|
|
||||||||
Institute of Immunology and Infection Research, Ashworth Laboratories, University of Edinburgh, Edinburgh, United Kingdom
| Abstract |
|---|
|
|
|---|
, but not by blocking IL-10 or CTLA-4 signaling. During prepatent infection, the macrophage population was restricted to the infection site. However, once infection became patent with systemic release of microfilariae, the suppressive macrophage activity extended peripherally into the tLN. In contrast, the hyporesponsive CD4+ T cell phenotype remained localized at the infection site, and the tLN CD4+ T cell population recovered full Ag responsiveness in the absence of suppressive macrophages. Filarial immunosuppression, therefore, evolves over time at sites increasingly distal to infection, and the mechanisms of filarial down-regulation are dependent on proximity to the infection site. | Introduction |
|---|
|
|
|---|
) and Th2 (IL-5) effector cytokines (6, 7). The isolation of T cells with regulatory characteristics from humans infected with Onchocerca volvulus, Loa loa, and Wuchereria bancrofti indicates that regulatory T cells are involved in filarial suppression (8, 9), and during Litomosoides sigmodontis infection of mice, they play an important role in promoting filarial survival (10). Regulatory T cells, however, are not the only cell type or mechanism involved in modulating the response to infection.
There is clear evidence during human infection that APC function is compromised (11, 12), and rodent models of filarial infection have demonstrated a variety of mechanisms by which filarial parasites immunosuppress their host (13, 14, 15, 16, 17, 18, 19). Mosquito-borne Brugia malayi L3 larvae are able to down-regulate expression of MHC class I and class II on human Langerhans cells and to inhibit their ability to activate T cells in vitro (20), whereas the same parasites, if injected into the murine peritoneal cavity, induce suppressive nematode-elicited macrophages (NeM
)3 that are able to block T cell proliferative responses (21). Thus, from the moment the parasite enters mammalian tissue, it is able to inhibit the priming of the immune response by APC, and influence the development of T cell immunity.
Immune suppression may deepen over the course of infection, and adult parasites are themselves strongly immunosuppressive; implantation of a single juvenile adult female of L. sigmodontis is sufficient to suppress host immunity and delay clearance of i.v. injected microfilariae (Mf) (22). Similarly, implantation of B. malayi adults into the peritoneal cavity recruits NeM
that profoundly inhibit the proliferative responses of T cells (23). These macrophages have an alternatively activated phenotype demonstrated by up-regulated expression of arginase, Fizz-1, and Ym1 as well as reduced proinflammatory chemokine expression (24) and are likely to play a strong anti-inflammatory role at the infection site.
In human studies, filarial immunosuppression is most marked in microfilaremic individuals who carry healthy adult worms and circulating Mf (5). The time of onset of microfilaremia is also associated with maximal immune suppression in a range of animal models (17, 25, 26, 27, 28). In agreement with these findings, studies in mice using i.v. injection of Mf have shown that they induce apoptosis of T cells in a NO-dependent manner (29, 30, 31). Mf Ags have also been shown to inhibit the in vitro maturation and function of human dendritic cells (DC), resulting in impaired T cell priming (32, 33, 34). Together, these studies indicate that filarial suppression acts on multiple cell types within the immune response, and that additional mechanisms of suppression may by invoked by each stage of the life cycle. Due to the absence of a permissible filarial parasite of mice, most studies have been limited to individual stages of the life cycle. However, it is important to consider that the immune response against the adult stage is defined by prior immune interactions with the larval stages. Similarly, responsiveness toward the adult stage will strongly influence immunity to the subsequent Mf stage.
The discovery that the filarial nematode L. sigmodontis will follow its full natural course of infection within certain mouse strains (35) now provides an immunological model to study these events in the context of full infection. Only with this model can one ask which immunoregulatory events allow the infective L3 stage to migrate from skin entry sites to the pleural cavity, to develop there into mature adult parasites, and to establish a patent infection with Mf circulating within the bloodstream. Using L. sigmodontis infection of susceptible BALB/c mice, we have already shown that regulatory T cells increase over the course of infection and are directly responsible for preventing parasite killing (10). Furthermore, once infection achieves patency, CD4+ T cells at the infection site become hyporesponsive to both antigenic and mitogenic stimulation. Distal to the infection site, the immune responses within the draining LN decrease. This suggests that the onset of Mf release is accompanied by a yet more profound degree of immunosuppression.
In this study, we now show that the mechanisms of filarial immunosuppression evolve over time at sites increasingly distal to infection, and that different mechanisms act at different sites. Specifically, we demonstrate that prepatency, L. sigmodontis NeM
are restricted to the infection site, between the pleural membranes (pleural cavity) within the thoracic cavity, resulting in localized suppressive activity. However, as infection becomes patent and Mf are released systemically, the suppressive activity of NeM
extends peripherally into the draining lymph nodes. In contrast, the hyporesponsive phenotype developed at patency by the pleural cavity CD4+ T cell population (10) remained restricted to the site of infection and was not reflected in the draining lymph nodes.
| Materials and Methods |
|---|
|
|
|---|
Female BALB/c and DO11.10 mice were bred in-house or purchased from Harlan Sprague-Dawley and maintained in individually ventilated cages. Mice were used at age 68 wk, and all animal work was conducted in accordance with the Animals (Scientific Procedures) Act 1986. The L. sigmodontis life cycle was maintained in gerbils using the mite vector Ornithonyssus bacoti (36). Mice were infected with a dose of 25 larvae (L3) s.c. Parasites were recovered from the pleural cavity by lavage of the thoracic cavity with 10 ml of cold AIM V medium (Invitrogen Life Technologies). L. sigmodontis whole worm Ag (LsAg) was prepared as the PBS-soluble fraction of homogenized adult male and female worms. For immunization, mice received 10 mg of LsAg emulsified in CFA s.c. in the footpad. For in vivo Ab treatments, mice were injected i.p. 28 days postinfection with either 2 mg of rat IgG (Sigma-Aldrich) or 1 mg of anti-CD25 (PC61) in combination with 1 mg of anti-glucocorticoid-inducible TNFR (anti-GITR, DTA-1).
Cell purifications
The parathymic, posterior mediastinal, and paravertebral lymph nodes (tLN) draining the thoracic cavity were dissociated, washed in AIM V medium, and resuspended in RPMI 1640 (Invitrogen Life Technologies) with 0.5% mouse serum (Caltag-MedSystems), 100 U/ml penicillin, 100 µg/ml streptomycin (Invitrogen Life Technologies), and 2 mM L-glutamine (Invitrogen Life Technologies). Popliteal lymph nodes were taken from LsAg-immunized mice, and spleen cells from naive DO11.10 mice. Pleural exudate cells (PleC) were isolated from the thoracic lavage fluid. CD4+ T cells and CD4-depleted APC were isolated by CD4 MicroBead magnetic cell sorting (Miltenyi Biotec) as per manufacturers instructions, except that HBSS-0.25% mouse serum was used as the separation medium, and 15 µg of rat IgG per 107 cells was used as a block. Thoracic lymph node CD4+ T cell purities were >95%. Gr1+ and Gr1 cells were purified using PE-conjugated anti-Gr1 (RB6-8C5; BD Pharmingen) in conjunction with anti-PE microbeads (Miltenyi Biotec). F4/80+ and F4/80 cells were purified using biotinylated anti-F4/80 (A3-1; Caltag-MedSystems) in conjunction with streptavidin microbeads (Miltenyi Biotec). DC were purified from F4/80 cell fractions using anti-CD11c microbeads (Miltenyi Biotec). B cells were purified positively with anti-CD19 microbeads, or negatively using anti-CD43 microbeads (Miltenyi Biotec). Macrophage purities are shown in Results. B cells were >90% pure, CD11c+ cells were 4752% pure.
In vitro cultures
Whole tLN cells, whole DO11.10 spleen cells, and irradiated CD4-depleted tLN cells were used at 5 x 105 cells/well. For irradiation, cells received 30 Gy. Irradiated spleen cells from naive mice were used as an APC source at 5 x 105 cells/well when compared with CD4-depleted tLN cells, and 1 x 106 cells/well when used in combination with purified APC. CD4+ T cells and irradiated B cells were used at 1 x 105 cells/well. Irradiated DC and F4/80+ cells were used at 5 x 104 cells/well. For in vitro restimulations, cells were cultured with medium alone or 10 µg/ml LsAg for 72 h followed by addition of 1 mCi/well [methyl-3H]thymidine per well for 16 h to measure proliferation. DO11.10 cells were restimulated with 0.5 µg/ml OVA peptide (ISQAVHAAHAEINEAGR) from Advanced Biotechnology Centre (Imperial School of Medicine, London, U.K.). In some experiments anti-IL-10R (1B1.3), whole anti-CTLA-4 (UC10-4F10-11), or anti-CTLA-4 F(ab')2 were added to cultures at the concentrations indicated in the text. Anti-CTLA-4 F(ab')2 were produced from whole Ab using the ImmunoPure Fab kit (Pierce). Both whole anti-CTLA-4 and CTLA-4 F(ab')2 were shown to competitively block the binding of PE-conjugated anti-CTLA-4 (BD Pharmingen) to splenic CD4 T cells. The neutralizing anti-TGF-
Ab (1D11.16) was titrated from 0.01 to 100 µg/ml. Results shown are for a concentration of 50 µg/ml at which maximum reversal of suppression occurred. For suppression assays using the EL-4 thymoma cell line, 1 x 105 PleC or 1 x 106 tLN cells were adhered to 96-well flat-bottom tissue culture plates (Nunc) for 2 h at 37°C and separated into nonadherent and adherent fractions. EL-4 cells were added at 1 x 104 cells/well and after 48 h cultures were pulsed with thymidine as described. The adherent tLN cells were negligible in number and so results are only shown for the nonadherent population.
Flow cytometry, ELISA, and cytospins
For flow cytometry, nonspecific binding was blocked with 4 µg of rat IgG/1 x 106 cells, and the following Abs applied: purified rat anti-Gr1 (RB6-8C5) in combination with FITC-conjugated goat F(ab')2 anti-rat IgG (Caltag-MedSystems), allophycocyanin-conjugated rat anti-CD4 (RM4-5), FITC-conjugated hamster anti-CD11c (HL3), PE-conjugated rat anti-B220 (RA3-6B2), FITC-conjugated rat anti-CD19 (1D3), TriColor-conjugated rat anti-F4/80 (A3-1, Caltag-MedSystems). All staining was compared against the relevant isotype controls to verify specificity. Flow cytometric acquisition and analysis was performed using a FACSCalibur running CellQuest Pro software. Standard IL-4 ELISA was performed using 11B11 and BVD6-24G2 anti-IL-4 Ab pairs. ELISA detection was performed using ExtrAvidin-alkaline phosphatase conjugate (Sigma-Aldrich) in conjunction with Sigma Fast p-nitrophenyl phosphate tablet substrate (Sigma-Aldrich). Cytospins were prepared using 2 x 105 cells/slide and were stained using the Diff-Quik staining kit (Dade Behring) as per the manufacturers instructions. Abs were purchased from BD Pharmingen unless otherwise stated.
Real-time PCR
Cell populations were resuspended in TRIzol (Invitrogen Life Technologies) and RNA extraction was performed as per the manufacturers instructions. After treatment with DNase1 (Ambion), cDNA was synthesized using Moloney murine leukemia virus reverse transcriptase (Stratagene). Quantification of arginase-1 mRNA was performed by real-time PCR using the LightCycler (Roche Diagnostics). The arginase-1 forward and reverse primer sequences were CAGAAGAATGGAAGAGTCAG (exon 3) and CAGATATGCAGGGAGTCACC (exon 5), respectively. PCR amplifications for arginase 1 were performed in 10 µl containing 1 µl of cDNA, 0.3 µM primers, 4 µM MgCl2, and the LightCycler DNA SYBR Green I mix under the following conditions: 30 s denaturation at 95°C, 5 s annealing of primers at 55°C and 12 s elongation at 72°C, for 50 cycles. The fluorescent DNA binding dye was monitored after each cycle at 86°C. Expression of
-actin was used as a control, and PCR conditions are as described.
-Actin forward and reverse primer sequences were TGGAATCCTGTGGCATCCATGAA and TAAAACGCAGCTCAGTAACAGTC, respectively. Five serial dilutions of cDNA pooled from each sample were used to create standard curves for
-actin and arginase 1 (in arbitrary units) against which expression of
-actin and arginase 1 mRNA in the samples was quantified. Arginase 1 mRNA levels were then expressed as a ratio to
-actin mRNA expression.
| Results |
|---|
|
|
|---|
Implantation of adult B. malayi worms into the peritoneal cavity of mice has been shown to recruit an adherent population of NeM
, which are capable of suppressing the Ag-specific proliferation of primary T cells, as well as the Ag-independent proliferation of EL-4 thymoma T cells (21, 37). Similarly, a population of peritoneal exudate cells capable of inhibiting the proliferative responses of spleen cells to mitogen is recruited following implantation of adult L. sigmondontis worms (22). To determine whether a similarly suppressive cell population is recruited to the pleural cavity during a natural L. sigmodontis infection, we isolated the adherent PleC from BALB/c mice 40 days (prepatency) and 60 days (postpatency) postinfection. The adherent cells taken both pre- and postpatency were able to inhibit the proliferation of the T cell thymoma, EL-4 (Fig. 1, left), indicating the recruitment of a NeM
population.
|
Depressed immune responsiveness of lymph node T cells is due to a suppressive non-CD4+ APC population
The presence of an Ag nonspecific suppressive cell population in the draining lymph nodes indicated that the decreased proliferation seen in unfractionated tLN cells at patency (10) is due to the action of a non-CD4+ T cell population. To directly demonstrate the role of APC in the proliferative suppression seen in the lymph node we compared the ability of APC from naive with APC from infected BALB/c mice to restimulate CD4+ T cells. CD4+ T cells were purified from pooled tLN 60 days postinfection, and from the popliteal lymph nodes of mice immunized with LsAg as a source of T cells from a noninfected environment. The CD4+ T cells were restimulated in vitro with LsAg using either irradiated CD4-depleted spleen cells from naive mice, or irradiated CD4-depleted tLN cells from 60-day infected mice. When CD4+ T cells from infected mice were cultured with APC from the tLN of infected mice they showed low levels of Ag-specific proliferation, consistent with findings for unfractionated tLN cells. However, their ability to proliferate in response to Ag was restored when they were cultured with splenic APC from naive mice (Fig. 2A). Similarly, culturing CD4+ T cells purified from immunized mice with APC from infected mice reduced their ability to proliferate in response to Ag. This effect was not due to differences in Ag presentation capabilities between spleen and tLN cells because identical results were seen when tLN cells from naive mice were used as an APC source (Fig. 2B). Thus, T cell unresponsiveness in the tLN at patency is mediated through an APC population.
|
Unfractionated tLN cells isolated prepatency (day 40) showed strong levels of Ag-specific proliferation (10), consistent with the failure of D40 tLN cells to block EL-4 proliferation (Fig. 1, right). Indeed, although CD4+ T cells from infected mice restimulated with postpatent APC showed significantly reduced proliferative responses, restimulation with prepatent (day 40) APC yielded equivalent levels of Ag-specific proliferation to those induced by APC from naive mice (Fig. 2E). This further demonstrates that before patency, down-regulatory APC are detectable only at the site of infection, whereas after the onset of patency the inhibitory APC phenotype is present in the draining lymph nodes.
At the infection site, in concert with the suppressive adherent cell population, an intrinsic defect in Ag responsiveness within the pleural cavity CD4+ T cell compartment develops between pre- and postpatency (10). To test the possibility that two levels of suppression are also acting within the tLN at patency, purified tLN CD4+ T cells from day 40 and day 60 infected mice were challenged with LsAg presented by naive, rather than infected, APC (Fig. 2F). CD4+ T cells purified postpatency did not show a loss of Ag responsiveness compared with prepatent CD4+ T cells and thus, in contrast to the CD4+ T cells at the infection site, tLN CD4+ T cells do not become intrinsically hyporesponsive as infection becomes patent. The immune suppression seen within the peripheral tLN is therefore mediated entirely through non-CD4+ APC.
The suppressive APC are F4/80+ NeM
with an alternatively activated phenotype
An important feature of L. sigmodontis infection is a significant expansion in F4/80+ macrophages at patency, both at the site of infection (naive, 2.37.8 x 105; day 60, 1.08.9 x 106; p < 0.01 Mann-Whitney U test) and in the tLN (naive, 0.25.9 x 104; day 61, 4.311.3 x 106; p < 0.01 Mann-Whitney U test). To determine whether macrophages were responsible for the observed suppression, F4/80+ cells were enriched from the pleural cavity and tLN of infected mice, and from the spleens of naive mice. CD4+ T cells purified from the tLN of infected mice were then challenged with LsAg in the presence or absence of different F4/80+ populations, together with irradiated naive splenic APC. F4/80+ cells enriched from both tLN and pleural cavity 60 days postinfection were able to inhibit CD4+ T cell Ag-specific proliferation (Fig. 3A). The pleural cavity F4/80+ cell fraction was more suppressive than F4/80+ cells from the tLN, perhaps reflecting the higher proportion of F4/80high macrophages within the pleural cavity fraction (39%) compared with the tLN fraction (26%). Despite the strong suppression of Ag-specific proliferative responses by both F4/80+ populations, Ag-specific production of cytokines was unaffected, in terms of IL-4 (Fig. 3B) as well as IL-5, IL-10, and IFN-
(data not shown).
|
Alternatively activated macrophages can be characterized by their expression of arginase 1, Ym1, and Fizz1 (24, 38). We have previously demonstrated that unfractionated PleC from L. sigmodontis-infected mice express Ym1 and Fizz1 (39). In this study, we extend those results to show that the expression of arginase 1 mRNA is up-regulated in both unfractionated and adherent PleC populations, indicating the presence of NeM
bearing an alternatively activated phenotype (Fig. 4, A and B). F4/80+ PleC from infected mice include both F4/80high Gr1 macrophages and F4/80lowGr1+ eosinophils (Fig. 3, C and D). Arginase 1 expression by the pleural cavity NeM
population was assessed by real-time PCR with mRNA from F4/80+ cells (47% F4/80high with 48% F4/80low) and Gr1-purified cells (88% Gr1+). The F4/80+ fraction showed 9-fold higher levels of arginase 1 mRNA than the Gr1+ cells (Fig. 4C), demonstrating that the F4/80+ PleC express arginase 1 and that expression is primarily by macrophages rather than eosinophils. tLN cells isolated from mice 60 days postinfection also showed increased arginase 1 expression (Fig. 4D) consistent with increased Ym1 and Fizz1 expression by these cells (39); however, it was not possible to measure expression in the F4/80+ fraction due to insufficient cell recoveries.
|
, both B cells and DC from the lymph nodes of B. malayi-implanted mice have been shown to express Ym1 and Fizz1, indicating some functional cross-over (39). To determine whether these cell types also had a role in suppressing proliferation, CD11c+ DC and CD19+ B cells were purified from the tLN of L. sigmodontis-infected mice. Neither DC nor B cells from L. sigmodontis-infected mice were able to inhibit Ag-specific proliferation (Fig. 5) or production of IL-4, IL-5, IL-10, or IFN-
(data not shown) of CD4+ T cells isolated from L. sigmodontis-infected mice.
|

CTLA-4 is a known inhibitor of T cell activation and proliferation (40), and during L. sigmodontis infection its intracellular expression is up-regulated on CD4+ T cells within the pleural cavity and tLN (10). To determine whether F4/80+ macrophage suppression of T cell proliferation involves CTLA-4, tLN cells were isolated from infected mice 60 days postinfection and restimulated in vitro with LsAg in the presence of varying concentrations of anti-CTLA-4 whole IgG or anti-CTLA-4 F(ab')2. Neither anti-CTLA-4 whole IgG (Fig. 6A), nor anti-CTLA-4 F(ab')2 (Fig. 6B) were able to restore Ag-specific proliferative responses, indicating that the suppressive effect is not mediated through CTLA-4.
|
have been implicated as a mediators of filarial suppression in several studies (41, 42, 43), however, the proliferative block exerted by B. malayi recruited NeM
has been shown to be IL-10- and TGF-
-independent (21, 44). To confirm whether IL-10 plays a role in the proliferative suppression seen in the tLN of L. sigmodontis-infected mice, whole tLN cells were isolated 60 days postinfection and restimulated in vitro with LsAg in the presence of varying concentrations of a neutralizing Ab against the IL-10R. Neutralizing the IL-10R did not restore the Ag-specific proliferative responses toward LsAg (Fig. 6C), although it did increase IFN-
production (Fig. 6D), indicating that the proliferative suppression is IL-10-independent. To investigate whether L. sigmodontis-recruited NeM
inhibit T cell proliferation through TGF-
, a blocking anti-TGF-
Ab was used to neutralize TGF-
in DO11.10 spleen cell cultures restimulated in vitro with OVA peptide in the presence or absence of F4/80+ cells purified from the pleural cavity of L. sigmodontis-infected mice 60 days postinfection. Adding D60 F4/80+ PleC to the DO11.10 spleen cell cultures suppressed Ag-specific proliferation by 98.6%, and this suppression was reduced to 85% when TGF-
was neutralized (Fig. 6E). Thus, suppression by L. sigmodontis-recruited NeM
is partially dependent on TGF-
, however, TGF-
is not a major suppressive mechanism as TGF-
neutralization only restored proliferation to a maximum of 14% of the control level. Killing of L. sigmodontis can occur in the presence of APC suppression
The potent suppressive ability of the NeM
indicated that they may inhibit the hosts protective immune responses, favoring parasite survival. To test their relative importance in controlling parasite numbers, we used L. sigmodontis-infected BALB/c mice that had been induced to kill their adult parasites through neutralization of CD4+ regulatory T cells by cotreatment with anti-CD25 and anti-GITR Abs (10). Adherent PleC isolated from mice cotreated with anti-CD25 and anti-GITR, or control treated with rat IgG, were tested for their ability to inhibit the proliferation of EL-4 cells. Cotreatment of infected mice with anti-CD25 and anti-GITR did not affect the suppressive phenotype of the adherent PleC population, despite a 72% reduction in the numbers of adult parasites (Fig. 7). As Ab cotreatment did not impact on the suppressive macrophage population, these data demonstrate that killing of adult filariae can be induced by intervening against CD4+ T cell-mediated regulation, even in the presence of suppressive macrophages.
|
| Discussion |
|---|
|
|
|---|
We now demonstrate that although immune regulation within the CD4+ T cell compartment is a critical determinant of filarial survival (10), the inactivation of CD4+ effector T cells into a hyporesponsive phenotype remains restricted to the infection site, and does not explain immune suppression within the draining lymph nodes. We present evidence that beyond the site of infection, immune regulation is mediated by a suppressive F4/80+ population of NeM
acting through a partially TGF-
-dependent, but IL-10- and CTLA-4-independent mechanism. The activity of this NeM
population evolved over the course of infection, being restricted to the infection site during prepatency, and spreading into the draining lymph nodes as infection became patent. Thus, at patency, two independent mechanisms of suppression operate in the pleural cavity, an intrinsic defect in the Ag responsiveness of the CD4+ T cell population and inhibition of proliferation by NeM
. In contrast, in the draining lymph nodes, immune suppression is restricted to the MeM
population.
The suppressive NeM
recruited by L. sigmodontis infection had similar characteristics to the "alternatively activated" peritoneal cavity NeM
in mice implanted with adult B. malayi parasites (18, 21, 23, 24, 37), and their alternatively activated status was confirmed by their expression of arginase 1. Their lack of expression of Gr1 suggests they are distinct from alternatively activated Gr1+ myeloid suppressor cells described in other systems (49, 50, 51). The alternatively activated phenotype is driven by the Th2 responses of the infected host, and NeM
are recruited by a range of different helminth infections (18, 21, 23, 24, 37). Filarial infection induces a Th2 response from first contact with the infective L3 stage (52), and B. malayi L3 are able to recruit NeM
to the peritoneal cavity within 7 days (21). Thus, although the most profound suppression is associated with patency, it is not surprising that NeM
are recruited locally to the site of L. sigmodontis infection from an earlier point. Interestingly, although Th2 responses are seen in the draining lymph nodes from day 12 of L. sigmodontis infection and are equally strong at days 40 and 60 (10), the presence of a Th2 cytokine response was not sufficient in itself to induce the suppressive NeM
response in the tLN. The dissemination of suppressive activity to the lymph nodes only occurred when Mf, released from gravid adult females, exit the pleural cavity and circulate through the blood and draining lymph nodes. Hence, the presence of NeM
peripheral to the infection site may be triggered by the newly systemic nature of infection.
The functional role of NeM
within parasitic infections is still not fully clear. Their ability to suppress T cell responses suggests a role in down-regulating inflammatory responses and limiting pathology during chronic infections, whereas their specialized profile of gene expression (24) indicates further undiscovered functions. Given their potent suppressive capability, a major question is whether NeM
have an influential role in restraining host immunity to parasitism, either through direct inhibition of T cell proliferation, or by driving the T cell toward a regulatory or unresponsive phenotype. Although T cells have been shown to recover full functionality once NeM
have been removed from culture and thus the inhibitory effect of the NeM
is transient (44), the effect of repeated stimulation by inhibitory NeM
has not been investigated, and F4/80+ macrophages have recently been shown to induce CD8+ regulatory T cell activity (53). Significantly, although NeM
inhibited the proliferative responses of T cells, IL-4 and IL-5 cytokine responses remained relatively unaffected. These cytokines are known to be important for protective immunity toward both adult parasites and Mf (54, 55), suggesting that the generation of NeM
in vivo may not have a direct impact on parasite survival. Interestingly, it was found that killing of adult L. sigmodontis parasites induced through the neutralization of regulatory T cell activity, occurred despite the presence of the suppressive NeM
. This indicates that, although multiple levels of suppression do exist, specifically targeting T cell-mediated regulation is sufficient to restore protective immunity. Further in vivo studies, however, will be required to ascertain whether NeM
contribute to the generation of regulatory T cells or T cell hyporesponsiveness during infection.
The marked correlation between the location of functional NeM
and that of the parasite during the different stages of infection indicates a close interaction. Alternatively activated macrophages play an important role in controlling pathology during infection with Schistosoma mansoni (56), and are associated with tissue repair indicating a role in wound healing (39, 57). If the NeM
do not promote L. sigmodontis survival, their role in vivo maybe to limit and repair potentially damaging inflammatory responses. While the adult parasites reside solely within the pleural cavity and the inflammatory response and damage is localized, the NeM
would only be required at the infection site. As Mf begin to migrate through the lymph nodes and bloodstream, potentially inducing more widespread inflammatory responses, then NeM
activity would need to expand to follow the parasites migration. Alternatively, NeM
may play an effector role, either directly through granuloma formation or indirectly through the recruitment of eosinophils by secretion of Ym1 (58) again requiring them to closely follow the migration of the Mf.
The intrinsic responsiveness of the CD4+ T cell populations was determined by their proximity to the infection site, as pleural cavity CD4+ T cells become hyporesponsive (10), whereas those in the tLN retained their ability to respond to Ag. Interestingly, the hyporesponsive phenotype of the pleural cavity CD4+ T cells is associated with greatly increased expression of CTLA-4 and GITR, whereas the tLN CD4+ T cells only show slight increases in CTLA-4 and GITR expression (10). Hyporesponsiveness is therefore associated with a highly activated phenotype, and greatly increased expression of the inhibitory receptor CTLA-4, indicating a potential role for CTLA-4 in the development of filarial-induced CD4+ T cell hyporesponsiveness. It is likely, therefore, that the CD4+ T cells at the infection site represent a resident population of effector T cells that have been chronically exposed to both antigenic challenge and the down-regulatory environment induced by infection resulting in their hyporesponsiveness. In contrast, the lymph nodes are provided with a continual stream of newly activated effector cells from the naive T cell pool, potentially maintaining the Ag responsiveness of the tLN T cell population. In the draining lymph nodes, the presence of NeM
could either benefit the parasite by inhibiting the expansion of these "fresh" effector cells, or benefit the host by polarizing them toward a protective Th2 phenotype (44).
Although the suppressive effects of the NeM
are highly potent in dissociated cell cultures, their function in vivo will be dependent on their location within the lymph node microenvironment, particularly as their main suppressive mechanism appears to be contact-dependent (18, 37). Recently, alternatively activated macrophages recruited by infection with Taenia crassiceps or S. mansoni have been shown to up-regulate expression of PD-L1 and PD-L2, and mediate their suppressive effect through interactions of these ligands with PD-1 expressed on T cells (59, 60). Thus, suppression in vivo by NeM
will likely require direct interactions with their target cell. The ability of T cells to respond to L. sigmodontis in vivo will therefore be defined by the APC type they encounter within the lymph nodes, of which the suppressive NeM
only form a minority. To have an impact on the generation or maintenance of T cell responses within the tLN would require the NeM
to preferentially migrate into the T cell areas and out-compete other APC for T cell interactions. Alternatively, if NeM
are more involved in controlling pathology in situ or as effector cells, then they would be expected to accumulate around the sites of migrating Mf, and may have little influence in the T cell areas. To fully understand the function of NeM
it will therefore be important in the future to follow their movements and interactions with other cell types in vivo.
Immunosuppression during L. sigmodontis infection therefore consists of several independent and overlapping players, CD4+ T cells (including both regulatory and effector cells) and F4/80+ NeM
. These different mechanisms of suppression vary both temporally and spatially with a large part of their progression linked to the onset of patency. The expanded profile of peripheral immune suppression at patency may mark the transition from a localized to a systemic infection, rather than an abrupt induction of new suppressive mechanisms by the parasite. Understanding how filarial suppression develops according to locality to the infection site is of particular importance for human studies where sampling is often restricted to peripheral blood populations. Immune suppression during human infection may, therefore, only be detectable once infection has become systemic, and may not be representative of the regulatory pathways at the actual infection site. The findings described in this study, along with continuing study of the L. sigmodontis model, will provide a framework for understanding and integrating the data on filarial-induced suppression seen in T cells and APC of humans and animals.
| Acknowledgments |
|---|
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported by the Medical Research Council (G9901118), the European Commission (ICA4-CT-1999-10002), and the Wellcome Trust (059423). ![]()
2 Address correspondence and reprint requests to Dr. Rick M. Maizels, Institute of Immunology and Infection Research, Ashworth Laboratories, University of Edinburgh, West Mains Road, Edinburgh EH9 3JT, U.K.; E-mail address: rick.maizels{at}ed.ac.uk or Dr. Judith E. Allen, Institute of Immunology and Infection Research, Ashworth Laboratories, University of Edinburgh, West Mains Road, Edinburgh EH9 3JT, U.K.; E-mail address: j.allen{at}ed.ac.uk ![]()
3 Abbreviations used in this paper: NeM
, nematode-elicited macrophage; Mf, microfilariae; DC, dendritic cell; GITR, glucocorticoid-inducible TNFR; PleC, pleural exudate cell; LsAg, Litomosoides sigmodontis whole worm Ag; tLN, thoracic lymph node. ![]()
Received for publication July 1, 2005. Accepted for publication March 20, 2006.
| References |
|---|
|
|
|---|
responses in human lymphatic filariasis as a function of clinical status and age. J. Infect. Dis. 175: 1276-1280. [Medline]
interferon and interleukin-4 responses in a bovine model of onchocerciasis. Infect. Immun. 69: 4313-4319.
production and myeloid cells are an effector mechanism through which CD1d-restricted T cells block cytotoxic T lymphocyte-mediated tumor immunosurveillance: abrogation prevents tumor recurrence. J. Exp. Med. 198: 1741-1752. This article has been cited by other articles:
![]() |
M. G. Nair, Y. Du, J. G. Perrigoue, C. Zaph, J. J. Taylor, M. Goldschmidt, G. P. Swain, G. D. Yancopoulos, D. M. Valenzuela, A. Murphy, et al. Alternatively activated macrophage-derived RELM-{alpha} is a negative regulator of type 2 inflammation in the lung J. Exp. Med., April 13, 2009; 206(4): 937 - 952. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. J. Mylonas, M. G. Nair, L. Prieto-Lafuente, D. Paape, and J. E. Allen Alternatively Activated Macrophages Elicited by Helminth Infection Can Be Reprogrammed to Enable Microbial Killing J. Immunol., March 1, 2009; 182(5): 3084 - 3094. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Hume Macrophages as APC and the Dendritic Cell Myth J. Immunol., November 1, 2008; 181(9): 5829 - 5835. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. J. McSorley, Y. M. Harcus, J. Murray, M. D. Taylor, and R. M. Maizels Expansion of Foxp3+ Regulatory T Cells in Mice Infected with the Filarial Parasite Brugia malayi J. Immunol., November 1, 2008; 181(9): 6456 - 6466. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Reece, M. C. Siracusa, T. L. Southard, C. F. Brayton, J. F. Urban Jr., and A. L. Scott Hookworm-Induced Persistent Changes to the Immunological Environment of the Lung Infect. Immun., August 1, 2008; 76(8): 3511 - 3524. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Rausch, J. Huehn, D. Kirchhoff, J. Rzepecka, C. Schnoeller, S. Pillai, C. Loddenkemper, A. Scheffold, A. Hamann, R. Lucius, et al. Functional Analysis of Effector and Regulatory T Cells in a Parasitic Nematode Infection Infect. Immun., May 1, 2008; 76(5): 1908 - 1919. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. P. Hubner, B. Pasche, S. Kalaydjiev, P. T. Soboslay, A. Lengeling, H. Schulz-Key, E. Mitre, and W. H. Hoffmann Microfilariae of the Filarial Nematode Litomosoides sigmodontis Exacerbate the Course of Lipopolysaccharide-Induced Sepsis in Mice Infect. Immun., April 1, 2008; 76(4): 1668 - 1677. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D. Taylor, A. Harris, S. A. Babayan, O. Bain, A. Culshaw, J. E. Allen, and R. M. Maizels CTLA-4 and CD4+CD25+ Regulatory T Cells Inhibit Protective Immunity to Filarial Parasites In Vivo J. Immunol., October 1, 2007; 179(7): 4626 - 4634. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Weng, D. Huntley, I-F. Huang, O. Foye-Jackson, L. Wang, A. Sarkissian, Q. Zhou, W. A. Walker, B. J. Cherayil, and H. N. Shi Alternatively Activated Macrophages in Intestinal Helminth Infection: Effects on Concurrent Bacterial Colitis J. Immunol., October 1, 2007; 179(7): 4721 - 4731. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Loke, I. Gallagher, M. G. Nair, X. Zang, F. Brombacher, M. Mohrs, J. P. Allison, and J. E. Allen Alternative Activation Is an Innate Response to Injury That Requires CD4+ T Cells to be Sustained during Chronic Infection J. Immunol., September 15, 2007; 179(6): 3926 - 3936. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Reece, M. C. Siracusa, and A. L. Scott Innate Immune Responses to Lung-Stage Helminth Infection Induce Alternatively Activated Alveolar Macrophages Infect. Immun., September 1, 2006; 74(9): 4970 - 4981. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |