|
|
||||||||
2 Impacts Receptor Distribution and IL-13 Signaling1
Division of Allergy and Immunology, Department of Pediatrics, Cincinnati Childrens Hospital Medical Center, Cincinnati, OH 45229
| Abstract |
|---|
|
|
|---|
, IL-13R
1, and IL-13R
2. IL-4R
and IL-13R
1 form a heterodimeric signaling receptor for IL-13. In contrast, IL-13R
2 binds IL-13 with high affinity but does not signal. IL-13R
2 exists on the cell surface, intracellularly, and in soluble form, but no information is available regarding the relative distributions of IL-13R
2 among these compartments, whether the compartments communicate, and how the relative expression levels impact IL-13 responses. Herein, we investigated the distribution of IL-13R
2 in transfected and primary cells, and we evaluated how the total level of IL-13R
2 expression impacted its distribution. Our results demonstrate that the distribution of IL-13R
2 is independent of the overall level of expression. The majority of the IL-13R
2 protein existed in intracellular pools. Surface IL-13R
2 was continually released into the medium in a soluble form, yet surface expression remained constant supporting receptor trafficking to the cell surface. IL-13R
2 inhibited IL-13 signaling proportionally to its level of expression, and this inhibition could be overcome with high concentrations of IL-13. | Introduction |
|---|
|
|
|---|
(IL-4R
chain) and two other cell surface proteins, IL-13R
1 and IL-13R
2 (4, 5, 6, 7, 8, 9). IL-13R
1 binds IL-13 with low affinity by itself, but when paired with IL-4R
it binds IL-13 with high affinity and forms a functional IL-13R that signals and results in activation of the Jak-Stat pathway (7). IL-13R
1 is widely expressed and has been demonstrated on nearly every cell tested except human and mouse T cells and mouse B cells, consistent with the known functions of IL-13 (10, 11, 12, 13). In contrast, expression of IL-13R
2 in vitro was insufficient to render cells responsive to IL-13, despite high affinity binding even in the presence of IL-4R
(14). IL-13R
2 has a short cytoplasmic tail (17 aa in the human), which contains no box 1 or box 2 signaling motifs, supporting the theory that it has no signaling function. The inability of IL-13R
2 expression to confer IL-13 responsiveness despite high affinity binding, along with the finding of soluble IL-13R
2 in vivo (9), has led to speculation that IL-13R
2 is a decoy receptor. Expression of IL-13R
2 varies across cell types and can be induced by inflammation and cytokines (15, 16, 17, 18, 19, 20). A role for IL-13R
2 as a potential modulator of inflammation in asthma is suggested by the IL-13- and IL-4-dependent up-regulation of IL-13R
2 in primary bronchial epithelial cells and the demonstration that overexpression of IL-13R
2 in bronchial derived cells decreases IL-13-dependent Stat6 phosphorylation (21). IL-13R
2 exists largely intracellularly and can be mobilized to the cell surface following cytokine exposure (22). A trileucine motif in the transmembrane domain was shown to be a critical regulator of internalization of IL-13R
2 (23). IL-13R
2 has also been found to exist in a soluble form (9). Thus, IL-13R
2 exists in three compartments, cytoplasmic, surface membrane, and soluble, but little is known about the relative distribution of IL-13R
2 among these compartments in cells or how this distribution is regulated. Modulation of the relative ratios of IL-13R
2 in these three compartments, as well as the total level of IL-13R
2, is likely important in determining the overall effect of IL-13 on a given cell.
Herein, we examined the relative distributions of IL-13R
2 in primary and transfected cells. To determine the relationship between total IL-13R
2 expression and the relative distributions among the different compartments (surface, intracellular, and soluble), we developed stable transfectant clones with relatively lower or higher levels of IL-13R
2 surface expression. We then determined how the relative amount of expression influenced the distribution of IL-13R
2 in the soluble, surface, and cytosolic compartments. We compared the distribution of IL-13R
2 in these transfected cells with the distribution of IL-13R
2 in murine splenocytes to confirm that the expression of IL-13R
2 in primary cells has a distribution similar to that seen in the transfectants. We also examined the inhibitory effect of IL-13R
2 on IL-13 signaling. The level of IL-13R
2 expression has been shown to be regulated in vivo by inflammation and cytokines (15, 16, 17, 18, 19, 20). Our in vitro model enabled the examination of varying levels of IL-13R
2 and their effects on IL-13 signaling and IL-13R
2 distribution, thus mirroring the variations in expression of IL-13R
2 that may be expected in vivo.
| Materials and Methods |
|---|
|
|
|---|
The coding sequence cDNA of mature human IL-13R
2 (GenBank NM_000640 without signal peptide) was tagged with a Flag epitope at the N terminus and cloned into pEF-Neo-PPL-SP vector, kindly provided by Dr. Yutaka Tagaya (National Cancer Institute, Metabolism Branch, Bethesda, MD) (24), which uses bovine preprolactin signal peptide to direct the surface expression of IL-13R
2. The construct produces a fusion protein of bovine preprolactin signal peptide followed by the Flag epitope tag and IL-13R
2 without its innate signal peptide. A total of 5 x 106 U937 cells (American Type Culture Collection) were washed, resuspended in RPMI 1640 containing 20 µg of uncut plasmid and pulsed with a Genepulser II electroporation device (Bio-Rad) set at 960 µF and 200 V. After electroporation, the cells were grown for 24 h in 10 ml of complete RPMI 1640 and then selected for resistance to G-418 (Invitrogen Life Technologies) at 400 µg/ml for 23 wk. Cell populations were screened by flow cytometry for surface expression by staining with FITC-conjugated anti-Flag Ab. Positive transfectant pools were cloned by limiting dilution. Higher (MDH1, MDH2, MDH3, MDH4) and lower (MDL1, MDL2, MDL3, MDL4) Flag-IL-13R
2-expressing clones were identified.
Murine splenocytes were prepared from C3H mice obtained from The Jackson Laboratory. After RBC lysis, the cells were washed three times in RPMI 1640 and resuspended in PBS. Cells were then treated with trypsin, and lysates were prepared as described below.
PCR for IL-13R
2
cDNA was prepared, using TRIzol reagent (Invitrogen Life Technologies), from cells stimulated overnight with the indicated cytokines. Message for IL-13R
2 was detected by PCR using the following primers: forward, TTCCCTATTTGGAGGCATCAGAC; reverse, CACCTTCCCAGCATTGTTTATCAC; and PCR conditions, 30 cycles of 94°C for 30 s, 56°C for 30 s, and 72°C for 30 s, yielding an expected fragment of 400 bp.
Flow cytometry
Flag-IL-13R
2 expression was assessed by flow cytometry. Briefly, cells were incubated with 5 µg/ml anti-Flag (Sigma-Aldrich) or anti-IL-13R
2 (R&D Systems) for 30 min at 4°C. Bound Abs were detected with Alexa Fluor 488 goat anti-mouse or chicken anti-goat (Invitrogen Life Technologies) Ab. IL-13 binding was determined by incubating cells with 200 ng/ml murine IL-13 (mIL-133; Peprotech) for 30 min at 4°C. Cells were washed twice in cold PBS and incubated with 4 µg/ml anti-mIL-13 (R&D Systems) for 30 min and washed twice in cold PBS. Bound Ab was detected by Alexa Fluor 488 chicken anti-goat Ab.
Murine splenocytes were assessed for IL-13R
2 expression by isolating single cell suspensions from spleens obtained from FVB/N mice. These splenocytes were either fixed with 2% paraformaldehyde in PBS and permeabilized with 0.2% saponin or were allowed to remain intact. They were then incubated with anti-murine IL-13R
2 goat polyclonal Ab (R&D Systems). Bound Ab was detected by Alexa Fluor 488 chicken anti-goat Ab.
Confocal microscopy
Confocal microscopy was performed as previously described (22). Briefly, cells expressing Flag-IL-13R
2 were labeled with anti-Flag (Sigma-Aldrich) for 30 min at 4° C and washed twice in cold PBS. The cells were then incubated at 37° C for 030 min. When indicated, cells were restained for Flag expression. Surface-bound Flag Abs were detected with Alexa Fluor 488 goat anti-mouse Ab. Cells were then washed twice in PBS and mounted in Vectashield (Vector Laboratories) for confocal microscopy.
For permeabilization, cells were fixed with 3% paraformaldehyde in PBS on ice for 10 min, washed three times with cold PBS, and then incubated with 15 mM glycine. The cells were washed three times in cold PBS followed by a 10-min permeabilization with 0.2% saponin in 3% normal rabbit serum. Ab staining is as previously described, with the addition of 3% normal rabbit serum and 0.2% saponin to all Ab and wash solutions.
ELISA
Quantitative IL-13R
2 ELISA was performed with the DuoSet system (R&D Systems). The standard curve was linear from 100 to 8000 pg/ml. Whole cell lysates were prepared by lysing 5 x 106 cells in 500 µl of lysis buffer (10 mM HEPES (pH 7.9), 10 mM KCl, 0.1 mM EDTA, 1.5 mM MgCl2 0.2% Nonidet P-40, 1.0 mM DTT, 0.5 mM PMSF) followed by centrifugation for 8 min at 8000 x g. Lysate was decanted for analysis. Spontaneous release of soluble IL-13R
2 was determined by incubating 5 x 106 cells in 1 ml of RPMI 1640 at 37°C for 1 h, centrifuging at 6000 x g for 2 min, and decanting the supernatant for analysis. Murine IL-13R
2 from splenocytes was detected with similar technique using anti-mIL-13R
2 polyclonal Ab for capture and detection.
For analysis of Flag-IL-13R
2, 96-well plates were coated with anti-Flag (10 µg/ml; Sigma-Aldrich) for capture overnight at 4°C. Native IL-13R
2 was assessed using a monoclonal anti-human IL-13R
2 (0.5 µg/ml; R&D Systems). Conditioned medium was applied to the plate and incubated overnight at 4°C. Wells were washed with 0.05% Triton X-100 in PBS and incubated with anti-human IL-13R
2 polyclonal Ab (0.5 µg/ml) at room temperature for 2 h. Wells were washed as before, and detection Ab was visualized with a biotinylated secondary anti-goat IgG (1.0 µg/ml; Vector Laboratories) for 2 h at room temperature. This was followed by streptavidin-HRP conjugate and substrate solution (R&D Systems) at room temperature for 20 min each. Optical density was read at 450 nm. Background (PBS only) OD450 was subtracted from the OD450 obtained from the samples. IL-13R
2 levels were expressed as mean optical density ± SD of three independent samples.
Trypsin treatment of cells
Cells (1 x 106; for flow cytometry), 5 x 106 cells (lysates for ELISA), or 4 x 107 splenocytes (for ELISA) were resuspended in 500 µl of trypsin-EDTA at 4°C. Cells were then warmed to 37°C for the indicated times. Trypsin was inactivated with 1 ml of FBS, and the cells were washed once in RPMI 1640 and twice in PBS. Cells were stained for surface Flag-IL-13R
2 and analyzed by flow cytometry or lysates were prepared for ELISA as previously described.
EMSA
EMSA was performed as previously described (25). Briefly, after cytokine treatment for 30 min, 5 x 106 cells were lysed in 20 µl of EMSA lysis buffer (10 mM HEPES (pH 7.9), 10 mM KCl, 0.1 mM EDTA, 1.5 mM MgCl2, 0.2% Nonidet P-40, 1.0 mM DTT, 0.5 mM PMSF) for 5 min on ice and centrifuged for 5 min at 10,000 x g. Pellets were resuspended in 20 µl of EMSA extraction buffer (20 mM HEPES (pH 7.9), 420 mM NaCl, 0.1 mM EDTA, 1.5 mM MgCl2, 25% glycerol, 1.0 mM DTT, 0.5 mM PMSF) for 30 min on ice and centrifuged for 20 min at 20,000 x g. The resulting nuclear extracts were incubated with 32P-labeled Stat6 probe (Santa Cruz Biotechnology), resolved by gel electrophoresis, and visualized by autoradiography. Stat6 activity was quantified by densitometry.
Functional assessment of the conditioned medium was performed by obtaining conditioned medium (medium cultured with 2 x 107 cells/ml for1 h (MDH or untransfected). This conditioned medium was then mixed with IL-4 or IL-13 at the indicated concentrations, incubated for 10 min on ice, and then added to U937 cells; and Stat6 activation was determined by EMSA as previously described (25).
CD23 induction
Induction of CD23 surface expression was assessed by stimulating 5 x 105 cells with the indicated concentration of cytokine in medium for 48 h. Cells were then washed and stained with FITC-conjugated anti-CD23 Abs (Beckman Coulter). Cells were washed twice, and bound anti-CD23 was detected by flow cytometry.
| Results |
|---|
|
|
|---|
2 expression and ligand binding
To study the role of IL-13R
2 in vitro, U937 cells were stably transfected with Flag- human IL-13R
2. The parent U937 line was selected because it is IL-13 responsive and expresses negligible endogenous IL-13R
2. Stable transfectants were assessed for IL-13R
2 mRNA, surface expression, and IL-13 binding. The relative amount of surface and intracellular staining for IL-13R
2 were determined, and clones with different levels of surface expression were isolated. Untransfected U937 cells demonstrated negligible mRNA by RT-PCR for IL-13R
2 in contrast to cells transfected with Flag-IL-13R
2 (Fig. 1A). Transfected cells demonstrated surface expression of Flag-IL-13R
2 by flow cytometry, and similar staining was observed with both anti-Flag and anti-IL-13R
2 Abs (Fig. 1B). To verify that the presence of the Flag epitope did not interfere with the ability of the Flag-IL-13R
2 to bind IL-13, we used a flow cytometry sandwich assay. Cells were first incubated with IL-13, and the amount of surface-bound IL-13 was then detected with Abs directed against IL-13. IL-13 binding in the transfectants correlated with the Flag and IL-13R
2 expression. Furthermore, IL-13 binding was unaffected by Abs to Flag. Untransfected U937 cells demonstrated no appreciable staining for Flag, IL-13R
2, or IL-13 binding.
|
2 compartments
We next determined the localization of Flag-IL-13R
2 by confocal microscopy. Transfected cells were stained with anti-Flag Abs either intact or after permeabilization. As shown in Fig. 1C, intact cells demonstrated membrane-associated receptor. Permeabilized cells show intense cytoplasmic staining of Flag-IL-13R
2, demonstrating that the majority of IL-13R
2 is located intracellularly. Negligible staining was observed in untransfected cells or with isotype control Abs. Because the regulation of IL-13R
2 and its ultimate effects on IL-13 signaling may be determined by its relative level of expression, limited dilution cloning was used to isolate clones with relatively lower (MDL1, MDL2, MDL3, MDL4) or higher (MDH1, MDH2, MDH3, MDH4) expression of surface Flag-IL-13R
2. Representative histograms of MDH and MDL clones are shown in Fig. 1D. We compared the expression of IL-13R
2 in the transfectants to primary keratinocytes to determine whether the expression of IL-13R
2 in our transfected cells was similar to an untransfected primary cell. We determined that MDH and MDL clones approximated the expression of IL-13R
2 in primary keratinocytes within 2- to 4-fold (data not shown).
Determination of relative distribution of soluble, membrane, and intracellular IL-13R
2
Mean surface expression of Flag-IL-13R
2 was 2.24-fold higher in MDH clones than MDL clones as determined by flow cytometry (Fig. 2A). To determine whether the surface expression of Flag-IL-13R
2 correlated with the total Flag-IL-13R
2, the amount of Flag-IL-13R
2 in whole cell lysate was quantified by ELISA. Total Flag-IL-13R
2 was 2.16-fold greater in MDH than in MDL clones based on OD450 ratios. A similar ratio (2.42) was obtained by quantitative ELISA (data not shown). This ratio was similar to the differences in their levels of surface expression (Fig. 2B). Because IL-13R
2 has been shown to exist in a soluble form in vivo (26), and an inhibitory role for soluble IL-13R
2 is suggested by the use of IL-13R
2 fusion proteins in vivo to block IL-13 signaling (2, 3), we next determined whether IL-13R
2 was spontaneously released into the medium by MDH and MDL clones. IL-13R
2 was released into the medium spontaneously by the transfectants. MDH clones released more Flag-IL-13R
2 into the medium than MDL clones (Fig. 2C), and receptor release was proportional to the surface expression of Flag-IL-13R
2. Levels of soluble IL-13R
2 in the medium yielded OD450 values that were 2.03-fold higher in MDH clones than in MDL clones. Comparisons of IL-13R
2 concentrations in lysates vs supernatants revealed that both MDH and MDL clones had greater IL-13R
2 that remained cell associated vs that which was spontaneously released into the medium. Although soluble IL-13R
2 was detected in the medium by the more sensitive anti-Flag capture ELISA, it was below the threshold of the quantitative ELISA using anti-IL-13R
2 capture (<100 pg/ml).
|
2 in transfectants approximates primary murine splenocytes
Our data thus far revealed that the level of intracellular IL-13R
2 is much greater than the level of surface IL-13R
2 or soluble IL-13R
2. To validate this observation and confirm that the distribution of IL-13R
2 seen in the transfected cells is similar to what is seen in primary cells in vivo, we compared the relative amounts of surface and cytoplasmic IL-13R
2 in transfectants and primary murine splenocytes. Trypsin, a nonspecific protease that cleaves IL-13R
2, was used to remove surface IL-13R
2. MDH clones were treated with trypsin at 37°C for the indicated times, and residual surface IL-13R
2 was assessed by flow cytometry (Fig. 3). Trypsin efficiently cleaved IL-13R
2 from the surface of the cells, removing 50% of the surface receptor in 10 min and virtually all of the receptor in 1 h (Fig. 3A). Cells remained >99% viable following trypsin treatment for 1 h. We then examined whole cell lysates obtained from IL-13R
2-transfected cells before and after trypsin treatment to determine the relative proportion of IL-13R
2 that is intracellular and not accessible to trypsin. This allowed determination of the relative proportions of membrane vs total cellular IL-13R
2. Although trypsin efficiently removed surface IL-13R
2, whole cell lysates showed a slower and incomplete decrease in IL-13R
2 consistent with the fact that the intracellular pool is resistant to trypsin (Fig. 3B). Decrease in total IL-13R
2 after trypsin treatment was
77% at 60 min, the time at which we observed nearly complete removal of surface receptor by trypsin. This demonstration of residual IL-13R
2 after removal of surface IL-13R
2 agrees with our findings of a pool of cytoplasmic IL-13R
2 by confocal microscopy. Although surface IL-13R
2 is completely removed at 1 h, the amount of IL-13R
2 in whole cell lysate continues to decrease during trypsin treatment at 2 h to 86% removal. This likely represents mobilization of cytoplasmic stores of IL-13R
2 to the surface where they are accessible to trypsin cleavage, demonstrating that the cytoplasmic and membrane compartments communicate, trafficking IL-13R
2 to the cell surface. This is further supported by the fact that despite the ongoing release of soluble IL-13R
2 from cells, the surface level of IL-13R
2 remains constant at the same steady state.
|
2 in murine splenocytes. Trypsin treatment resulted in a decrease in total cellular IL-13R
2 of 12% in splenocytes (p = 0.037; Fig. 3C), supporting the presence of IL-13R
2 on the surface of murine splenocytes. However, the kinetics of the loss of IL-13R
2 after trypsin treatment was slower than that seen in the transfected cells presumably because in splenocytes there was a larger percentage of IL-13R
2 located intracellularly, and thus protected from trypsin. We verified the predominance of intracellular IL-13R
2 in splenocytes by flow cytometry. IL-13R
2 was detected in intact and permeabilized splenocytes to determine surface and total cellular IL-13R
2, respectively. Fig. 3D shows histograms from intact and permeabilized cells demonstrating the significant increase in staining for IL-13R
2 in permeabilized cells. These findings confirm that there is an intracellular pool of IL-13R
2 in primary cells.
Effect of IL-13R
2 expression level on IL-4 and IL-13 signaling
We next investigated whether the level of IL-13R
2 expression affected IL-13- and IL-4-dependent Stat6 activation (Fig. 4A). Untransfected cells demonstrate significant Stat6 activation even at low concentrations of IL-13. Cells overexpressing IL-13R
2 (MDH or MDL clones) demonstrated decreased activation of Stat6 in response to IL-13 when compared with untransfected cells at lower concentrations of IL-13 but appear to activate Stat6 normally at higher concentrations of IL-13. Densitometry was performed on four experiments to quantify the amount of Stat6 activation (Fig. 4B). MDL clones show less Stat6 activation than untransfected cells only at 10 ng/ml IL-13 (p < 0.013); MDH clones show decreased Stat6 activation at 10, 25, and 50 ng/ml (p < 0.001, p < 0.031, p < 0.012, respectively). The inhibitory effects of the IL-13R
2 were overcome at the highest concentrations of IL-13. These findings demonstrate that the inhibitory effects of IL-13R
2 on IL-13 signaling are dependent on both the level of expression of the receptor and the concentration of IL-13. There was no difference in the IL-4 responses between the untransfected cells and the MDH clones as demonstrated by their similar IL-4 dependent Stat6 activation shown in the EMSA (Fig. 4A). Additionally, activation of Stat6 in response to as much as 200 ng/ml IL-4 revealed no significant differences between MDH and untransfected cells (data not shown).
|
2 is detectable in the supernatant of cultured MDH and MDL clones. We next investigated the ability of this spontaneously released receptor to inhibit Stat6 activation in response to IL-13. MDH cells or untransfected U937 cells were cultured in complete medium for 1 h, and their supernatants were isolated. These supernatants together with 10200 ng/ml IL-13 were added to naive U937 cells, and Stat6 activation was assessed. Although IL-13R
2 was detected in these supernatants (Fig. 2C), it was very low (<100 pg/ml) and was insufficient to inhibit IL-13 responses.
Effect of IL-13R
2 expression level on IL-4- and IL-13-dependent CD23 surface expression
To further define the effect of IL-13R
2 expression on IL-13 responses, we investigated its role in IL-13-dependent increase in CD23 surface expression. Whereas Stat6 activation in response to IL-4 or IL-13 occurs in minutes, increased CD23 surface expression in response to IL-4 or IL-13 occurs over 4872 h. Because IL-4 responses were unaffected by IL-13R
2 expression, data on response to IL-13 for each clone were normalized to their peak IL-4 response. Both IL-4 and IL-13 induced CD23 surface expression in untransfected cells (Fig. 5A). In contrast, the MDH transfectants revealed significantly decreased CD23 induction at all concentrations of IL-13 when compared with untransfected cells (Fig. 5B). The CD23 response of the MDH clones to IL-4 remained intact.
|
These data demonstrate that IL-13R
2 has an inhibitory role in IL-13-dependent surface CD23 expression. Furthermore, this inhibitory effect is directly proportional to the level of expression and can be largely overcome by increased IL-13 concentrations.
| Discussion |
|---|
|
|
|---|
2 has been demonstrated in numerous tissues, including murine spleen and brain and human liver, lung, and thymus (14). Additionally, IL-13R
2 has been shown to be induced by cytokines (17), parasitic infection (20), and allergen sensitization and challenge (21); thus, its expression will vary in cells depending on the inflammatory state. Herein, we studied a model of IL-13R
2 expression with higher (MDH clones) and lower (MDL clones) expressing transfectants to mirror the effects of varying IL-13R
2 expression in cells. These transfectants were produced in U937 cells, a human monocytic cell line with negligible endogenous IL-13R
2 expression. We characterized the effect of the overall level of expression of IL-13R
2 on the distribution of IL-13R
2 in soluble, surface, and cytosolic compartments. The relative ratios of IL-13R
2 in these three compartments were independent of the overall level of expression. Thus, even though the absolute amount of receptor was higher in MDH clones than in MDL clones, the relative ratios of IL-13R
2 in the three compartments was similar. The level of expression correlated directly with the amount of inhibition of IL-13 responses observed.
There was communication between the soluble, membrane, and cytoplasmic compartments of the receptor. Prolonged treatment of cells with trypsin beyond that needed to remove the surface IL-13R
2 revealed an ongoing decrease in total cell IL-13R
2. This continued decline in IL-13R
2 suggests mobilization of the cytoplasmic IL-13R
2 to the surface where it is susceptible to trypsin-mediated cleavage.
Our data demonstrate that IL-13R
2 is spontaneously released from cells into the medium. This is an important observation because soluble IL-13R
2 has been shown to inhibit IL-13 responses (3). This represents a potential mechanism for IL-13R
2 to have effects on cells distant from its production. It will be critical to define the mechanisms by which IL-13R
2 is released and how these processes are regulated. It could represent a secreted receptor or a cleaved soluble receptor. We observed that IL-13R
2 was released at baseline into the supernatant of cells. This receptor release was roughly proportional to the level of surface expression of Flag-IL-13R
2. This level of soluble IL-13R
2 was unable to inhibit IL-13 signaling in untransfected cells when we transferred the supernatants, most likely because the level of soluble receptor was low. However, under condition of inflammation the levels may be higher and may be functionally relevant. Membrane, intracellular, and soluble IL-13R
2 proportions may be altered in inflammatory states, because studies have shown that IL-13R
2 expression is induced during inflammation. In our experiments, the total level of expression did not affect the cellular distribution, but during inflammation this may not be the case. Furthermore, there may be cellular differences in both the level and distribution of IL-13R
2 as we observed between transfected MDH cells and splenocytes.
Overexpression of IL-13R
2 at modest or high levels resulted in inhibition of IL-13 responses proportional to the level of expression. This was true of both experiments lasting minutes (Stat6 activation) and days (CD23 surface expression). This demonstrates that the inhibitory effects of the receptor were rapid and persistent. In addition, these inhibitory effects could largely be overcome by increasing concentrations of IL-13. Thus, the ability of IL-13R
2 to quench IL-13 responses is dependent on both the level of expression of the receptor and the amount of IL-13 present.
The mechanism of this inhibition is most likely due to the surface receptors. We did not observe an inhibitory effect of the shed receptors in transfer experiments when conditioned medium containing released IL-13R
2 from transfected cells was placed onto untransfected cells. Thus, the IL-13R
2 spontaneously released by the transfected cells was insufficient to explain the inhibitory effects of IL-13R
2, probably due to low levels. In our experiments, IL-13R
2 receptors located at the cell surface are most likely responsible for the observed inhibition of IL-13 signaling and responses. In more complex models of inflammation, it is possible that up-regulated expression or enhanced release of IL-13R
2 from this membrane-bound compartment creates a greater inhibitory effect.
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported by National Institutes of Health Grant K08 AI053150 (to M.O.D.) and National Institutes of Health Grant R01 AI058157 (to G.K.K.H.). ![]()
2 Address correspondence and reprint requests to Dr. Gurjit K. Khurana Hershey, Division of Allergy and Immunology, Childrens Hospital Medical Center, 3333 Burnet Avenue, Cincinnati, OH 45229. E-mail address: Gurjit.Hershey{at}cchmc.org ![]()
3 Abbreviation used in this paper: mIL-13, murine IL-13. ![]()
Received for publication October 28, 2005. Accepted for publication March 26, 2006.
| References |
|---|
|
|
|---|
chain. J. Biol. Chem. 271: 29265-29270.
chain. J. Biol. Chem. 271: 16921-16926.
1 chain and reconstitution with the IL4R
of a functional IL-4/IL-13 receptor complex. FEBS Lett. 401: 163-166. [Medline]
-chains. J. Biol. Chem. 272: 9474-9480.
mRNA expressed in human B, T, and endothelial cells encoding an alternate type-II interleukin-4/interleukin-13 receptor. Eur. J. Immunol. 27: 971-978. [Medline]
1 expression on B cells, T cells and monocytes and its regulation by IL-13 and IL-4. Eur. J. Immunol. 28: 4286-4298. [Medline]
2: molecular cloning, characterization, and comparison with murine IL-13 receptor
1. J. Immunol. 161: 2317-2324.
2 and IL-13R
1 in vivo and in vitro. J. Allergy Clin. Immunol. 111: 720-728. [Medline]
and IL-4 regulate expression of IL-13 receptor
2 on human fibroblasts. Biochem. Biophys. Res. Commun. 312: 1248-1255. [Medline]
2-chain by IL-4 and IL-13 in human keratinocytes: involvement of STAT6, ERK and p38 MAPK pathways. Oncogene 20: 6660-6668. [Medline]
potentiates IL-4/IL-13-induced IL-13R
2 expression. Ann. NY Acad. Sci. 973: 207-209. [Medline]
2 down-modulates granulomatous inflammation and prolongs host survival in schistosomiasis. Proc. Natl. Acad. Sci. USA 101: 586-590.
2 chain in bronchial epithelial cells. Cytokine 24: 293-303. [Medline]
can regulate interleukin (IL)-13 responses. Evidence for intracellular stores of IL-13 receptor
-2 and their rapid mobilization by interferon-
. J. Biol. Chem. 277: 10387-10393.
2 chain. J. Biol. Chem. 276: 25114-25120. This article has been cited by other articles:
![]() |
A. Margulis, K. H. Nocka, A. M. Brennan, B. Deng, M. Fleming, S. J. Goldman, and M. T. Kasaian Mast Cell-Dependent Contraction of Human Airway Smooth Muscle Cell-Containing Collagen Gels: Influence of Cytokines, Matrix Metalloproteases, and Serine Proteases J. Immunol., August 1, 2009; 183(3): 1739 - 1750. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. P. Katsoulotos, M. Qi, J. C. Qi, K. Tanaka, W. E. Hughes, T. J. Molloy, R. Adachi, R. L. Stevens, and S. A. Krilis The Diacylglycerol-dependent Translocation of Ras Guanine Nucleotide-releasing Protein 4 inside a Human Mast Cell Line Results in Substantial Phenotypic Changes, Including Expression of Interleukin 13 Receptor {alpha}2 J. Biol. Chem., January 18, 2008; 283(3): 1610 - 1621. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Khodoun, C. Lewis, J.-Q. Yang, T. Orekov, C. Potter, T. Wynn, M. Mentink-Kane, G. K. Khurana Hershey, M. Wills-Karp, and F. D. Finkelman Differences in Expression, Affinity, and Function of Soluble (s)IL-4R{alpha} and sIL-13R{alpha}2 Suggest Opposite Effects on Allergic Responses J. Immunol., November 15, 2007; 179(10): 6429 - 6438. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Tabata, W. Chen, M. R. Warrier, A. M. Gibson, M. O. Daines, and G. K. K. Hershey Allergy-Driven Alternative Splicing of IL-13 Receptor {alpha}2 Yields Distinct Membrane and Soluble Forms J. Immunol., December 1, 2006; 177(11): 7905 - 7912. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |