BSw/SJL and NKR-P1BBALB sequences, because the two differ in NK1.1 reactivity, but only differ in sequence by three amino acids (see Fig. 7A). Of these three substitutions in the NKR-P1BSw/SJL sequence, two were expected to be nonconservative, resulting in charge alterations in the NKR-P1BBALB isoform (D183V, E217K). However, the D183V substitution also is present in the NK1.1+ NKR-P1CB6 isoform, while the E217 amino acid is intact in the NK1.1 NKR-P1CBALB isoform. This left a seemingly conservative S191T substitution as a candidate determinant for NK1.1 epitope reactivity (Fig. 7A). Interestingly, both NK1.1-reactive isoforms (NKR-P1BSw/SJL, NKR-P1CB6) possess an S residue at this position, whereas all other mouse NKR-P1 sequences have substitutions, including NKR-P1BBALB (T), NKR-P1CBALB (T), NKR-P1DB6 (A), NKR-P1D129 (T), NKR-P1AB6/BALB (A), NKR-P1EB6/BALB (T), NKR-P1FB6/BALB (I), and the predicted NKR-P1GB6 (L). Therefore, to test the significance of this residue in conferring NK1.1 reactivity, the NKR-P1BBALB sequence was altered by site-directed mutagenesis.


Figure 7
View larger version (54K):
[in this window]
[in a new window]
 
FIGURE 7. NK1.1 epitope mapping of mouse NKR-P1 proteins. A, Amino acid alignment of the mouse NKR-P1 distal C-terminal sequences regions is shown. Residues that differ between NKR-P1BBALB and NKR-P1BSw/SJL are shown in boldface. {dagger}Predicted coding sequence from the B6 genomic database (XM355818) (B) NK1.1 reactivity of known mouse and rat NKR-P1 proteins. 293T cells were transfected with vectors encoding the indicated cDNA’s (plus GFP reporter vector; see Materials and Methods), then cells were analyzed by flow cytometry using the PK136 {alpha}-NK1.1 mAb. All transfections are shown gated on GFP+ transfected cells. C, NK1.1 reactivity of NKR-P1BBALB variants generated by site-directed mutagenesis. Shown are control NKR-P1BSw/SJL and NKR-P1BBALB transfectants of 293T cells (as in B), as well as NKR-P1BBALB (K217E) and NKR-P1BBALB (T191S) mutants (gated on GFP+ transfected cells).

 
As shown in Fig. 7C, the T191S mutation conferred NK1.1 reactivity to the NKR-P1BBALB protein, whereas a K217E control mutation, found natively in the NKR-P1CBALB sequence, did not alter NK1.1 reactivity. This demonstrates that a single amino acid substitution present in both the BALB/c NKR-P1B and NKR-P1C sequences is sufficient to explain the lack of NK1.1 reactivity of the BALB/c mouse strain. Furthermore, these results suggest that the basis of NK1.1 alloreactivity across mouse strains, including the original (C3H x BALB)F1 {alpha}-CE immunizations used to generate both the polyclonal {alpha}-NK-1 (3) and monoclonal {alpha}-NK1.1 (PK136; Ref. 4) specificities, is due to a single amino acid substitution in either NKR-P1B, NKR-P1C, or both receptors. Due to a lack of information about NKR-P1 expression in the CE mouse strain, we cannot distinguish these possibilities at present. Nonetheless, these results demonstrate that BALB/c mice are not deficient in NKR-P1 expression, rather they possess divergent NKR-P1 sequences sufficient to generate alloantibodies when immunized with NK cells from other mouse strains.

The BALB/c NKR-P1B receptor is functional and recognizes cognate Ocil/Clr-b ligand

Although BALB/c mice express functional NKR-P1B/C transcripts, it remains formally possible that BALB/c NK cells may be deficient in NKR-P1-mediated recognition, if substitutions in their NKR-P1 coding sequences lead to loss of ligand recognition. Although cognate ligands for the NKR-P1A/C receptors remain unknown, NKR-P1-mediated missing-self recognition of tumor cells has been shown to depend on functional recognition of Ocil/Clr-b ligand by the NKR-P1B/D inhibitory receptors in various mouse strains (12). Therefore, we tested whether the NKR-P1BBALB receptor is capable of recognizing Ocil/Clr-b ligand.

To do this, we used our previous modification of the BWZ reporter-cell assay (12, 19). In this study, expression of a chimeric CD3{zeta}/NKR-P1B fusion receptor on BWZ.36 reporter cells signals functional recognition of ligand expressed on the surface of intact target cells, via NFAT-driven beta-galactosidase enzyme expression. As shown previously, BWZ cells expressing the CD3{zeta}/NKR-P1BSw/SJL receptor are capable of recognizing target cells (either BWZ or 293T) expressing Ocil/Clr-b ligand, but not target cells alone (BWZ.P1BSw/SJL; Fig. 8A). Moreover, this interaction is specific for Ocil/Clr-b ligand, as it can be blocked using the {alpha}-Ocil/Clr-b mAb, 4A6 (Fig. 8A). Importantly, BWZ cells expressing the NKR-P1BBALB receptor are also capable of specifically recognizing Ocil/Clr-b ligand (BWZ.P1BBALB; Fig. 8A), while BWZ cells expressing a control CD69 fusion receptor do not recognize Ocil/Clr-b (BWZ.CD69; Fig. 8A). Furthermore, BWZ.P1BBALB reporter cells also recognize native Ocil/Clr-b ligand on the surface of various hemopoietic cells ex vivo, including bone marrow (BM), lymph node (LN), spleen (SP), and thymus (TH) (Fig. 8B). These results demonstrate that the BALB/c NKR-P1B receptor is functional and recognizes cognate Ocil/Clr-b ligand on the surface of normal cells. Thus, the NKR-P1B–Ocil/Clr-b missing-self recognition system is intact in BALB/c mice despite a single amino acid substitution that is responsible for the lack of NK1.1 reactivity of BALB/c NK cells.


Figure 8
View larger version (32K):
[in this window]
[in a new window]
 
FIGURE 8. Functional analysis of Ocil/Clr-b ligand binding by the BALB/c NKR-P1B receptor. A, BWZ reporter cell assay analysis of NKR-P1 transductants vs a panel of target cells. Parental and Ocil/Clr-b-expressing BWZ variants and 293T transfectants with and without 4A6 {alpha}-Ocil/Clr-b blocking mAb were tested. B, BWZ reporter cell assay analysis of NKR-P1 transductants vs cells from normal mouse tissues ex vivo. Shown are parental BWZ cells, transductants bearing the NKR-P1BSw/SJL and NKR-P1BBALB receptors, as well as transductants expressing mouse CD69, as a control.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
It is widely believed that the lack of NK1.1 reactivity of BALB/c NK cells is due to a strain-specific deficiency in the expression of one or more members of the Nkrp1 family (10). We show here that BALB/c mice are normal with respect to Nkrp1 gene content and genomic organization (Figs. 1–6), Nkrp1 transcript expression (Figs. 5–6), and NKR-P1B receptor function (Figs. 7–8). Furthermore, we show that the lack of NK1.1 reactivity of BALB/c NK cells is due to a single amino acid substitution (S191T) found in the extracellular regions of both the BALB/c NKR-P1B and NKR-P1C receptors (the known NK1.1 Ags (5, 6, 9)), which abolishes the epitope recognized by the {alpha}-NK1.1 mAb, PK136 (4) (Fig. 7). Despite allelic differences, the BALB/c NKR-P1B receptor is fully functional and recognizes Ocil/Clr-b ligand on the surface of transfected and normal cells (Fig. 8). Our finding that the BALB/c and 129 strains appear to share a related Nkrp1 haplotype (Fig. 4) suggests that other NK1.1 mouse strains possess similar allelic differences. These results indicate that the NKR-P1–Ocil/Clr receptor-ligand system plays a broader and more important role in target cell recognition than previously thought.

Insight from the BALB/c Nkrp1 region: Nkrp1b and Nkrp1d delineate divergent murine NKC haplotypes

A significant finding of this study is that the mouse Nkrp1b and Nkrp1d genes appear to represent alleles of the same genetic locus (Fig. 3). It has long been suspected that this might be the case, for a number of reasons. Although the original Nkrp1b cDNA sequence (gene 34; Ref. 31) was reportedly derived from B6 mice, along with Nkrp1a (gene 2; Ref. 31); mNKR-P1.7 (9, 28) and Nkrp1c (gene 40; Ref. 31); mNKR-P1.9 (9), we and others have been unable to identify an Nkrp1b genomic or cDNA sequence, or an NKR-P1B protein, from the B6 background (5, 6, 27). However, our group and Kung et al. (6) were able to isolate an identical Nkrp1b cDNA sequence derived from the Sw (5) and SJL strains (6), respectively. Thus, it is possible, due to the large numbers of NK cells required for cDNA library preparation and Northern blotting, that a mixed strain may have been included in the original identification of the mouse Nkrp1 cDNA family. In any case, we and others were successful in cloning an Nkrp1b-related cDNA from B6 NK cells by RT-PCR (5, 6). Due to significant coding sequence divergence in the extracellular region (21 nonsynonymous substitutions, a difference similar to that observed between other Nkrp1 genes), we gave this cDNA a novel designation, Nkrp1d (GenBank accession no. AF338321; Ref. 5); however, Kung et al. (6) only detected 15-aa substitutions and designated their cDNA sequence, Nkrp1bB6 (GenBank accession no. AF354260). Notwithstanding these differences, our collective cDNA findings were later confirmed at the genomic level through random sequencing of the B6 Nkrp1 region: no evidence for the existence of a B6 Nkrp1b sequence could be found, resulting in the designation of the B6 gene, Nkrp1d (GenBank accession no. AF324825; Ref. 27). In the absence of information about the Nkrp1 genomic region from other strains, including Sw or SJL mice, this issue has remained unresolved until now.

Our new data from the BALB/c genome, however, sheds light on the allelic nature of Nkrp1b and Nkrp1d: (1) only a single inhibitory-class cDNA and/or gene could be identified in BALB/c, similar to B6 and other strains analyzed to date; (2) the genomic location of the BALB/c Nkrp1b gene is similar to that of the B6 Nkrp1d gene (3); the Nkrp1bBALB and Nkrp1dB6 probes both hybridize to the same bands on genomic Southern blots; and (4) the Nkrp1bBALB gene shares a highly conserved e3-i3-e4 organization and sequence with the Nkrp1dB6 locus (Fig. 9). If Nkrp1b and Nkrp1d are indeed allelic, they show much greater allelic divergence than other Nkrp1 genes among B6, BALB/c, and other mouse strains (with exception of the Nkrp1c locus). The reason for this specific and directed divergence is unclear, but it is even more intriguing considering that the NKR-P1B/D receptors share a common ligand, the product of the Ocil/Clr-b locus, which is identical among the B6, BALB/c, and 129 strains (12, 13). Differential binding of NKR-P1B and NKR-P1D to a single allele of Ocil/Clr-b has been observed before in functional assays (12); however, this could reflect a differential affinity of each gene product, as a consequence of their divergent sequences, for a common ligand. In turn, such differential binding of NKR-P1 receptors to their Ocil/Clr ligands could have implications for the role of this system in missing self recognition and transplantation biology (12). Confirmation of such a role will have to await the elucidation of Ocil/Clr alleles and haplotypes, as well as functional analyses of the role of Ocil/Clr proteins in allotransplantation.


Figure 9
View larger version (22K):
[in this window]
[in a new window]
 
FIGURE 9. Comparison of Nkrp1 gene structure. A, A scale diagram of the organization of exons 3–5 of various mouse Nkrp1 genes is shown. Differentially shaded boxes indicate exons and various types of repetitive elements in introns as highlighted at the bottom. Numbers indicate the percentage nucleotide identity of the exon 3–5 region between B6 and available BALB/c alleles. The identity score shown for Nkrp1cB6 and Nkrp1cBALB ignores the LINE element in the Nkrp1cBALB gene. B, Individual exon 3–5 sequences of Nkrp1 genes from B6 and BALB/c mice were aligned using ClustalX software, and bootstrap analysis of 1000 data sets was performed with Phylip software (<http://evolution.genetics.washington.edu/phylip.html>). The bootstrap values for each grouping are shown as a percentage. Phylogram branch lengths indicate the exon similarity among different Nkrp1 genes, and the scale bar indicates the percent divergence. When different strains are grouped together in one gene, this indicates exon identity.

 
Another interesting finding of the genomic analyses is that the BALB/c and 129 strains appear to share a related Nkrp1 haplotype (Fig. 4 and Ref. 28). In fact, an Nkrp1b-like sequence has been identified in 129-strain mice, designated Nkrp1d129, that resembles Nkrp1bBALB more than Nkrp1dB6 (13); indeed, the NKR-P1D129 protein differs from the NKR-P1BBALB and NKR-P1BSw/SJL proteins by only 5- or 6-aa, respectively, and possesses the S191T substitution that abrogates NK1.1 reactivity (Fig. 7). As both BALB/c and 129 are well-known NK1.1 mouse strains, this suggests that other NK1.1 strains possess similar allelic differences. Interestingly, our classification of Nkrp1 haplotypes thus far appears to delineate functionally distinct NK1.1 alloantigen expression patterns: B6 strain (group 1) NK cells are known express an NK1.1 alloantigen (Nkrp1c) (9); BALB/c and 129 strain (group 2) NK cells do not express NK1.1 (4); while FVB strain (group 3) NK cells are also known to express NK1.1 (Nkrp1b) (7). Notably, FVB mice represent an inbred Swiss-related mouse strain (7), perhaps explaining the similar basis for NK1.1 reactivity (Nkrp1b) of FVB (7), Sw (5), SJL (6), and CD-1 (12) NK cells; thus, it is likely that these strains all share a related Nkrp1 haplotype (group 3). Because there are currently no data on the relationship of any of these strains to the donor CE strain used for immunizations to generate the original polyclonal (3) and monoclonal (4) anti-NK1.1 alloantibodies, the identity of the original NK1.1 Ag remains unknown.

Nevertheless, before any final conclusions can be made concerning Nkrp1 (and Ocil/Clr) haplotype variation, more haplotypes will have to be characterized. The genomic organization and content of the BALB/c and B6 Nkrp1-Ocil/Clr regions are more similar than the Ly49 regions between these strains. If one assumes that the BALB/c and B6 Nkrp1-Ocil/Clr and Ly49 haplotype association is a natural one and not a consequence of the original derivation of inbred mice, then it would appear that the Nkrp1-Ocil/Clr region is evolving less rapidly than the Ly49 region. Although the reason for this remains speculative at present, a striking difference between the two NK cell receptor systems is that the Nkrp1 genes are genetically intermingled in the NKC with the Ocil/Clr genes that encode their ligands (12, 13); thus, both are coinherited. In contrast, the Ly49 genes segregate independently of the genes encoding their ligands, because the MHC is located on a different chromosome than the NKC (18). Coinheritance of ligand-encoding genes may negatively affect the rate of accumulated receptor gene mutations (i.e., receptor evolution), and vice-versa, because amino acid changes that decrease receptor-ligand binding affinities might be selected against. In contrast, the observed level of allelic divergence between Nkrp1b and Nkrp1d (and within the Nkrp1c locus) suggests that this may not always be the case. Further characterization of Ocil/Clr haplotypes is necessary to clarify the relationship between allelic divergence of the Nkrp1 and Ocil/Clr genes and how that influences their function. Intriguingly, the underlying basis for the evolution of numerous Nkrp1 genes in rodents and only a single gene (NKRP1A; Ref. 32) in humans is unknown. Yet like the Ly49 receptor system, this dichotomy is probably a functional consequence of differences in receptor usage by rodent vs human NK cells. Only a single Ocil/Clr-b-like gene exists in humans, designated LLT1 (18, 33). Indeed, the recent finding that human NKR-P1A–LLT1 interact and inhibit NK cell function demonstrates that the NKR-P1 missing-self recognition system is intact in humans (34, 35).

Identification of novel Nkrp1 and Ocil/Clr genes

Southern cross-hybridization and PCR cross-amplification of BAC clones and cDNA libraries identified sequences in the BALB/c genome that appear to represent novel Nkrp1 and Ocil/Clr genes. The first of these, designated Clr-h, was identified from BAC analysis using primers intended for Clr-b (cross-reactive to Clr-d). This new gene is not unique to the BALB/c genome; rather, the sequence is readily identifiable in the latest assembly of the public B6 genome database (99% identical across e3-i3-e4; GenBank accession no. XM487965). Moreover, the corresponding region in the B6 genome does not fit the location of any other known Clr gene (18). Such a high degree of sequence conservation suggests that Clr-h either represents a ligand for a highly conserved receptor, or that it is not subject to selection pressure and thus may represent a nonfunctional gene/pseudogene (at least in the strains tested; Fig. 5C), or encode a ligand for a nonfunctional receptor. In this light, it is interesting to note that the Nkrp1a sequence is highly conserved, the Nkrp1f sequence is identical between B6 (27) and BALB/c (this study), and the Nkrp1e sequence appears to be nonfunctional in both strains (this study, and Ref. 27). As the NKR-P1F receptor binds to Ocilrp2/Clr-g (13, 16, 17, 36, 37), it is likely that at least some of the remaining NKR-P1 receptors and Ocil/Clr ligands bind to one another. Although the Clr-c/d/e genes are not novel, this study elucidates their relative order within the NKC (i.e., Clr-g, Clr-d, Clr-e, Clr-c, and Nkrp1f)

A second new gene, Nkrp1g, is predicted to exist in the interval between Clr-f and Nkrp1c, based upon Southern cross-hybridization with an Nkrp1f cDNA probe. Although it is not known whether the sequence encodes a functional receptor, a sequence is currently available for this putative new gene in the B6 genome database (GenBank accession no. XM355818). The coding sequence bears some similarity to the NKR-P1F receptor in the extracellular region (16), but the predicted protein appears to lack known signaling motifs, including a cytoplasmic ITIM or Y residue, a putative CxCP recruitment motif for the Lck tyrosine kinase, and a charged transmembrane R residue (5, 38). Thus, full BAC sequencing may be required to assess the significance of the BALB/c cross-hybridization results, if no related cDNA can be isolated. This approach may also provide a clue to the origin and relationship of this sequence to the other Nkrp1 genes and/or pseudogenes. Although attempts to isolate an Nkrp1g cDNA were unsuccessful (at least in the strains tested; Fig. 5C), the Nkrp1g sequence appears to be conserved in the rat genome (Ensembl ID ENSRNOT00000035766; <www.ensembl.org>), along with Nkrp1a (GenBank accession no. M62891), Nkrp1b (GenBank accession no. U56936), and Nkrp1f (GenBank accession no. X97477).

Conformational nature of the NK1.1 epitope

As mentioned previously, the NK1.1 epitope is specific to NKR-P1BSw/SJL and NKR-P1CB6 among known NKR-P1 proteins from both mice and rats (Fig. 7). However, sequence alignment of these NKR-P1 proteins does not provide a clue as to the context of the NK1.1-reactive sequence. Our identification of a substitution in the NKR-P1BBALB vs NKR-P1BSw/SJL sequence that confers NK1.1 reactivity by no means indicates that this amino acid alone is sufficient to generate the NK1.1 epitope. In contrast, both the rat NKR-P1A and NKR-P1B sequences contain the NK1.1-reactive S residue at the correct position, yet neither receptor bears the NK1.1 epitope. This is not surprising considering that NKR-P1B/C can be immunoprecipitated but not Western blotted using PK136 mAb (J.R.C., unpublished observations). This suggests that the NK1.1 epitope is conformational in nature, relying on additional context-dependent amino acid residues, and that denaturation of the three-dimensional structure of the epitope destroys its reactivity.

It was surprising that the seemingly conservative S191T substitution found in both NKR-P1BBALB and NKR-P1CBALB could abolish NK1.1 reactivity, whereas reversing this single amino acid substitution could confer NK1.1 reactivity (Fig. 7). The chemical nature of S and T residues is quite similar: both residues contain a hydroxymethyl group, yet the T residue has one additional methyl group. The implications of this are not entirely clear, but since both S and T residues can be posttranslationally modified by O-linked polysaccharides, it is possible that a specific O-linked glycosyltransferase may be partially responsible for either conferring or destroying the NK1.1 epitope on these receptors. Carbohydrate modification of the NKR-P1 receptors is not functionally required for ligand binding, because tetramers of NKR-P1 proteins produced in bacteria bind to their cognate ligands (12, 13); however, such modifications could alter the affinity of the receptor–ligand interaction, because bacterially produced NKR-P1 tetramers only bind their ligands weakly (12, 13). This is evident in the findings that NKR-P1D tetramers fail to visualize native Ocil/Clr-b ligand on normal cells ex vivo (13), and NKR-P1B tetramers bind more weakly to Ocil/Clr-b ligand than the {alpha}-Ocil/Clr-b mAb, 4A6 (which is a low-affinity IgM) (12). Nonetheless, our present findings using the NKR-P1BBALB receptor in the BWZ reporter system recapitulate our in vitro and ex vivo results using an NKR-P1BSw/SJL receptor reporter cell (12). These results confirm that the cognate Ocil/Clr-b ligand recognized by these inhibitory receptors is expressed in a broad manner reminiscent of MHC class I (12), in contrast with the more restricted expression pattern suggested by other reports (13). The correlation between Ocil/Clr-b transcript expression (15, 16) and surface protein staining using {alpha}-Ocil/Clr-b 4A6 mAb (12) seems to be in agreement with our current findings.

Thus, the NKR-P1B–Ocil/Clr-b missing self recognition system is intact in BALB/c mice, despite their well-known NK1.1 strain designation. The generation of mAbs to the BALB/c NKR-P1 proteins should facilitate direct analyses of receptor expression and function. In addition, further analysis of the known and novel NKR-P1–Ocil/Clr interactions in various mouse strains should elucidate the complex nature of this system of at least 6 potential receptor and 8 potential ligand genes linked to one another in the NKC; heterodimerization of these proteins could offer as yet unappreciated additional complexity to NK cell recognition of target cells.

Note added in proof. The genomic sequences and intron–exon structure of the Nkrp1 genes in this study have been modified from Ljutic et. al. (39) to conform to the Ly49 gene nomenclature (i.e., exon 2, cytoplasmic; exon 3, transmembrane, exon 4, stalk; exons 5–7, C-type lectin-like domain).


    Acknowledgments
 
We thank Dr. J.C. Zúñiga-Pflücker for support; Drs. David Raulet, Lewis Lanier, Richard Miller, and Stephen Anderson for suggestions; Renée DePooter for critical reading of the manuscript; and Gisele Knowles for cell sorting.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by grants (to J.R.C. and A.P.M.) from the Canadian Institutes of Health Research (CIHR). J.R.C. is supported by a Career Development Award from the International Human Frontier Science Program Organization. A.M. was supported by a Life Sciences Award from the University of Toronto. A.P.M. is supported by a New Investigator Award from the CIHR. Back

2 Address correspondence and reprint requests to Dr. James R. Carlyle, Department of Immunology, University of Toronto, Sunnybrook and Women’s Research Institute, 2075 Bayview Avenue (A-331), Toronto, ON, Canada M4N 3M5. E-mail address: james.carlyle{at}utoronto.ca or Dr. Andrew P. Makrigiannis, Laboratory of Molecular Immunology, Institut de Recherches Cliniques de Montréal, 110 Avenue des Pins Ouest, Montréal, QC, Canada H2W 1R7. E-mail address: makriga{at}ircm.qc.ca Back

3 Current address: Immunology Research CA, Sanofi-Pasteur, 1755 Steeles Avenue West, Toronto, ON, Canada M2R 3T4 Back

4 Abbreviations used in this paper: NKC, NK gene complex; BAC, bacterial artificial chromosome; EC/UTR, extracellular/3'-untranslated region. Back

Received for publication December 21, 2005. Accepted for publication March 24, 2006.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Trinchieri, G.. 1989. Biology of natural killer cells. Adv. Immunol. 47: 187-376. [Medline]
  2. Lanier, L. L.. 2005. NK cell recognition. Annu. Rev. Immunol. 23: 225-274. [Medline]
  3. Glimcher, L., F. W. Shen, H. Cantor. 1977. Identification of a cell-surface antigen selectively expressed on the natural killer cell. J. Exp. Med. 145: 1-9. [Abstract/Free Full Text]
  4. Koo, G. C., J. R. Peppard. 1984. Establishment of monoclonal anti-NK-1.1 antibody. Hybridoma 3: 301-303. [Medline]
  5. Carlyle, J. R., A. Martin, A. Mehra, L. Attisano, F. W. Tsui, J. C. Zúñiga-Pflücker. 1999. Mouse NKR-P1B, a novel NK1.1 antigen with inhibitory function. J. Immunol. 162: 5917-5923. [Abstract/Free Full Text]
  6. Kung, S. K., R. C. Su, J. Shannon, R. G. Miller. 1999. The NKR-P1B gene product is an inhibitory receptor on SJL/J NK cells. J. Immunol. 162: 5876-5887. [Abstract/Free Full Text]
  7. Liu, J., M. A. Morris, P. Nguyen, T. C. George, E. Koulich, W. C. Lai, J. D. Schatzle, V. Kumar, M. Bennett. 2000. Ly49I NK cell receptor transgene inhibition of rejection of H2b mouse bone marrow transplants. J. Immunol. 164: 1793-1799. [Abstract/Free Full Text]
  8. Hackett, J., Jr, M. Tutt, M. Lipscomb, M. Bennett, G. Koo, V. Kumar. 1986. Origin and differentiation of natural killer cells. II. Functional and morphologic studies of purified NK-1.1+ cells. J. Immunol. 136: 3124-3131. [Abstract]
  9. Ryan, J. C., J. Turck, E. C. Niemi, W. M. Yokoyama, W. E. Seaman. 1992. Molecular cloning of the NK1.1 antigen, a member of the NKR-P1 family of natural killer cell activation molecules. J. Immunol. 149: 1631-1635. [Abstract]
  10. Giorda, R., E. P. Weisberg, K. I. Tze, M. Trucco. 1992. Genomic structure and strain-specific expression of the natural killer cell receptor NKR-P1. J. Immunol. 149: 1957-1963. [Abstract]
  11. Anderson, S. K., K. Dewar, M. L. Goulet, G. Leveque, A. P. Makrigiannis. 2005. Complete elucidation of a minimal class I MHC natural killer cell receptor haplotype. Genes Immun. 6: 481-492. [Medline]
  12. Carlyle, J. R., A. M. Jamieson, S. Gasser, C. S. Clingan, H. Arase, D. H. Raulet. 2004. Missing self recognition of Ocil/Clr-b by inhibitory NKR-P1 natural killer cell receptors. Proc. Natl. Acad. Sci. USA 101: 3527-3532. [Abstract/Free Full Text]
  13. Iizuka, K., O. Naidenko, B. Plougastel, D. Fremont, W. M. Yokoyama. 2003. Genetically linked C-type lectin-related ligands for the NKR-P1 NK cell receptors. Nat. Immunol. 4: 801-807. [Medline]
  14. Kumar, V., M. E. McNerney. 2005. A new self: MHC-class-I-independent natural-killer-cell self-tolerance. Nat. Rev. Immunol. 5: 363-374. [Medline]
  15. Zhou, H., V. Kartsogiannis, Y. S. Hu, J. Elliott, J. M. Quinn, W. J. McKinstry, M. T. Gillespie, K. W. Ng. 2001. A novel osteoblast-derived C-type lectin that inhibits osteoclast formation. J. Biol. Chem. 276: 14916-14923. [Abstract/Free Full Text]
  16. Plougastel, B., C. Dubbelde, W. M. Yokoyama. 2001. Cloning of Clr, a new family of lectin-like genes localized between mouse Nkrp1a and Cd69. Immunogenetics 53: 209-214. [Medline]
  17. Zhou, H., V. Kartsogiannis, J. M. Quinn, C. Ly, C. Gange, J. Elliott, K. W. Ng, M. T. Gillespie. 2002. Osteoclast inhibitory lectin, a family of new osteoclast inhibitors. J. Biol. Chem. 277: 48808-48815. [Abstract/Free Full Text]
  18. Yokoyama, W. M., B. F. Plougastel. 2003. Immune functions encoded by the natural killer gene complex. Nat. Rev. Immunol. 3: 304-316. [Medline]
  19. Sanderson, S., N. Shastri. 1994. Lacz inducible, antigen/MHC-specific T-cell hybrids. Int. Immunol. 6: 369-376. [Abstract/Free Full Text]
  20. Li, J., B. A. Rabinovich, R. Hurren, J. Shannon, R. G. Miller. 2003. Expression cloning and function of the rat NK activating and inhibitory receptors NKR-P1A and -P1B. Int. Immunol. 15: 411-416. [Abstract/Free Full Text]
  21. Carlyle, J. R., A. M. Michie, S. K. Cho, J. C. Zúñiga-Pflücker. 1998. Natural killer cell development and function precede {alpha}beta T cell differentiation in mouse fetal thymic ontogeny. J. Immunol. 160: 744-753. [Abstract/Free Full Text]
  22. Arase, H., T. Saito, J. H. Phillips, L. L. Lanier. 2001. Cutting edge: the mouse NK cell-associated antigen recognized by DX5 monoclonal antibody is CD49b ({alpha}2 integrin, very late antigen-2). J. Immunol. 167: 1141-1144. [Abstract/Free Full Text]
  23. Stoneman, E. R., M. Bennett, J. An, K. A. Chesnut, E. K. Wakeland, J. B. Scheerer, M. J. Siciliano, V. Kumar, P. A. Mathew. 1995. Cloning and characterization of 5E6 (Ly49C), a receptor molecule expressed on a subset of murine natural killer cells. J. Exp. Med. 182: 305-313. [Abstract/Free Full Text]
  24. Dorshkind, K., S. B. Pollack, M. J. Bosma, R. A. Phillips. 1985. Natural killer (NK) cells are present in mice with severe combined immunodeficiency (scid). J. Immunol. 134: 3798-3801. [Abstract]
  25. Proteau, M. F., E. Rousselle, A. P. Makrigiannis. 2004. Mapping of the BALB/c Ly49 cluster defines a minimal natural killer cell receptor gene repertoire. Genomics 84: 669-677. [Medline]
  26. Makrigiannis, A. P., D. Patel, M. L. Goulet, K. Dewar, S. K. Anderson. 2005. Direct sequence comparison of two divergent class I MHC natural killer cell receptor haplotypes. Genes. Immun. 6: 71-83. [Medline]
  27. Plougastel, B., K. Matsumoto, C. Dubbelde, W. M. Yokoyama. 2001. Analysis of a 1-Mb BAC contig overlapping the mouse Nkrp1 cluster of genes: cloning of three new Nkrp1 members, Nkrp1d, Nkrp1e, and Nkrp1f. Immunogenetics 53: 592-598. [Medline]
  28. Yokoyama, W. M., J. C. Ryan, J. J. Hunter, H. R. Smith, M. Stark, W. E. Seaman. 1991. cDNA cloning of mouse NKR-P1 and genetic linkage with Ly-49. Identification of a natural killer cell gene complex on mouse chromosome 6. J. Immunol. 147: 3229-3236. [Abstract]
  29. Makrigiannis, A. P., P. Gosselin, L. H. Mason, L. S. Taylor, D. W. McVicar, J. R. Ortaldo, S. K. Anderson. 1999. Cloning and characterization of a novel activating Ly49 closely related to Ly49A. J. Immunol. 163: 4931-4938. [Abstract/Free Full Text]
  30. Mehta, I. K., H. R. Smith, J. Wang, D. H. Margulies, W. M. Yokoyama. 2001. A "chimeric" C57l-derived Ly49 inhibitory receptor resembling the Ly49D activation receptor. Cell Immunol. 209: 29-41. [Medline]
  31. Giorda, R., M. Trucco. 1991. Mouse NKR-P1. A family of genes selectively coexpressed in adherent lymphokine-activated killer cells. J. Immunol. 147: 1701-1708. [Abstract]
  32. Lanier, L., C. Chang, J. Phillips. 1994. Human NKR-P1A. A disulfide-linked homodimer of the C-type lectin superfamily expressed by a subset of NK and T lymphocytes. J. Immunol. 153: 2417-2428. [Abstract]
  33. Boles, K. S., R. Barten, P. R. Kumaresan, J. Trowsdale, P. A. Mathew. 1999. Cloning of a new lectin-like receptor expressed on human NK cells. Immunogenetics 50: 1-7. [Medline]
  34. Aldemir, H., V. Prod’homme, M. J. Dumaurier, C. Retiere, G. Poupon, J. Cazareth, F. Bihl, V. M. Braud. 2005. Cutting edge: Lectin-like transcript 1 is a ligand for the CD161 receptor. J. Immunol. 175: 7791-7795. [Abstract/Free Full Text]
  35. Rosen, D. B., J. Bettadapura, M. Alsharifi, P. A. Mathew, H. S. Warren, L. L. Lanier. 2005. Cutting edge: Lectin-like transcript-1 is a ligand for the inhibitory human NKR-P1A receptor. J. Immunol. 175: 7796-7799. [Abstract/Free Full Text]
  36. Tian, W., R. Nunez, S. Cheng, Y. Ding, J. Tumang, C. Lyddane, C. Roman, H. C. Liou. 2005. C-type lectin OCILRP2/Clr-g and its ligand NKRP1f costimulate T cell proliferation and IL-2 production. Cell Immunol. 234: 39-53. [Medline]
  37. Tian, W., B. Feng, H. C. Liou. 2005. Silencing OCILRP2 leads to intrinsic defects in T cells in response to antigenic stimulation. Cell Immunol. 235: 72-84. [Medline]
  38. Ljutic, B., J. R. Carlyle, D. Filipp, R. Nakagawa, M. Julius, J. C. Zuniga-Pflucker. 2005. Functional requirements for signaling through the stimulatory and inhibitory mouse NKR-P1 (CD161) NK cell receptors. J. Immunol. 174: 4789-4796. [Abstract/Free Full Text]
  39. Ljutic, B., J. R. Carlyle, J. C. Zuniga-Pflucker. 2003. Identification of upstream cis-acting regulatory elements controlling lineage-specific expression of the mouse NK cell activation receptor, NKR-P1C. J. Biol. Chem. 278: 31909-31917. Vol. 176, No. 12. [Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Immunol.Home page
J. G. Aust, F. Gays, K. M. Mickiewicz, E. Buchanan, and C. G. Brooks
The Expression and Function of the NKRP1 Receptor Family in C57BL/6 Mice
J. Immunol., July 1, 2009; 183(1): 106 - 116.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Astrakhan, H. D. Ochs, and D. J. Rawlings
Wiskott-Aldrich Syndrome Protein Is Required for Homeostasis and Function of Invariant NKT Cells
J. Immunol., June 15, 2009; 182(12): 7370 - 7380.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
X. Yan, B. D. Johnson, and R. J. Orentas
Induction of a VLA-2 (CD49b)-Expressing Effector T Cell Population by a Cell-Based Neuroblastoma Vaccine Expressing CD137L
J. Immunol., October 1, 2008; 181(7): 4621 - 4631.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
T. Walzer, M. Blery, J. Chaix, N. Fuseri, L. Chasson, S. H. Robbins, S. Jaeger, P. Andre, L. Gauthier, L. Daniel, et al.
Identification, activation, and selective in vivo ablation of mouse NK cells via NKp46
PNAS, February 27, 2007; 104(9): 3384 - 3389.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Carlyle, J. R.
Right arrow Articles by Makrigiannis, A. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Carlyle, J. R.
Right arrow Articles by Makrigiannis, A. P.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS