The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Related articles in The JI
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zoller, A. L.
Right arrow Articles by Kersh, G. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zoller, A. L.
Right arrow Articles by Kersh, G. J.
The Journal of Immunology, 2006, 176: 7371-7378.
Copyright © 2006 by The American Association of Immunologists

Estrogen Induces Thymic Atrophy by Eliminating Early Thymic Progenitors and Inhibiting Proliferation of beta-Selected Thymocytes1

Allison L. Zoller and Gilbert J. Kersh2

Department of Pathology and Laboratory Medicine, Emory University School of Medicine, Atlanta, GA 30322


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Although it has been established that high levels of estrogen can induce thymic involution, the mechanism by which this happens is not known. We have found that daily i.p. injections of the synthetic estrogen 17-beta-estradiol reduce thymus cellularity by 80% over a period of 4–6 days. Although the atrophy is most strikingly observed in the CD4/CD8 double-positive (DP) thymic subset, the loss of thymocytes is not accompanied by a significant increase in thymocyte apoptosis, suggesting that direct killing of cells may not be the dominant means by which estrogens induce thymic atrophy. Instead, we find that estradiol drastically reduces the lineage-negative, Flt3+Sca-1+c-Kit+ population in the bone marrow, a population that contains thymic homing progenitors. Within the thymus, we observe that estradiol treatment results in a preferential depletion of early thymic progenitors. In addition, we find that estradiol leads to a significant reduction in the proliferation of thymocytes responding to pre-TCR signals. Reduced proliferation of DN3 and DN4 cell subsets is likely the major contributor to the reduction in DP thymocytes that is observed. The reduction in early thymic progenitors is also likely to contribute to thymic atrophy, as we show that estradiol treatment can reduce the size of Rag1-deficient thymuses, which lack pre-TCR signals and DP thymocytes.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The ability of sex hormones to influence lymphocyte development has been recognized for many years. In particular, the ability of estrogen to inhibit postnatal thymocyte development and T cell production has been well documented (1, 2). Ovariectomy drastically reduces serum estrogen levels and results in significant enlargement of the female thymus (3). In contrast, pregnancy is a period in which serum estrogen levels are extremely high, and in mammals, the thymus shrinks dramatically during this time (4, 5). Experimentally, ectopically administered estrogen can induce a level of thymic atrophy similar to pregnancy (2, 6). The physiological importance of the relationship between estrogen and thymus size is not clear. Maintaining maternal tolerance toward an immunologically foreign fetus could require alterations in thymocyte development. This could include a need to limit production of new thymic emigrants, or to shift the balance between CD4 Th cells and CD4+CD25+ regulatory T cells (7). Changes in the thymus could also influence the severity of T cell-mediated autoimmune diseases during pregnancy. Despite the potential importance of the regulation of thymocyte development by estrogen, the mechanism by which estrogen induces thymic atrophy is not known.

T cell development in the thymus has been extensively described at the cellular level. Progenitor cells migrate to the thymus from the bone marrow. Although the phenotype of cells that enter the thymus has not yet been described, the earliest population of cells with clear T cell lineage potential can be referred to as early thymic progenitors (ETPs)3 (8). These cells are c-Kit positive, and low/negative for CD4, CD8, and CD25 expression as well as a number of hemopoietic lineage markers. For the {alpha}beta T cell lineage, the cells then progress through a series of stages defined by CD44 and CD25 expression on cells that are double negative (DN) for CD4 and CD8. The DN2 stage is CD44+CD25+, the DN3 stage is CD44–CD25+, and the DN4 stage is negative for both CD44 and CD25 (9). It is at the DN3 stage that the cells rearrange the TCR beta-chain, and express a pre-TCR consisting of the rearranged beta-chain in a complex with the pre-TCR {alpha}-chain. Pre-TCR signaling induces a proliferative burst and development to the double positive (DP) stage (10). At the DP stage the cells rearrange the TCR {alpha}-chain, and are then selected based on the specificity of the {alpha}beta TCR for self-peptide-MHC (11).

Multiple mechanisms have been put forward to describe how estrogen reduces thymic cellularity. Several studies have suggested that estrogen directly induces apoptosis of DP thymocytes, much like the structurally related glucocorticoid hormones (12, 13). However, evidence of DP thymocyte apoptosis in vivo in response to estrogen has yet to be reported. Indeed, overexpression of anti-apoptotic Bcl-2 expression in DP cells does not rescue mice from estrogen-induced thymic atrophy, arguing against induction of apoptosis in DP thymocytes as a mechanism for estrogen-mediated thymic atrophy (14). Another study has suggested that testosterone can cause apoptosis of DP thymocytes by inducing TNF-{alpha} production and rendering DP thymocytes more sensitive to TNFR signaling (15). This result has not been extended to estrogen, however. An alternative mechanism of estrogen-induced thymic atrophy could be inhibition of thymopoiesis. Estrogen has been implicated in the survival of DN thymocyte populations (1). Estrogen is also known to have an effect on lymphoid progenitor cells in the bone marrow (16, 17, 18). Multiple hormone sensitive stages throughout B lymphopoiesis have been identified, including lineage-negative c-kithigh and c-kitlow precursors (19) and small pre-B cells (20). Estrogens are hypothesized to affect the B cell development pathway through a variety of mechanisms, including inhibition of proliferation and induction of apoptosis (20). Similar mechanisms for estrogen-induced disruption of thymopoiesis have not been explored.

In this study, we have undertaken a detailed analysis of the influence of estrogen on thymocyte development. We have established a model of estrogen-induced thymic atrophy that involves daily i.p. injections of 17-beta-estradiol. This model results in a massive depletion of thymocytes, including a profound reduction in DP thymocytes. We have found that this treatment induces a rapid decrease in T cell progenitors in the bone marrow, as well as a decline in ETP cells in the thymus. Furthermore, we have observed reduced proliferation of thymocytes responding to pre-TCR signals. We have not found any evidence of apoptosis in DP thymocytes, and indeed we have shown estradiol-induced thymic atrophy in Rag1-deficient mice, which lack DP thymocytes. Our data suggest that estrogen depletes the thymus not by killing DP thymocytes, but by inhibiting their production. Inhibition occurs by at least three distinct mechanisms: blocking the expansion of cells after pre-TCR signaling, reducing the number of early thymic progenitors, and reducing progenitor populations that contain thymic precursors.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 Disclosures
 References
 
Mice

Rag1- and IL-7R{alpha}-deficient mice were purchased from The Jackson Laboratory. C57BL/6 mice were purchased from Charles River Laboratories. Age-matched male mice were injected i.p. once daily with vehicle only or 200 µg of beta-estradiol-17-valerate (Sigma-Aldrich) dissolved in ethanol and resuspended in sesame oil (Sigma-Aldrich). These studies were approved by the Emory University Institutional Animal Care and Use Committee.

Flow cytometry

Abs and reagents used in flow cytometry were purchased from eBioscience: anti-CD8-FITC, anti-CD3{epsilon}-FITC, anti-TER-119-FITC, anti-Gr-1-FITC, anti-NK1.1-FITC, anti-CD45.2-FITC, anti-Flt3-biotin, and anti-c-Kit allophycocyanin; Caltag Laboratories: anti-CD11b-FITC, anti-CD45R-FITC, anti-TCR {alpha}beta-FITC, anti-TCR {gamma}{delta}-FITC, anti-CD25-PE, streptavidin-TriColor, and streptavidin-allophycocyanin; BD Pharmingen: anti-CD11c-FITC, anti-CD4-PE, anti-CD44-CyChrome, anti-BrdU-FITC; and Leinco: anti-Sca-1-PE. Thymocytes and bone marrow were stained on ice with appropriate Ab dilutions in PBS containing 0.02% sodium azide and 0.5% BSA. For analysis of apoptosis, thymocytes were stained with Annexin VFITC (Caltag Laboratories) according to the manufacturer’s instructions. Thymocyte lineage marker mix includes CD3, CD8, TER-119, Gr-1, CD11b, NK1.1, CD11c, TCR {alpha}beta, TCR {gamma}{delta}, and CD45R. Bone marrow lineage markers include CD3, CD4, CD8, Gr-1, TER-119, CD11b, and CD45R. Flow cytometry data was collected on a FACSCalibur (BD Immunocytometry Systems), and analyzed using FlowJo software (Tree Star).

Purification of DN2/3 thymocytes

Total thymus from mice exposed to vehicle or estradiol over 48 h was removed and enriched for CD4 and CD8 DN thymocytes using negative selection on anti-CD4- and anti-CD8-conjugated magnetic beads (Dynal Biotech). The remaining cells were then positively selected for CD25 expression using anti-CD25-conjugated beads, which were then subject to RNA extraction.

Quantitative real-time RT-PCR

Total RNA was isolated using the TRIzol reagent (Invitrogen Life Technologies) according to the manufacturer’s instructions. RNA concentrations were determined spectrophotometrically, and 2 µg of RNA was reverse transcribed into cDNA using random primers and Superscript II reverse transcriptase (Invitrogen Life Technologies). Quantitative real-time RT-PCR was performed using Platinum SYBRGreen quantitative PCR SuperMix-UDG (Invitrogen Life Technologies). Triplicate samples were run for 32 cycles of 15 s at 95°C and 60 s at 60°C. PCR products were measured using a GeneAmp 5700 Sequence Detection System (Applied Biosystems). Samples were normalized to beta-actin. Primer sequences used were purchased from Integrated DNA Technologies and were as follows: beta-actin (forward) AAG TGT GAC GTT GAC ATC CGT AA, (reverse) TGC CTG GGT ACA TGG TGG TA; IL-7 (forward) TCT GCT GCC TGT CAC ATC ATC, (reverse) GGA CAT TGA ATT CTT CAC TGA TAT TCA (previously described in Ref. 21); Hes-1 (forward) TCC TGA CGG CCA ATT TGC, (reverse) GGA AGG TGA CAC TGC GTT AGG (previously described in Ref. 22); CCR7 (forward) GACCATGACGGATACCTACCT, (reverse) AGACGCCAAAGATCCAGGACT; and CD25 (forward) ACTCCCATGACAAATCGAGAAAG, (reverse) TCTCTTGGTGCATAGACTGTGT (designed by PrimerBank, <http://pga.mgh.harvard.edu/primerbank/>).

Cellular proliferation

BrdU incorporation was detected with the BrdU flow kit (BD Pharmingen). Mice were injected i.p. with 1 mg of BrdU and sacrificed 5 h later. Thymocytes were fixed in Cytofix/Cytoperm buffer, permeabilized in freezing medium according to the manufacturer’s instructions, and then reincubated in Cytofix/Cytoperm buffer. Cells were then treated with DNase to expose BrdU epitopes, and immunofluorescent staining was performed with anti-BrdU FITC and analyzed by FACSCalibur. 7-Aminoactinomycin D (7-AAD) staining was performed according to the manufacturer’s instructions after permeabilization as described.

Serum estradiol

Serum was collected from mice 24 h after two or six daily estradiol injections. Estradiol was then measured according to the manufacturer’s instructions using the estradiol EIA kit from Alpco Diagnostics.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 Disclosures
 References
 
A model for estrogen-induced thymic atrophy

To investigate the mechanism of estrogen-induced thymic atrophy, we injected 200 µg of the synthetic estrogen 17-beta-estradiol into male C57BL/6 mice daily by an i.p. route. Previous studies have shown that estrogens influence lymphopoiesis in both male and female mice (18, 23). We have chosen to evaluate the effects of elevated estradiol on male mice so as to minimize the complication of cycling sex hormones on our analysis. In experiments in which we have compared estradiol treatment between male and female mice, we have found similar effects on the thymus and bone marrow, suggesting that male and female mice are capable of responding equally to high levels of estradiol (data not shown). Dose-titration studies found that the 200-µg dose was the lowest at which we could observe a maximum effect. This dose resulted in serum levels of estradiol after 2 or 6 days of treatment that were 7255 or 8594 pg/ml, respectively. This result is within the range of serum estradiol detected during late-stage pregnancy (24).

At this dose, we found that significant atrophy began 48 h after injection of estradiol, and thymus cellularity continued to decline out to six days, where it reached a minimum of 19% of vehicle-treated age-matched controls (Fig. 1A), with a preferential reduction of DP thymocytes (Fig. 1B). This observation is consistent with other in vivo systems of elevated estradiol, where loss of cellularity occurs over a period of days/weeks, is dose-dependent, and DP thymocytes are reduced to a small percentage (2, 13, 14, 17, 25, 26). The extent of thymic atrophy after 6 days of estradiol treatment is also similar to what we have observed in pregnant mice at 18.5 days of gestation when the thymus is at a minimum (Fig. 1A).


Figure 1
View larger version (37K):
[in this window]
[in a new window]
  		FIGURE 1. Thymic atrophy induced by elevated estradiol exposure in vivo. Age-matched pairs of 4- to 8-wk-old male C57BL/6 mice were injected i.p. daily with vehicle only or 17-beta-estradiol. A, Absolute number of thymocytes were compared in equivalently treated mice at days 1–6 postexposure using a hemacytometer, and the percentage of control is shown. Pregnant females at day 18.5 gestation were compared with nonpregnant controls. Data represent mean ± SEM, with 3–25 mice per time point. B, Thymocyte distribution after 6 days was examined by flow cytometric analysis of CD4 and CD8.

 
Estradiol exposure induces rapid loss of LSK cells in the bone marrow

Previous studies have shown that estradiol exposure results in a depletion of lymphocyte precursors in the bone marrow that lead to a significant reduction in B lymphopoiesis (16). Bone marrow cells negative for specific lineage markers, but positive for Sca-1 and c-kit (LSK cells) can be depleted after 7 or 14 days of estradiol exposure (16). LSK (lineage-negative, Sca-1+c-Kit+) cells have been shown to contain both T and B cell lineage potential. Recently, it has been demonstrated that the subset of LSK cells with Flt3 expression are enriched for T cell lineage potential, and are found both in the bone marrow and in blood circulation (27). Flt3+ LSK cells are thus likely to contain the precursors that migrate from the bone marrow to the thymus. Depletion of Flt3+ LSK cells in the bone marrow is therefore a possible mechanism by which estradiol inhibits thymocyte development. Examination of bone marrow in animals treated with estradiol vs vehicle revealed that although total bone marrow cellularity was not affected during the short time course of our treatment, after 24 h there was a greater than 60 ± 1.3% reduction in the percentage of Flt3+ LSK cells in estradiol-treated mice (Fig. 2A). There was a further reduction at 48 h, with a substantial decrease in lineage-negative c-Kit+ cells, LSK cells, and Flt3+ LSK cells, as seen in Fig. 2B. We observed continued suppression throughout the duration of our treatment until Flt3+ LSK were only 4 ± 0.04% of normal after 6 days of treatment (Fig. 2A). Although the loss of Flt3+ LSK cells in the bone marrow of estradiol-treated mice may contribute to the maintenance of thymic atrophy over the long term, loss of cells in the bone marrow is not likely to contribute significantly to the depletion of DP thymocytes that we observe after 4–6 days of estradiol treatment. Progenitor cells are thought to require a minimum of 13 days to reach the DP stage after they enter the thymus (28), and there are sufficient progenitors already in the thymus to maintain cellularity of the DP compartment beyond 6 days.


Figure 2
View larger version (23K):
[in this window]
[in a new window]
  		FIGURE 2. Elevated estradiol induces loss of T lineage progenitors in the bone marrow. Age-matched pairs of 6- to 12-wk-old male C57BL/6 mice were injected i.p. daily with vehicle only or 17-beta-estradiol for 1–6 days. Bone marrow was harvested and stained with Abs against lineage markers, Sca-1, c-Kit, and Flt3. Days 1, 3, 4, and 5 (n = 3), day 2 (n = 11), and day 6 (n = 2) are shown. A, Percentage of total bone marrow (bm) and Flt3+ LSK (Lin–Sca-1+c-Kit+) cells in estradiol-treated mice, compared with equivalently treated vehicle-only controls. B, Representative gating strategy of day 2 bone marrow cells. Numbers in the top panel represent percentage of total bone marrow, numbers in the middle panel represent percentage of Lin–, c-kit+ cells, and numbers in the bottom panel represent percentage of bone marrow LSK cells. Shaded histogram is staining with an isotype-matched control Ab.

 
Elevated estradiol depletes ETP

The timing of thymic atrophy after estradiol treatment suggests that DN thymocytes may be a target of estradiol. We therefore examined the effect of estradiol treatment on the different DN subsets. In initial observations, we noted that there was an increase in the percentage of CD4/CD8-negative, CD44+CD25– cells (DN1 cells) after estradiol treatment (Fig. 3A). This could indicate that there is a block in transition to the DN2 stage; however, the DN1 population is actually quite diverse, with most of these cells not adopting the T cell lineage. Expression of c-Kit can be used to define the ETP thymocyte population that is highly enriched for T lineage potential (8). We therefore stained thymocytes after 48 h of estradiol treatment for lineage markers, CD25 and c-kit, and examined the ETP, DN2, DN3, and DN4 cells after estradiol exposure. At this time point, there was a decrease in the absolute number of all of these subsets. However, we found that there was a preferential decrease in ETP and DN2 cells (Fig. 3, B and C), resulting in a low percentage of these cells in the DN population. This loss of early thymic precursors was sustained throughout the length of our observation period (data not shown). We also detected a reproducible down-regulation of CD25 expression within the DN3 subset (Fig. 3, A and B). It is not clear whether this finding was due to decreased expression of CD25 or preferential depletion of CD25high cells. These results indicate that estradiol treatment preferentially reduces the number of ETP before major reductions in overall thymic cellularity or percentage of DP cells.


Figure 3
View larger version (34K):
[in this window]
[in a new window]
  		FIGURE 3. Elevated estradiol induces specific loss of ETP and DN2 thymocytes. Age-matched pairs of 6- to 12-wk-old male C57BL/6 mice were injected i.p. daily with vehicle only or 17-beta-estradiol for 2 days. A, Dot plots display staining for CD44 and CD25 after gating on CD3, CD4, and CD8 triple negative cells. The percentage of DN cells for a representative pair is shown within each quadrant. B, Dot plots display staining for c-Kit and CD25 after gating on lineage-negative cells. C, Mean percentage ± SEM of each DN subset for six pairs of mice is shown. Significance was determined by unpaired two-tailed Student’s t test. *, p < 0.03.

 
Estradiol does not induce progenitors to adopt a B cell fate

The reduction in ETP induced by estradiol could be due to a block in development of the T lineage, or could represent a shift in lineage commitment such that precursors are directed to a B cell fate. Such a shift can occur when Notch signaling is absent in these progenitors (29). To determine whether estradiol-mediated depletion of ETP was a result of a shift in lineage commitment, we determined the number of thymic B cells after 2 and 6 days of estradiol treatment. We found that the absolute number of thymic B cells declined in response to estradiol treatment, but the reduction was similar to the overall decline in thymic cellularity. This resulted in only a marginal increase in the percentage of B cells in the thymus after 2 and 6 days of estradiol treatment (Fig. 4A). When we focused on the CD25–CD44+ DN compartment, we found estradiol induced a slight increase in the percentage of B cells in this group when compared with vehicle treated animals, although this increase was not statistically significant (Fig. 4B). Thus, estradiol treatment results in depletion of cells committed to the T lineage from the DN1 compartment, but does not cause a shift of precursors to the B lineage.


Figure 4
View larger version (26K):
[in this window]
[in a new window]
  		FIGURE 4. Effect of elevated estradiol on thymic B cells. Six- to 7-wk-old male C57BL/6 mice were injected i.p. daily for 2 or 6 days with vehicle only or 17-beta-estradiol. A, Representative B220+ cells are shown as a percentage of total thymocytes ± SEM, with three to eight mice per group. B, Dot plots of 6 day-treated mice show thymocytes gated on CD3-, CD4-, CD8-, and CD25-negative cells with the percentage of B220+ cells shown.

 
Elevated estradiol inhibits proliferation of DN3 and DN4 subsets

Although specific loss of bone marrow LSK, and thymic ETP and DN2 populations will allow estradiol to control the size of the thymus over the long term, previous studies have suggested that >5 days are required for the transition from DN2 to DP thymocyte (28). As we observe significant reduction in the cellularity of the DP compartment within 3–4 days after estradiol exposure, there must also be additional mechanisms accounting for the relatively rapid depletion of DP thymocytes in our system. Pre-TCR signaling in DN3 thymocytes initiates a period of rapid proliferation that results in an estimated 12 rounds of division by the time these cells differentiate into resting DP cells (reviewed in Ref. 30). It is known that inhibiting proliferation in the thymus via injection of an anti-mitotic reagent can lead to maximum depletion of DP thymocytes after 3 days (31). Considering the kinetics of estradiol-induced thymic atrophy (Fig. 1A), we determined the proliferation of DN thymocyte subsets by analyzing BrdU uptake after a 5-h pulse. We found that after 48-h exposure to estradiol, the proliferation of DN1 and DN2 subsets is not changed. However, there was a significant decrease in BrdU incorporation among DN3 and DN4 subsets, such that after estradiol treatment, these subsets were only proliferating 36% (DN3) and 37% (DN4) as much as vehicle-treated mice (Fig. 5, A and B). Consistent with this result, we find a significant decrease in the percentage of cycling DN3 and DN4 cells, as assessed by 7-AAD staining after 2 days of estradiol treatment (Fig. 5C). The reduction in numbers of proliferating DN3 and DN4 cells is not due to increased apoptosis of the proliferating cells, as there is no increase in annexin V-positive staining in either the DN3 or DN4 compartments after 2 or 6 days estradiol treatment (data not shown). Our data suggest that estradiol inhibits the proliferation of thymocytes responding to pre-TCR signals, and that this inhibition is a major factor in the ability of estradiol to deplete the DP thymocyte compartment.


Figure 5
View larger version (16K):
[in this window]
[in a new window]
  		FIGURE 5. Estradiol exposure results in decreased proliferation of DN subsets. Six- to 7-wk-old C57BL/6 mice were injected i.p. daily for 2 days with vehicle only or 17-beta-estradiol. At 20 h after the second injection, mice were given an i.p. injection of 1 mg of BrdU and sacrificed 5 h later. A, Representative histogram showing BrdU+ DN subsets gated on CD3, CD4, and CD8 triple-negative thymocytes. B, The percentage of BrdU+ thymocytes within each DN subset. The data represent seven mice per group ± SEM. Significance was determined by unpaired two-tailed Student’s t test. *, p < 0.005. C, Representative histogram showing percentage of cycling DN3 and DN4 subsets as determined by 7-AAD staining on triple negative thymocytes. D, Thymocytes were extracted after two estradiol injections and enriched for CD25+ DN thymocytes by bead depletion. Quantitative real-time RT-PCR analysis shows that CCR7, CD25, and Hes-1 expression are not changed after estradiol treatment. Data represent three independent experiments ± SEM with two mice per treatment per experiment.

 
A potential target through which estradiol could mediate thymic involution is the Notch pathway. Notch signaling is known to be required for the commitment of early thymocytes to the T cell lineage, whereas in the absence of Notch signaling early thymocytes adopt a B cell fate (29). Notch has also been implicated in promoting proliferation of cells responding to pre-TCR signaling (32). Our data in Fig. 4 show that there is not a significant shift of cells to the B cell lineage after estradiol treatment, suggesting that inhibition of the Notch pathway is not responsible for the loss of ETP. However, inhibition of the Notch pathway remained a possibility for the reduced proliferation of DN3 and DN4 cells. To determine whether estradiol was causing a block in the Notch signaling pathway at the DN3 stage, we evaluated expression of the Notch-regulated target genes CCR7, CD25, and Hes-1 (33). After 2 days in vivo exposure to vehicle alone or estradiol, we isolated CD4–CD8–CD25+ DN2/3 thymocytes via magnetic bead sorting, and analyzed gene expression by quantitative real-time RT-PCR. We observed no loss of CCR7, CD25, or Hes-1 RNA expression upon treatment with estradiol (Fig. 5D). These results suggest that estradiol does not impart a global block on Notch signaling, as these genes have been found to be downstream of the Notch pathway (33, 34).

Estradiol induces thymic atrophy and CD4+CD8+ DP thymocyte depletion in the absence of significant apoptosis

In addition to the inhibition of proliferation of thymocytes in the transition from DN to DP, it is also possible that estradiol kills DP thymocytes directly. Indeed, previous studies have proposed that estradiol functions by inducing apoptosis in DP thymocytes, much like the structurally related glucocorticoids (12, 13). However, the kinetics of DP thymocyte depletion is much different in glucocorticoid treatment, compared with estradiol (17). Glucocorticoids induce rapid apoptosis of DP thymocytes, depleting the DP compartment within hours after treatment (35), whereas estradiol requires days to effectively deplete the DP cells (Fig. 1). The significant difference in kinetics of thymocyte loss between glucocorticoid and estradiol treatment suggests that these two hormones deplete thymocytes by different mechanisms.

We therefore sought to determine whether estradiol caused a significant increase in the apoptosis of DP thymocytes. C57BL/6 male mice were treated with estradiol for 2 and 6 days, and apoptosis of different thymocyte subsets was determined by annexin V staining (Fig. 6). Although the thymus experienced significant cell loss after 2 days of estradiol treatment and almost complete depletion by day 6 (Fig. 1), we were unable to detect any significant increases in the number of apoptotic cells after estradiol exposure. This included the DN, DP, and CD4 and CD8 single positive subsets. In contrast, apoptosis was readily detected by annexin V staining after glucocorticoid treatment (data not shown). These results suggest that induction of apoptosis in the DP subset is not a mechanism by which estradiol causes thymic atrophy.


Figure 6
View larger version (18K):
[in this window]
[in a new window]
  		FIGURE 6. Estradiol induces DP depletion in the absence of significant thymocyte apoptosis. Age-matched pairs of 4-wk-old male C57BL/6 mice were injected i.p. daily for 2 or 6 days with vehicle only or 17-beta-estradiol. Total thymocytes were stained with Abs against CD4 and CD8, and stained with annexin V. The percentage of apoptotic cells within each thymocyte subset was determined by flow cytometric analysis of annexin V. Data represent five to six mice per group ± SEM.

 
Estradiol-induced thymic atrophy occurs in the absence of DP thymocytes

We have found that estradiol can deplete ETP and DN2 cells in the thymus, inhibit the proliferation of cells responding to pre-TCR signals, but not induce apoptosis of DP cells. To determine the significance of estrogenic effects before the initiation of pre-TCR signaling, we investigated whether estradiol could affect the cellularity of Rag1-deficient mice. Mice deficient in expression of Rag1 are unable to rearrange and express TCR genes. These mice cannot express the pre-TCR, and are therefore blocked in thymocyte development at the DN3 stage, before the proliferative expansion and development of DP cells (36). We found that after 6 days exposure to estradiol, there was a significant reduction in the thymic cellularity of Rag1-deficient mice (Fig. 7A). Examination of DN subset distribution in the estradiol-treated Rag1-deficient mice showed that there was a preferential reduction in DN2 cells, and a relative expansion of the DN1 subset. This finding is consistent with our results in normal mice in which the DN1 population becomes more predominant after estradiol preferentially eliminates ETP and DN2 cells. These results indicate that estradiol can deplete thymocytes by influencing events that occur before pre-TCR signaling.


Figure 7
View larger version (48K):
[in this window]
[in a new window]
  		FIGURE 7. Estradiol-induced thymic atrophy occurs in the absence of DP thymocytes. Age-matched pairs of 4- to 8-wk-old male Rag1-deficient mice were injected i.p. daily for 6 days with vehicle only or 17-beta-estradiol, and single-cell suspensions were made from thymus. A, Absolute number of thymocytes were counted and the means ± SEM for five pairs are shown. Significance was determined by unpaired two-tailed Student’s t test. *, p < 0.01. B, Dot plots display staining for CD44 and CD25 after gating on lineage negative cells. The percentage of DN cells for a representative pair is shown within each quadrant.

 
IL-7 is not necessary for estradiol-induced thymic atrophy

Another potential target for estradiol in the thymus is IL-7. Mice deficient in IL-7 signaling show a profound loss of thymic cellularity, varying between 0.01 and 10% of their wild-type littermates (37). This is due to poor survival of DN2 and DN3 precursors in the thymus (38). Ovariectomy, which reduces serum levels of estrogen, has been demonstrated to result in increased levels of IL-7 RNA in the bone marrow, thymus, and spleen at 4 wk after surgery (39). Thus, it is possible that increased levels of estrogen may lead to reduced IL-7 production or signaling and thereby negatively regulate thymopoiesis. To address the influence of estradiol on IL-7 production, we used quantitative real-time RT-PCR to examine IL-7 RNA expression in Rag1-deficient mice after 4 days exposure to estradiol. As seen in Fig. 8A, IL-7 RNA levels in whole thymic extract derived from Rag1-deficient mice treated with estradiol are not significantly different from those treated with vehicle only. Rag1-deficient mice were used to enrich for cells that make IL-7, but we also found no difference in whole thymus IL-7 RNA levels after treatment of normal mice with estradiol (data not shown). This suggests that estradiol does not interfere with IL-7 production, but does not however preclude interference of the IL-7 signaling pathway by estradiol. To examine this possibility, we treated IL-7R{alpha} knockout mice for 6 days with estradiol and examined the extent of thymic atrophy (Fig. 8, B and C). We found that IL-7R-deficient mice are susceptible to estradiol-induced atrophy, indicating that estradiol can mediate its effects independently of this cytokine pathway.


Figure 8
View larger version (24K):
[in this window]
[in a new window]
  		FIGURE 8. Estradiol-induced thymic atrophy occurs independently of IL-7R signaling. A, Rag-1–/– mice were injected i.p. daily for 4 days with vehicle only or 17-beta-estradiol. cDNA was made from RNA extracted from whole thymus, and IL-7 expression analyzed by quantitative real-time RT-PCR. B, Age-matched IL-7R–/– mice were injected i.p. daily with vehicle only or 17-beta-estradiol over 6 days. Thymocyte suspensions were stained with Abs against CD45.2, CD4 and CD8. Absolute number of CD45.2+ thymocytes were analyzed by flow cytometry and the mean ± SEM for 16 vehicle only and for 16 17-beta-estradiol-treated IL-7R–/– mice are shown. The mean is statistically different by two-tailed Student’s t test. *, p < 0.005. C, CD4/CD8 profile gated on CD45.2+ thymocytes for a representative pair of vehicle only or 17-beta-estradiol-treated IL-7R–/– mice. The percentage of cells is shown within each quadrant.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
Disclosures
 References
 
In this study, we demonstrate that elevated estradiol initiates thymic atrophy by inhibiting thymocyte development at multiple stages. The inhibition takes place in the absence of detectable apoptosis. We suggest that the disappearance of DP thymocytes mediated by estradiol is due to inhibition of production, rather than direct killing. We are able to show a significant reduction in DN3 and DN4 proliferation after 48 h of estradiol exposure. In addition, we demonstrated a rapid and specific loss of populations enriched for T lineage progenitors in the bone marrow and thymus. Together, these results indicate that elevated estradiol inhibits thymopoiesis at multiple stages of development, and that DP cells are depleted by estradiol due to elimination of DP thymocyte precursors.

Even though estrogenic effects on the immune system have been observed for decades, the specific targets of estrogen remain elusive, partly due to the ubiquitous expression of estrogen receptor (ER){alpha} and ERbeta. Igarashi et al. (40) has shown both ER{alpha} and ERbeta mRNA expression in Lin–c-Kit+ bone marrow cells, suggesting that these cells may be directly influenced by estradiol. Our data support this finding; however, the effect of estradiol on bone marrow stromal cells has yet to be fully characterized. ER{alpha} and ERbeta expression has also been described in both thymocytes and thymic stromal cells (41). Lindberg et al. (42) and others (43) have shown that estradiol-induced thymic atrophy is mainly mediated by ER{alpha} expression, although ERbeta can clearly play a role and the exact cellular targets are unknown. Our data further suggest that DN thymocytes or the cells that maintain them are influenced by elevated estradiol. Substantiating these findings, we have documented mRNA expression of ER{alpha} in the Rag1-deficient thymus, which consists mainly of DN1-DN3 thymocytes. Future studies evaluating ER{alpha} and ERbeta expression on specific thymocyte and stromal cell subsets will be of great benefit in determining the exact cellular targets of estradiol in the thymus.

Many studies have shown that elevated estrogens lead to a specific decrease in DP thymocytes (1, 2). Elevated levels of other steroid hormones such as glucocorticoids also result in DP depletion due to induction of apoptosis (35). Some studies have proposed that estradiol acts similarly to glucocorticoids and induces apoptosis of DP thymocytes (12, 13). Glucocorticoid-induced direct apoptosis of DP thymocytes has been well documented, although the exact molecular targets remain elusive. It is known that glucocorticoid-induced apoptosis requires caspase-9, and is inhibited by anti-apoptotic Bcl-2 and Bcl-xL (reviewed in Ref. 44). Although some studies have shown mild increases in the percentage of apoptotic thymocytes after estradiol treatment (12, 45), others have been unable to detect significant DNA fragmentation over a broad time course, during which maximal thymic atrophy is occurring (17). Staples et al. (14) have shown that in contrast to glucocorticoid-mediated thymic atrophy, overexpression of Bcl-2 does not rescue mice from estradiol-induced atrophy, indicating a pathway divergent from that used by glucocorticoids. It remains a possibility that rapid clearance of apoptotic cells by phagocytes precludes their direct detection. However, apoptosis is readily detectable after glucocorticoid-induced direct depletion of DP thymocytes. In this study we have examined DP thymocytes after 2 and 6 days estradiol exposure, when the thymus is undergoing significant atrophy, and found no significant increase in annexin V-positive cells. We are also unable to detect any increase in apoptosis of DP cells after estradiol exposure in vitro (data not shown). In addition, our experiments with Rag1-deficient mice show that estradiol can induce thymic atrophy in the absence of DP cells. Our results are therefore consistent with a model in which specific loss of DP thymocytes after estradiol exposure is due to inhibition of thymopoiesis rather than direct targeting of this population. Although a direct effect of estradiol on DP thymocytes cannot be ruled out, our data suggest that inhibition of proliferation in response to pre-TCR signaling as well as decreased numbers of ETP are responsible for estradiol-mediated depletion of DP thymocytes in our model.

DN thymocytes undergo discreet stages of proliferative expansion to generate a large pool of DP thymocytes. Previous studies have demonstrated a decrease in mitotic activity in B lineage precursors after estradiol exposure (20). However, a detailed analysis of thymocyte proliferation had not been undertaken. In this study, we find reduced BrdU uptake in thymocytes undergoing beta selection. A recent study has suggested that proliferation at the DN3 stage is supported by cooperative signals between the pre-TCR complex and Notch, whereby inhibition of either leads to a failure to survive, proliferate or differentiate (32). Thus, the mechanism by which estradiol inhibits DN3/4 proliferation may include the formation of the pre-TCR, signaling downstream of the pre-TCR, or interference with the Notch pathway. Although there is some evidence to suggest that estradiol could directly influence Notch1 expression (46), we find no decrease in RNA levels of Notch target genes in DN2/3 thymocytes after estradiol exposure in vivo. There is also precedence in the literature to suggest estrogenic inhibition of Rag-1 expression (20). This could lead to decreased formation of pre-TCR complexes, and a reduction in proliferation as we have shown. Future studies will be necessary to determine the exact role of estradiol in inhibiting proliferation of beta-selected thymocytes.

There is evidence suggesting that the IL-7 signaling pathway should be considered as a molecular target of estradiol in the thymus. Mice deficient in IL-7R contain only 0.01–10% of normal thymocytes (37), and display a >1000-fold reduction in pro- and pre-B cells in the bone marrow at 7 wk of age (47). As estradiol can negatively regulate both B and T cell development, this raises the possibility that IL-7 could be a common target for estradiol. Indeed, earlier studies have suggested estrogenic regulation of IL-7. IL-7 RNA in the bone marrow, spleen, and thymus has been shown to increase 4 wk after ovariectomy (39). However, in the time frame of our model, we did not see any alteration in total thymus IL-7 RNA after 4 days exposure to estradiol. Furthermore, we found that exposure of IL-7R{alpha}-deficient mice to estradiol for 6 days resulted in significant loss of thymic cellularity, in addition to CD4/CD8 thymic subset alterations. It is important to note that there was significant variability in the ability of estradiol to induce thymic atrophy in IL-7R{alpha}-deficient mice. Variable thymic phenotypes have been observed within the same line of IL-7R{alpha}-deficient mice independent of age and sex, whereby some mice are severely lymphopenic and display a profound block in DP cell development, while other mice have a milder reduction in thymic cellularity and a normal distribution of thymocyte subsets (37). Our experience is consistent with these previous observations. However, by comparing the phenotype of a large number of estradiol-treated IL-7R{alpha}-deficient mice, we are able to conclude that IL-7 signaling is not necessary for estradiol-induced thymic atrophy that occurs after 6 days of treatment. In support of this, neither Flt3+ LSK cells nor ETP express IL-7R, and ETP have been found to be IL-7 nonresponsive in vitro (8, 27). As both of these populations appear to be selectively targeted by estradiol, it is unlikely that estradiol-mediated changes in the thymus are critically dependent on IL-7 signaling.

The state of pregnancy results in many immunologic changes, including increased percentage of CD25+CD4+ regulatory T cells (7), and suppression of B cell (48) and T cell lymphopoiesis (49). These and other alterations at the fetal-maternal interface may act together to protect the immunologically foreign fetus from maternal immune attack. Additional outcomes of an altered maternal immune system include the amelioration or exacerbation of autoimmune diseases such as rheumatoid arthritis or systemic lupus, respectively (50). Although many hormonal alterations occur during pregnancy, elevated levels of estrogens have emerged as a potent immunomodulator. Kincade and others (17, 23) have shown that a single high-dose injection of estradiol can recapitulate significant suppression of B and T cell development. Our observations show a marked and persistent loss of T-lineage progenitors in the bone marrow and thymus after estradiol exposure. This suggests a mechanism whereby thymic atrophy is sustained over an extensive gestation period due to inhibition of thymic-seeding progenitors. It also poses an interesting question of whether suppressed lymphopoiesis is necessary for fetal maintenance, or merely a consequence of elevated maternal hormones. Additional experiments are required to determine the molecular mechanism by which increased estradiol leads to T lineage progenitor depletion.


   Acknowledgments
 
We thank Roberto Pacifici and Ifor Williams for comments on the manuscript.


   Disclosures
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
References
 
The authors have no financial conflict of interest.


   Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by grants from the National Institutes of Health. Back

2 Address correspondence and reprint requests to Dr. Gilbert J. Kersh, Department of Pathology and Laboratory Medicine, Room 7311 Woodruff Memorial Building, Emory University, 101 Woodruff Circle, Atlanta, GA 30322. E-mail address: gkersh{at}emory.edu Back

3 Abbreviations used in this paper: ETP, early thymic progenitor; DN, double negative; DP, double positive; 7-AAD, 7-aminoactinomycin D; ER, estrogen receptor. Back

Received for publication December 5, 2005. Accepted for publication March 28, 2006.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Rijhsinghani, A. G., K. Thompson, S. K. Bhatia, T. J. Waldschmidt. 1996. Estrogen blocks early T cell development in the thymus. Am. J. Reprod. Immunol. 36: 269-277.
  2. Barr, I. G., B. A. Khalid, P. Pearce, B. H. Toh, P. F. Bartlett, R. G. Scollay, J. W. Funder. 1982. Dihydrotestosterone and estradiol deplete corticosensitive thymocytes lacking in receptors for these hormones. J. Immunol. 128: 2825-2828. [Abstract]
  3. Utsuyama, M., K. Hirokawa. 1989. Hypertrophy of the thymus and restoration of immune functions in mice and rats by gonadectomy. Mech. Ageing Dev. 47: 175-185. [Medline]
  4. Clarke, A. G., M. D. Kendall. 1994. The thymus in pregnancy: the interplay of neural, endocrine and immune influences. Immunol. Today 15: 545-551. [Medline]
  5. Clarke, A. G., M. D. Kendall. 1989. Histological changes in the thymus during mouse pregnancy. Thymus 14: 65-78. [Medline]
  6. Novotny, E. A., E. S. Raveche, S. Sharrow, M. Ottinger, A. D. Steinberg. 1983. Analysis of thymocyte subpopulations following treatment with sex hormones. Clin. Immunol. Immunopathol. 28: 205-217. [Medline]
  7. Aluvihare, V. R., M. Kallikourdis, A. G. Betz. 2004. Regulatory T cells mediate maternal tolerance to the fetus. Nat. Immunol 5: 266-271. [Medline]
  8. Allman, D., A. Sambandam, S. Kim, J. P. Miller, A. Pagan, D. Well, A. Meraz, A. Bhandoola. 2003. Thymopoiesis independent of common lymphoid progenitors. Nat. Immunol. 4: 168-174. [Medline]
  9. Godfrey, D. I., J. Kennedy, T. Suda, A. Zlotnik. 1993. A developmental pathway involving four phenotypically and functionally distinct subsets of CD3–CD4–CD8– triple-negative adult mouse thymocytes defined by CD44 and CD25 expression. J. Immunol. 150: 4244-4252. [Abstract]
  10. Wiest, D. L., M. A. Berger, M. Carleton. 1999. Control of early thymocyte development by the pre-T cell receptor complex: a receptor without a ligand?. Semin. Immunol. 11: 251-262. [Medline]
  11. Robey, E., B. J. Fowlkes. 1994. Selective events in T cell development. Annu. Rev. Immunol. 12: 675-705. [Medline]
  12. Okasha, S. A., S. Ryu, Y. Do, R. J. McKallip, M. Nagarkatti, P. S. Nagarkatti. 2001. Evidence for estradiol-induced apoptosis and dysregulated T cell maturation in the thymus. Toxicology 163: 49-62. [Medline]
  13. Do, Y., S. Ryu, M. Nagarkatti, P. S. Nagarkatti. 2002. Role of death receptor pathway in estradiol-induced T-cell apoptosis in vivo. Toxicol. Sci. 70: 63-72. [Abstract/Free Full Text]
  14. Staples, J. E., N. C. Fiore, D. E. Frazier, Jr, T. A. Gasiewicz, A. E. Silverstone. 1998. Overexpression of the anti-apoptotic oncogene, bcl-2, in the thymus does not prevent thymic atrophy induced by estradiol or 2,3,7, 8-tetrachlorodibenzo-p-dioxin. Toxicol. Appl. Pharmacol. 151: 200-210. [Medline]
  15. Guevara Patiño, J. A., M. W. Marino, V. N. Ivanov, J. Nikolich-Zugich. 2000. Sex steroids induce apoptosis of CD8+CD4+ double-positive thymocytes via TNF-{alpha}. Eur. J. Immunol. 30: 2586-2592. [Medline]
  16. Medina, K. L., K. P. Garrett, L. F. Thompson, M. I. Rossi, K. J. Payne, P. W. Kincade. 2001. Identification of very early lymphoid precursors in bone marrow and their regulation by estrogen. Nat. Immunol. 2: 718-724. [Medline]
  17. Silverstone, A. E., D. E. Frazier, Jr, N. C. Fiore, J. A. Soults, T. A. Gasiewicz. 1994. Dexamethasone, beta-estradiol, and 2,3,7,8-tetrachlorodibenzo-p-dioxin elicit thymic atrophy through different cellular targets. Toxicol. Appl. Pharmacol. 126: 248-259. [Medline]
  18. Thurmond, T. S., F. G. Murante, J. E. Staples, A. E. Silverstone, K. S. Korach, T. A. Gasiewicz. 2000. Role of estrogen receptor {alpha} in hematopoietic stem cell development and B lymphocyte maturation in the male mouse. Endocrinology 141: 2309-2318. [Abstract/Free Full Text]
  19. Kouro, T., K. L. Medina, K. Oritani, P. W. Kincade. 2001. Characteristics of early murine B-lymphocyte precursors and their direct sensitivity to negative regulators. Blood 97: 2708-2715. [Abstract/Free Full Text]
  20. Medina, K. L., A. Strasser, P. W. Kincade. 2000. Estrogen influences the differentiation, proliferation, and survival of early B-lineage precursors. Blood 95: 2059-2067. [Abstract/Free Full Text]
  21. Ortman, C. L., K. A. Dittmar, P. L. Witte, P. T. Le. 2002. Molecular characterization of the mouse involuted thymus: aberrations in expression of transcription regulators in thymocyte and epithelial compartments. Int. Immunol. 14: 813-822. [Abstract/Free Full Text]
  22. Anderson, M. K., G. Hernandez-Hoyos, C. J. Dionne, A. M. Arias, D. Chen, E. V. Rothenberg. 2002. Definition of regulatory network elements for T cell development by perturbation analysis with PU.1 and GATA-3. Dev. Biol. 246: 103-121. [Medline]
  23. Medina, K. L., P. W. Kincade. 1994. Pregnancy-related steroids are potential negative regulators of B lymphopoiesis. Proc. Natl. Acad. Sci. USA 91: 5382-5386. [Abstract/Free Full Text]
  24. Bebo, B. F., Jr, A. Fyfe-Johnson, K. Adlard, A. G. Beam, A. A. Vandenbark, H. Offner. 2001. Low-dose estrogen therapy ameliorates experimental autoimmune encephalomyelitis in two different inbred mouse strains. J. Immunol. 166: 2080-2089. [Abstract/Free Full Text]
  25. Okuyama, R., T. Abo, S. Seki, T. Ohteki, K. Sugiura, A. Kusumi, K. Kumagai. 1992. Estrogen administration activates extrathymic T cell differentiation in the liver. J. Exp. Med. 175: 661-669. [Abstract/Free Full Text]
  26. Screpanti, I., S. Morrone, D. Meco, A. Santoni, A. Gulino, R. Paolini, A. Crisanti, B. J. Mathieson, L. Frati. 1989. Steroid sensitivity of thymocyte subpopulations during intrathymic differentiation: effects of 17 beta-estradiol and dexamethasone on subsets expressing T cell antigen receptor or IL-2 receptor. J. Immunol. 142: 3378-3383. [Abstract]
  27. Schwarz, B. A., A. Bhandoola. 2004. Circulating hematopoietic progenitors with T lineage potential. Nat. Immunol. 5: 953-960. [Medline]
  28. Porritt, H. E., K. Gordon, H. T. Petrie. 2003. Kinetics of steady-state differentiation and mapping of intrathymic-signaling environments by stem cell transplantation in nonirradiated mice. J. Exp. Med. 198: 957-962. [Abstract/Free Full Text]
  29. Wilson, A., H. R. MacDonald, F. Radtke. 2001. Notch 1-deficient common lymphoid precursors adopt a B cell fate in the thymus. J. Exp. Med. 194: 1003-1012. [Abstract/Free Full Text]
  30. Shortman, K., M. Egerton, G. J. Spangrude, R. Scollay. 1990. The generation and fate of thymocytes. Semin. Immunol. 2: 3-12. [Medline]
  31. Vasseur, F., A. Le Campion, C. Penit. 2001. Scheduled kinetics of cell proliferation and phenotypic changes during immature thymocyte generation. Eur. J. Immunol. 31: 3038-3047. [Medline]
  32. Ciofani, M., T. M. Schmitt, A. Ciofani, A. M. Michie, N. Çuburu, A. Aublin, J. L. Maryanski, J. C. Zúñiga-Pflücker. 2004. Obligatory role for cooperative signaling by pre-TCR and Notch during thymocyte differentiation. J. Immunol. 172: 5230-5239. [Abstract/Free Full Text]
  33. Huang, Y. H., D. Li, A. Winoto, E. A. Robey. 2004. Distinct transcriptional programs in thymocytes responding to T cell receptor, Notch, and positive selection signals. Proc. Natl. Acad. Sci. USA 101: 4936-4941. [Abstract/Free Full Text]
  34. Jarriault, S., O. Le Bail, E. Hirsinger, O. Pourquié, F. Logeat, C. F. Strong, C. Brou, N. G. Seidah, A. Israël. 1998. Delta-1 activation of notch-1 signaling results in HES-1 transactivation. Mol. Cell. Biol. 18: 7423-7431. [Abstract/Free Full Text]
  35. Ivanov, V. N., J. Nikolic-Zugic. 1998. Biochemical and kinetic characterization of the glucocorticoid-induced apoptosis of immature CD4+CD8+ thymocytes. Int. Immunol. 10: 1807-1817. [Abstract/Free Full Text]
  36. Mombaerts, P., J. Iacomini, R. S. Johnson, K. Herrup, S. Tonegawa, V. E. Papaioannou. 1992. RAG-1-deficient mice have no mature B and T lymphocytes. Cell 68: 869-877. [Medline]
  37. Peschon, J. J., P. J. Morrissey, K. H. Grabstein, F. J. Ramsdell, E. Maraskovsky, B. C. Gliniak, L. S. Park, S. F. Ziegler, D. E. Williams, C. B. Ware, et al 1994. Early lymphocyte expansion is severely impaired in interleukin 7 receptor-deficient mice. J. Exp. Med. 180: 1955-1960. [Abstract/Free Full Text]
  38. Akashi, K., M. Kondo, U. von Freeden-Jeffry, R. Murray, I. L. Weissman. 1997. Bcl-2 rescues T lymphopoiesis in interleukin-7 receptor-deficient mice. Cell 89: 1033-1041. [Medline]
  39. Ryan, M. R., R. Shepherd, J. K. Leavey, Y. Gao, F. Grassi, F. J. Schnell, W. P. Qian, G. J. Kersh, M. N. Weitzmann, R. Pacifici. 2005. An IL-7-dependent rebound in thymic T cell output contributes to the bone loss induced by estrogen deficiency. Proc. Natl. Acad. Sci. USA 102: 16735-16740. [Abstract/Free Full Text]
  40. Igarashi, H., T. Kouro, T. Yokota, P. C. Comp, P. W. Kincade. 2001. Age and stage dependency of estrogen receptor expression by lymphocyte precursors. Proc. Natl. Acad. Sci. USA 98: 15131-15136. [Abstract/Free Full Text]
  41. Kawashima, I., K. Seiki, K. Sakabe, S. Ihara, A. Akatsuka, Y. Katsumata. 1992. Localization of estrogen receptors and estrogen receptor-mRNA in female mouse thymus. Thymus 20: 115-121. [Medline]
  42. Lindberg, M. K., Z. Weihua, N. Andersson, S. Moverare, H. Gao, O. Vidal, M. Erlandsson, S. Windahl, G. Andersson, D. B. Lubahn, et al 2002. Estrogen receptor specificity for the effects of estrogen in ovariectomized mice. J. Endocrinol. 174: 167-178. [Abstract]
  43. Staples, J. E., T. A. Gasiewicz, N. C. Fiore, D. B. Lubahn, K. S. Korach, A. E. Silverstone. 1999. Estrogen receptor {alpha} is necessary in thymic development and estradiol-induced thymic alterations. J. Immunol. 163: 4168-4174. [Abstract/Free Full Text]
  44. Ashwell, J. D., F. W. Lu, M. S. Vacchio. 2000. Glucocorticoids in T cell development and function. Annu. Rev. Immunol. 18: 309-345. [Medline]
  45. Zajchowski, S., L. Hoffman-Goetz. 2000. Supraphysiological level of estrogen exposure in vivo increases lymphoid cell death in mice. Life Sci. 66: 1451-1459. [Medline]
  46. Soares, R., G. Balogh, S. Guo, F. Gartner, J. Russo, F. Schmitt. 2004. Evidence for the Notch signaling pathway on the role of estrogen in angiogenesis. Mol. Endocrinol. 18: 2333-2343. [Abstract/Free Full Text]
  47. Carvalho, T. L., T. Mota-Santos, A. Cumano, J. Demengeot, P. Vieira. 2001. Arrested B lymphopoiesis and persistence of activated B cells in adult interleukin 7–/– mice. J. Exp. Med. 194: 1141-1150. [Abstract/Free Full Text]
  48. Medina, K. L., G. Smithson, P. W. Kincade. 1993. Suppression of B lymphopoiesis during normal pregnancy. J. Exp. Med. 178: 1507-1515. [Abstract/Free Full Text]
  49. Phuc, L. H., M. Papiernik, S. Berrih, D. Duval. 1981. Thymic involution in pregnant mice. I. Characterization of the remaining thymocyte subpopulations. Clin. Exp. Immunol. 44: 247-252. [Medline]
  50. Ostensen, M.. 1999. Sex hormones and pregnancy in rheumatoid arthritis and systemic lupus erythematosus. Ann. NY Acad. Sci. 876: 131-143. [Medline]

Related articles in The JI:

IN THIS ISSUE

The JI 2006 176: 7141-7142. [Full Text]  



This article has been cited by other articles:


Home page
 Mol. Endocrinol.Home page
C. Wang, B. Dehghani, I. J. Magrisso, E. A. Rick, E. Bonhomme, D. B. Cody, L. A. Elenich, S. Subramanian, S. J. Murphy, M. J. Kelly, et al.
GPR30 Contributes to Estrogen-Induced Thymic Atrophy
Mol. Endocrinol., March 1, 2008; 22(3): 636 - 648.
[Abstract] [Full Text] [PDF]

Home page
 Toxicol SciHome page
K. Nohara, K. Ao, Y. Miyamoto, T. Suzuki, S. Imaizumi, Y. Tateishi, S. Omura, C. Tohyama, and T. Kobayashi
Arsenite-Induced Thymus Atrophy is Mediated by Cell Cycle Arrest: A Characteristic Downregulation of E2F-Related Genes Revealed by a Microarray Approach
Toxicol. Sci., February 1, 2008; 101(2): 226 - 238.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
R. Dai, R. A. Phillips, and S. A. Ahmed
Despite Inhibition of Nuclear Localization of NF-{kappa}B p65, c-Rel, and RelB, 17-beta Estradiol Up-Regulates NF-{kappa}B Signaling in Mouse Splenocytes: The Potential Role of Bcl-3
J. Immunol., August 1, 2007; 179(3): 1776 - 1783.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Related articles in The JI
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zoller, A. L.
Right arrow Articles by Kersh, G. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zoller, A. L.
Right arrow Articles by Kersh, G. J.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS