The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Knoechel, B.
Right arrow Articles by Abbas, A. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Knoechel, B.
Right arrow Articles by Abbas, A. K.
The Journal of Immunology, 2006, 176: 6473-6483.
Copyright © 2006 by The American Association of Immunologists

Functional and Molecular Comparison of Anergic and Regulatory T Lymphocytes1

Birgit Knoechel2,*, Jens Lohr2,*, Shirley Zhu{dagger}, Lisa Wong{dagger}, Donglei Hu{dagger}, Lara Ausubel3,* and Abul K. Abbas4,*

* Department of Pathology and {dagger} Diabetes Center, University of California San Francisco School of Medicine, San Francisco, California 94143


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Tolerance in vivo is maintained by multiple mechanisms that function to prevent autoimmunity. An encounter of CD4+ T cells with a circulating self-Ag leads to partial thymic deletion, the development of CD25+ regulatory T cells (Tregs), and functional anergy in the surviving CD25– population. We have compared anergic and regulatory T cells of the same Ag specificity generated in vivo by the systemic self-Ag. Anergic cells are unresponsive to the self-Ag that induces tolerance, but upon transfer into a new host and immunization, anergic cells can induce a pathologic autoimmune reaction against tissue expressing the same Ag. Tregs, in contrast, are incapable of mediating harmful reactions. To define the basis of this functional difference, we have compared gene expression profiles of anergic and regulatory T cells. These analyses show that Tregs express a distinct molecular signature, but anergic cells largely lack such a profile. Anergic cells express transcripts that are associated with effector differentiation, e.g., the effector cytokines IL-4 and IFN-{gamma}. Anergic cells do not produce these cytokines in response to self-Ag, because the cells exhibit a proximal signaling block in response to TCR engagement. Thus, anergy reflects an aborted activation pathway that can readily be reversed, resulting in pathologic effector cell responses, whereas Treg development follows a distinct developmental pathway that extinguishes effector functions.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
T cell tolerance to self-Ags is maintained by three principal mechanisms: anergy (functional unresponsiveness), deletion (apoptotic death), and suppression by regulatory T lymphocytes (1, 2, 3, 4, 5, 6, 7). Many of the studies on which this conclusion is based have relied on cloned cell lines or polyclonal stimuli (8, 9, 10). Much less has been done to address the mechanisms of T cell tolerance induced in normal T cells by self-Ags, especially in vivo. Transgenic (Tg)5 mouse models are valuable for defining the fates of T cells that encounter their cognate Ag in different forms. A large number of studies have shown that deletion, anergy, and suppression by CD25+ regulatory T cells (Tregs) are all demonstrable with Ag receptor Tg T cells (11, 12, 13, 14, 15, 16, 17). However, few studies have formally compared the properties of anergic and regulatory T cells induced in one T cell population by one Ag. In particular, given the considerable interest in inducing T cell anergy as a therapeutic strategy, it is important to ask whether this may be more or less effective than generating Tregs. It is also unclear whether the biochemical and molecular characteristics of anergic and regulatory T cells are distinct or show some overlap.

To address these questions, we have generated a Tg mouse that expresses a secreted form of OVA (sOVA) in the circulation (sOVA Tg mouse) and crossed these animals with TCR Tg mice expressing the DO11.10 (referred to hereafter as DO11) OVA-specific TCR. This is the first experimental system in which both anergic and regulatory T cells are induced by a single self-Ag in the same Ag-specific population, and thus it is possible to formally compare the two cell populations. In this work we show that anergic and regulatory T cells can be distinguished on the basis of function and gene expression profiles. Microarray analysis revealed that anergic CD4+ T cells express very few specific genes. However, they express abundant mRNA for cytokine genes such as Ifn-{gamma} and Il4 that are typically assigned to Th cells with effector function, suggesting that anergic cells in this setting may be "poised" to become true effector cells. We demonstrate that this differentiation also occurs if tolerance is induced de novo when T cells newly encounter a tolerogenic Ag in an adoptive transfer model (18). Similar to T cells that have encountered self-Ag during development, the transferred T cells express IFN-{gamma} mRNA within four days after encounter with the self-Ag. Anergic T cells can even be triggered to secrete IFN-{gamma} upon stimulation in vivo. However, at the same time anergic cells develop a proximal signaling defect leading to decreased Ca2+ mobilization upon TCR stimulation. Importantly, we show that the state of anergy can be broken in that anergic T cells are unresponsive to the systemic self-Ag but retain their ability to trigger severe pathologic autoimmunity. In contrast, regulatory T cells are incapable of causing harmful autoimmune reactions, and they express a large number of genes that are specific to this lineage. Our studies suggest that anergy induction is a double-edged sword in which a signaling block and aborted effector responses develop simultaneously and that this balance may be easily tipped. Regulatory T cells, in contrast, are incapable of effector responses, suggesting that they develop by a distinct pathway. These data have implications for a variety of approaches attempting to induce tolerance in vivo.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 Disclosures
 References
 
Mice

All experimental mice were used at 6–12 wk of age. All mice were age and sex matched ±2 wk. BALB/c mice were purchased from Charles River Laboratory. Tg mice expressing the DO11 TCR specific for the chicken OVA peptide (OVA323–339) in the context of the MHC class II molecule I-Ad were obtained from K. Murphy (Washington University, St. Louis, MO).

sOVA Tg mice express a soluble form of OVA in the serum under control of the metallothionein promoter I and were generated by cloning the OVA cDNA into the metallothionein locus control region expression vector 2999 (kindly provided by R. D. Palmiter (University of Washington, Seattle, WA) (19) and injecting the construct into blastocysts from FVB mice. Founders were screened for OVA expression by Southern blotting and ELISA (anti-OVA; Research Diagnostics), and one founder expressing ~20 ng/ml OVA in the serum was selected. Mice were subsequently typed for the presence of OVA by PCR (forward primer, GCAATGCCTTTCAGAGTGA; reverse primer, GCCCTAAATTCTTCAGAGACG). sOVA Tg mice have normal life expectancy. The mice were backcrossed onto the BALB/c background for >10 generations and crossed with DO11 TCR Tg mice. Rat insulin promoter (RIP)-membrane-bound OVA (mOVA) Tg mice have been described (20, 21). For some experiments they were bred onto a Rag2–/– background.

All mice were bred and maintained in our pathogen-free facility in accordance with the guidelines of the Laboratory Animal Resource Center of the University of California, San Francisco. All experiments were conducted with the approval of the Committee on Animal Research of the University of California, San Francisco.

Abs and flow cytometry

CD4+ cells were stained with the clonotypic Ab KJ1-26 (Caltag Laboratories), anti-CD4 (GK1.5, H129.19, and RM4-5), and anti-CD25 (PC61, 7AD). All Abs were obtained from BD Pharmingen unless otherwise stated. Abs were used as FITC, PE, PE-Cy7, PE-Texas Red, allophycocyanin, or PerCp conjugates. Fc Block (anti-CD16/CD32; BD Biosciences) was added before staining. Flow cytometric analyses were done on a FACSCalibur with CellQuest software (both from BD Biosciences) or on a CyAn analyzer (DakoCytomation). Cells were sorted with a MoFlo cell sorter (DakoCytomation). For intracellular cytokine staining, transferred DO11 T cells recovered from the peripheral or pancreatic lymph nodes of RIP-mOVA Rag–/– recipients were restimulated on mitomycin C-treated BALB/c splenocytes for 14 h in the presence of 1 µg/ml OVA-peptide. Brefeldin A (Epicentre Biotechnologies) was added (10 µg/ml) for the last 2 h of stimulation. Cells were stained for the intracellular cytokines IL-2 and IFN-{gamma} and analyzed by flow cytometry. Staining with appropriate isotype controls showed no detectable differences between experimental groups.

Cell preparations, purification, and adoptive transfer

CD4+KJ1-26+CD25– and CD25+ cells from DO11, DO11 x sOVA Tg, or DO11 x RIP-mOVA Tg mice were recovered by cell sorting from lymph nodes or spleen. For adoptive transfer into wild-type recipients, sorted cells were labeled with 5 µM CFSE (Invitrogen Life Technologies) at 10 x 106 cells/ml for 10 min at 37°C and washed before injection. A total of 0.5–1 x 106 CD4+KJ1-26+CD25– cells (purity > 95%) were adoptively transferred by tail vein injection. In experiments using Rag–/– recipients, a total of 2 x 105 CD4+KJ1-26+CD25– or CD25+ cells were adoptively transferred, and the mice were immunized with 200 µg of OVA protein in IFA s.c. the following day. Activated DO11 cells for gene array were recovered by cell sorting from BALB/c or sOVA Tg mice that had been adoptively transferred with 5 x 106 CFSE-labeled, purified CD4+ cells from the spleen and the lymph nodes of DO11 mice using magnetic beads (Dynal) and were immunized with 200 µg of OVA protein in IFA (Invitrogen Life Technologies) 4 days before sorting.

CD4+ cells for adoptive transfer were purified from spleen and lymph nodes using Dynabeads according to the manufacturer’s protocol (Dynal) and labeled with CFSE where indicated. A total of 5 x 106 CD4+ DO11 T cells (purity > 95%) were transferred into recipients by tail vein injection. CD4+KJ1-26+ cells from lymph nodes were enriched by cell sorting at the indicated time points and used for re-stimulation assays or mRNA isolation.

In vitro proliferation and cytokine assays

Five thousand to 25,000 sorted KJ1-26+CD4+CD25– T cells from DO11 x sOVA Tg and DO11 mice or sOVA Tg and BALB/c transfer recipients were cultured with 0.25 x 105 mitomycin C-treated BALB/c splenocytes in 200 µl of RPMI 1640 medium that contained 10% FCS in 96-well plates (Costar). Cells were stimulated with 0–1 µg/ml OVA. [3H]Thymidine (1 µCi/well) was added during the last 16 h of culture, and incorporation was measured by scintillation counting after 72 h of culture. Unless otherwise indicated, supernatants were collected after 48 h, and levels of IL-2 or IFN-{gamma} were assayed by ELISA as previously described (22). For coculture assays 25,000 sorted KJ1-26+CD4+CD25– T cells from DO11 mice were used as responders and stimulated on 25,000 APCs with 1 µg/ml OVA. The input of responder cells remained constant. KJ1-26+CD4+CD25+ and KJ1-26+CD4+CD25– T cells from double-Tg mice were used as suppressors and, starting from equal numbers, were titrated in 1/4 dilutions. [3H]Thymidine (1 µCi/well) was added during the last 16 h of culture, and incorporation was measured by scintillation counting after 72 h of culture.

RNA purification and amplification

KJ1-26+CD4+CD25– (anergic) and CD25+ (Treg) T cells from DO11 x sOVA Tg and KJ1-26+CD4+CD25– cells from DO11 mice (naive) were sorted from lymph nodes. Activated cells were recovered as cycled KJ1–26+CD4+ cells from BALB/c mice that had been transferred with 5 x 106 CFSE-labeled DO11 cells and immunized with 200 µg of OVA in IFA 4 days before sorting. Cells from up to four mice were pooled for each individual sample per group. Total RNA was isolated using the Absolutely RNA RT-PCR Miniprep kit from Stratagene. To avoid contamination with DNA, samples were treated with DNase (Ambion) before amplification. A total of 56.76 ng of RNA per sample was used for linear in vitro amplification using Superscript II (Invitrogen Life Techologies) for reverse transcription and the MEGAscript T7 kit to generate cRNA (Ambion). The cRNA was used for a second round of amplification and finally labeled with biotinylated ribonucleotides using the Enzo BioArray kit (Affymetrix).

Real-time RT-PCR

Quantitative RT-PCR was performed using real-time fluorogenic PCR (TaqMan) on a PE Biosystems ABI Prism 7700 Sequence BioDetector according to the manufacturer’s instructions (PerkinElmer). Total RNA was extracted as described above and reverse transcribed using Superscript II kit for RT-PCR (Invitrogen Life Technologies). No linear amplification was performed for RT-PCR. Primer and probe sequences for IL-4 and IFN- {gamma}, and hypoxanthine phosphoribosyltransferase (HPRT) were used as published (23).

GeneChip hybridization and analysis

Ten micrograms of cRNA was used to hybridize each MOE430A GeneChip array (Affymetrix). Hybridization was performed in a GeneChip Hybridization Oven 640 (Affymetrix) for 16 h at 45°C. The arrays were washed and stained on a GeneChip Fluidics Station 450 (Affymetrix), and scanned with a GeneChip Scanner 3000 (Affymetrix). Intensities of Perfect Match and Mismatch probes were generated by GeneChip operating software 1.2 (Affymetrix). Gene expression was adjusted with the robust multi-array average method using Bioconductor release 1.3. Robust multiarray average expression measurements of all probe sets were analyzed with one-way ANOVA using version R 1.8.1. Differentially expressed probe sets between groups were considered significant if their p values were <0.01 and their fold-change >2.0. For hierarchical clustering, differentially expressed probe sets were combined and clustered using GeneSpring 6.0 (Silicon Genetics). For identical genes, probe sets displaying the greatest fold change are shown.

Ca2+ flux analysis by flow cytometry

For Ca2+ analysis, lymph node cells or splenocytes were enriched for CD4+ cells by depletion of B220+ and CD8+ cells (Dynal), stained for CD4 and KJ1-26, and labeled with 5 µg/ml indo-1 acetoxymethyl ester (Invitrogen Life Technologies). Ca2+ flux was induced by adding soluble anti-CD3 (2C11; BD Pharmingen). Soluble anti-CD3 was used at 5 µg/ml in experiments with nonpurified DO11 x sOVA Tg T cells and at 40 µg/ml for adoptively transferred DO11 cells because of the higher cell density per sample and low frequency of DO11 cells. Ionomycin (0.5 - 1 µg/ml; Sigma-Aldrich) was used as a positive control. Ca2+ flux was analyzed on a CyAn flow cytometer with an Enterprise 621 UV laser by gating on adoptively transferred, CFSE-labeled KJ1-26+CD4+, KJ1-26+CD4+CD25– T cells in the TCR Tg mice, respectively. The ratio of emission at 400:40 and 450:50 nm over time is shown.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 Disclosures
 References
 
Encounter with self-Ag leads to T cell deletion, anergy, and the development of regulatory T cells

The initial experiments were designed to establish the fate of DO11 T cells that encountered OVA throughout development as a ubiquitously secreted "self-Ag" expressed systemically. To do this, we have generated Tg mice that express a soluble form of OVA and crossed them with DO11 TCR Tg mice. To compare this form of systemic tolerance with tolerance to the self-Ag restricted to tissues, RIP-mOVA mice expressing membrane OVA in islet beta cells were also crossed with DO11 mice. As expected, self-Ag recognition during development results in the deletion of a substantial proportion of the T cells in the thymus, and this is reflected in reduced numbers of DO11 cells in peripheral tissues (Fig. 1A). Thymic deletion is greater in DO11 x sOVA Tg mice than in DO11 x RIP-mOVA Tg mice, perhaps because the secreted Ag is more abundantly expressed in the thymus of sOVA Tg animals. Within the surviving DO11 cells ~30% expressed high levels of CD25, and the majority of these also expressed high levels of CD62L (Fig. 1, A and B), a phenotype that is characteristic of Treg (24). The same pattern of partial T cell deletion and development of CD25+ cells is seen when the DO11 x sOVA Tg is on a Rag–/– background, ensuring a monoclonal T cell population (Fig. 1C). Thus, both the soluble self-Ag and the membrane-associated Ag induce deletion and the development of a population that is phenotypically similar to Tregs.


Figure 1
View larger version (23K):
[in this window]
[in a new window]
  		FIGURE 1. Thymic deletion and development of CD25+ T cells in response to self-Ag. A, Lymph nodes (LN) and thymus (THY) of DO11, DO11 x sOVA Tg, and DO11 x RIP-mOVA Tg mice were harvested, total numbers of DO11 cells were measured by cell counting, and the percentage of KJ1-26+CD4+ cells was determined by flow cytometry. Cells were stained for KJ1-26, CD4, and CD25 to determine the percentage of CD25+ cells. Each symbol represents one individual mouse. B, FACS plots show the expression of CD25 and CD62L in KJ1-26+CD4+ cells from lymph nodes. Data for a representative mouse from four experiments with at least two mice per group are shown. C, Thymi from DO11 Rag–/– or DO11 x sOVA Tg Rag–/– mice were harvested and stained as described in A. Lower graphs are gated on CD4+ single positive thymocytes. Numbers refer to the percentage of gated cells in the upper right quadrant. Data from one representative mouse from two individual experiments with two mice each are shown.

 
In the next series of experiments, we examined the functional capabilities of the CD25– and CD25+ DO11 T cells purified from the lymphoid organs of the DO11 x sOVA Tg mice. We postulated that the surviving CD25– T cells from the DO11 x sOVA Tgs are unresponsive (anergic) to self-Ag, because the mice do not show any manifestations of autoimmunity. To test this hypothesis, CD25– DO11 cells were purified from these mice by cell sorting, labeled with CFSE, and transferred into sOVA Tg recipients. As shown in Fig. 2A, naive DO11 T cells (from TCR Tgs without the Ag) undergo rapid cycling after an encounter with the self-Ag in vivo following adoptive transfer (in separate studies we have found that this initial proliferation is followed by functional unresponsiveness and cell death; Ref. 18). In contrast, DO11 T cells from the DO11 x sOVA Tgs respond much less to the self-Ag.


Figure 2
View larger version (17K):
[in this window]
[in a new window]
  		FIGURE 2. CD4+CD25– T cells from DO11 x sOVA Tg mice are hyporesponsive to Ag in vivo and in vitro. A, KJ1-26+CD4+CD25– cells from DO11 or DO11 x sOVA Tg mice were isolated by cell sorting, labeled with CFSE, and transferred into either BALB/c wild-type or sOVA Tg mice. The CFSE dilution profile was analyzed 4 days after transfer. Numbers refer to the ratio of divided to undivided CD4+KJ1-26+ cells (proliferation index). One representative experiment of three is shown. B, KJ1–26+CD4+CD25– and CD25+ cells from DO11 x sOVA Tg and DO11 x RIP-mOVA Tg mice or KJ1-26+CD4+CD25– cells from DO11 mice were isolated by cell sorting and cultured with Ag plus APCs. Empty squares represent KJ1-26+CD4+CD25– cells from DO11 control mice in all panels. [3H]Thymidine incorporation was assayed on day 3, and supernatants were harvested for cytokine ELISA from the cultures on day 2. Data from one of three experiments are shown.

 
We next examined the responses of these T cells to stimulation with the Ag ex vivo. As shown in Fig. 2B, the CD25– DO11 cells from the DO11 x sOVA mice are markedly hyporesponsive to stimulation with Ag, although their proliferative responses are restored at high Ag concentrations. Thus, these experiments showed that encounter with self-Ag makes CD25– DO11 T cells functionally unresponsive and that this form of anergy can be reversed by stimulation at high Ag concentrations. Under the same conditions, CD25+ cells from the DO11 x sOVA Tg mice are completely unresponsive to Ag in vitro, as has been demonstrated previously in many similar systems (16, 25, 26).

Anergic CD25– cells do not have suppressive activity

In the next series of experiments, we asked whether the anergic CD25– populations had any suppressive activity. In coculture assays, CD25+ cells from DO11 x sOVA Tg mice profoundly suppress the responses of normal DO11 T cells in a dose-dependent manner (Fig. 3). For comparison, we included CD25+ T cells from DO11 x RIP-mOVA Tg mice, which have previously been shown to have potent suppressive activity (26). The suppression is Ag dependent, because CD25+CD4+ cells from normal BALB/c animals do not inhibit the responses of normal DO11 cells to OVA. In contrast to the CD25+ cells, CD25– T cells from either DO11 x sOVA or DO11 x RIP-mOVA Tg mice are not suppressive (Fig. 3). The conclusion of these experiments is that self-Ag encounter induces two populations of T cells: CD25+ regulatory cells and CD25– anergic, but not regulatory, cells.


Figure 3
View larger version (17K):
[in this window]
[in a new window]
  		FIGURE 3. CD4+CD25– T cells from DO11 x sOVA Tg mice are anergic but not suppressive. KJ1–26+CD4+CD25– or CD25+ cells from DO11 x sOVA Tg mice and DO11 x RIP-mOVA Tg mice were isolated by cell sorting and cocultured with KJ1-26+CD4+CD25– cells from DO11 mice with Ag plus APCs. The number of KJ1-26+CD4+ CD25– responder cells from DO11 mice remained constant. The number indicates the input ratio of KJ1–26+CD4+CD25– or CD25+ to KJ1–26+CD4+CD25– responder cells. CD4+CD25+ and CD4+CD25– cells from BALB/c mice were used as controls. [3H]Thymidine incorporation was assayed on day 3, and supernatants were harvested for ELISA on day 2 of culture.

 
Gene expression profiles of anergic and regulatory T cells

Because anergic and regulatory T cells that are chronically exposed to self-Ag show quite different functional response potentials, we asked whether their functions are reflected in the patterns of genes expressed in these cells. We isolated CD25– (anergic) and CD25+ (regulatory) DO11 cells from the DO11 x sOVA Tg mice as well as DO11 cells that had been transferred into BALB/c recipients and activated by immunization. We compared their gene expression profiles with naive DO11 CD25– T cells using Affymetrix gene chips displaying 22,000 probe sets. At the statistical thresholds described in Materials and Methods, we found a total of 511 individual genes that are differentially up- or down-regulated at least 2-fold in any of the anergic, activated, or regulatory T cell population when compared with naive cells. Table I shows a list of selected genes. The complete listing of differentially regulated genes corresponding to the hierarchical clustering shown in Fig. 4 can be found in the supplemental data Table I.


View this table:
[in this window]
[in a new window]
  		Table I. Selected gene expression of anergic, activated, and regulatory T cells compared with naivea

 

Figure 4
View larger version (58K):
[in this window]
[in a new window]
  		FIGURE 4. Gene expression profiles of anergic, regulatory, and activated T cells compared with naive cells. KJ1-26+CD4+CD25– (anergic) and KJ1–26+CD4+CD25+ (regulatory) cells from DO11 x sOVA Tg mice, KJ1-26+CD4+CD25– (naive) cells from DO11 mice, and KJ1-26+CD4+ cells from transferred and immunized BALB/c mice (activated; see Materials and Methods) were isolated by cell sorting. For each of the three replicates, RNA was processed from pooled cells of an individual experiment. Total RNA was extracted, amplified, labeled, and hybridized on Affymetrix gene arrays. A, 591 differentially expressed probe sets in three group comparisons were combined for two-dimensional hierarchical clustering of significant genes. Hierarchical clustering was conducted on all differentially expressed probe sets from 12 GeneChip arrays. Red and blue colors, respectively, indicate high and low levels of expression. B, Solidly filled (black) bars represent the total number of individual genes that are exclusively regulated in the indicated group compared with expression level in naive cells. Mixed filled and open (white) bars show the total number of genes for which up- or down-regulation is shared in the indicated groups compared with naive cells. Within these groups, the open fraction of the bar represents the number of genes that are regulated at least 2-fold more in anergic cells than in activated or regulatory T cells.

 
The hierarchical clustering of targets expressed in the various cell populations makes several important points (Fig. 4, A and B). First, regulatory T cells have a distinct molecular signature that is completely different from that of activated or anergic T cells. We found 123 individual genes that were exclusively regulated in Treg (Fig. 4B). Many of the genes that are uniquely regulated in Treg have been previously described (27, 28); these include Foxp3, Cd25, Ctla4, and a number of inhibitory cytokines, chemokines, and chemokine receptors (Table I and supplemental data Table I) (29, 30, 31). Similarly, a distinct gene expression profile can be found in activated cells (Fig. 4, A and B). The expression level of 149 genes is uniquely regulated in activated cells, many of which play a role in cell division and cell cycle control (Table I and supplemental data Table I).

In contrast, anergic T cells do not express a clear molecular signature (Fig. 4, A and B). Only 24 individual genes are uniquely regulated in anergic cells at a significant level when compared with naive. Many of these have been described as aiding in peripheral deletion (e.g., FasL) or maybe altering the strength of signal transduction, such as Mapk12 (32, 33). Importantly, none of the genes that have been described as being responsible for regulatory T cell function, like Foxp3, are expressed in anergic cells. It is also noteworthy that several genes that are up-regulated in activated T cells are also altered similarly or to a lower extent in anergic cells e.g., members of the TNF superfamily such as RANKL (Tnfsf11) or LIGHT (Tnfsf14) (supplemental data Table I).6 Surprisingly, some of the genes expressed in anergic cells (such as IFN-{gamma} and IL-4) are thought to be characteristic of activated and effector T cells. These findings suggest that anergy may reflect a partial activation phenotype.

Several genes are regulated in the same fashion in activated, regulatory, and anergic T cells (85 genes). These genes may be markers of Ag recognition (Table I and supplemental data Table I). Among these genes are the chemokine receptors CCR9 and CXCR3, known to be expressed on intestinal homing lymphocytes and activated Th1 cells, respectively (34, 35, 36), and the costimulatory molecule ICOS (37, 38). In contrast, genes that are shared between regulatory and anergic but not activated cells most likely reflect exposure to self-Ag rather than regulatory potency and include surface receptors that have been associated with signaling modification in anergic cells and regulatory T cells (e.g., CD5, GITR, CD38, and neuropilin) (Table I) (28, 39, 40, 41, 42, 43, 44).

Therefore, within the groups of genes that are regulated in the same fashion in anergic and activated cells, anergic and Treg cells, or in all three groups, the great majority of the genes is regulated to the same or greater degree in activated or regulatory cells when compared with anergic cells (Fig. 4B and supplemental data Table I). This means that the magnitude of gene regulation in anergic cells, for the most part, lies between naive and regulatory or naive and activated cells. The gene expression profile of anergic cells may therefore reflect partial activation or Ag recognition in general, but failure to fully commit to either the effector or Treg lineage.

Anergy induction in vivo is associated with partial effector differentiation and proximal signaling defects

The genes that are regulated in anergic cells, when compared with naive T cells, appear to fall into two expression patterns. Anergic cells express some genes such as IFN-{gamma} and IL-4, which are typically found in effector cells, and also express other genes such as PD-1, which are shared with regulatory T cells and thus most likely represent genes that are induced by continuous exposure to tolerogenic Ag. We therefore hypothesized that the induction of anergy is accompanied by simultaneous differentiation along an aborted effector pathway and a tolerogenic pathway, with decreased responsiveness to an antigenic stimulus. To test this hypothesis, we used an adoptive transfer model in which CD4-purified DO11 T cells were transferred into sOVA Tg or WT BALB/c recipients (18). After 5 days, the DO11 cells were isolated from the lymph node and spleen by cell sorting and restimulated on Ag ex vivo. Fig. 5A shows that the DO11 cells that had encountered the Ag were defective in proliferation and IL-2 production and did not show any detectable IFN-{gamma} production (data not shown) upon restimulation with Ag and splenocytes ex vivo. Thus, they are considered hyporesponsive and are functionally tolerant. To determine the expression of IFN-{gamma} and IL-4 mRNA, quantitative real-time PCR was performed for DO11 cells that had encountered the Ag in sOVA Tg mice or naive DO11 cells. Fig. 5B shows that self-Ag recognition leads to strong expression of IFN-{gamma} and IL-4 mRNA 4 days after transfer. Thus, anergy induction is accompanied by partial effector differentiation in vivo, and the anergic cells seem to be poised to turn into effector cells but are incapable of secreting the cytokine in a tolerogenic environment.


Figure 5
View larger version (18K):
[in this window]
[in a new window]
  		FIGURE 5. Recognition of tolerogenic Ag by naive T cells promotes expression of effector cytokine mRNA. CD4+-purified DO11 T cells were transferred into WT BALB/c or sOVA Tg animals. Lymphocytes were harvested from peripheral lymph nodes on day 5 (A) or day 4 (B), and CD4+KJ1-26+ cells were isolated by cell sorting. A, Sorted CD4+KJ1-26+ cells were restimulated with APCs and OVA at the indicated doses. [3H]Thymidine incorporation was assayed on day 3, and IL-2 secretion by ELISA was measured on day 2. B, mRNA was isolated from sorted cells and analyzed for the expression of IFN-{gamma}, IL-4, and HPRT by real-time fluorogenic RT-PCR. The abbreviation n.d. represents the amounts of transcript that are not detectable. Transcript abundance is represented as the ratio of cytokine to HPRT. Data are from one representative experiment of three.

 
In view of these findings, we hypothesized that tolerogenic stimuli must use other signaling pathways in parallel that prevent effective cytokine production. To test this hypothesis, we isolated DO11 cells that had been transferred into sOVA Tg or BALB/c recipients and measured Ca2+ mobilization in response to TCR cross-linking. As shown in Fig. 6A, DO11 cells that have encountered the self-Ag show a defect in Ca2+ flux when compared with naive cells. Although cell cycling seems to further promote this signaling block, defective Ca2+ mobilization can already be seen in cells that have not divided. Thus, the induction of anergy is simultaneously associated with the development of a proximal signaling defect as well as with partial effector differentiation. A similar Ca2+ mobilization defect can be seen in CD25– DO11 cells from DO11 x sOVA Tg mice (Fig. 6B). Therefore, it should be possible for anergic cells to acquire full effector function if the antigenic stimulus is strong enough to overcome the signaling block.


Figure 6
View larger version (30K):
[in this window]
[in a new window]
  		FIGURE 6. Anergic CD4+ cells have a cell cycle-independent defect in Ca2+-mobilization. A, CFSE-labeled CD4+ T cells from DO11 mice were adoptively transferred into BALB/c (a) or sOVA Tg recipients on day 0. Splenocytes were recovered 3 days later, and the Ca2+ flux of KJ1-26+CD4+ cells gated on cells that had divided (c) or not divided (b) was measured after stimulation with anti-CD3 as described in Materials and Methods. The table summarizes data from day 3 (d3) to day 5 (d5) with two mice per group. B, Splenocytes from DO11 x sOVA Tg mice or DO11 Tg mice were isolated, stained for KJ1-26, CD4, and CD25, and labeled with indo-1 dye. Ca2+ flux was measured in gated KJ1-26+CD4+CD25– cells after stimulation with soluble anti-CD3. The table summarizes the percentage of KJ1-26+CD4+CD25– cells that flux Ca2+. Data from one of five experiments is shown.

 
CD25– anergic cells but not CD25+ regulatory cells can induce autoimmunity

If responses of anergic cells can be restored with strong stimulation (Fig. 2B), it is possible that anergic cells retain the capacity for causing harmful reactions. It is not known whether the same is true of CD25+ Treg.

To compare the pathogenic potential of these cell populations, we used an experimental system that we have described previously (45) in which DO11 cells induce diabetes when transferred into lymphopenic (Rag–/–) RIP-mOVA recipients and immunized. CD25– or CD25+ DO11 cells were purified from DO11 x sOVA Tg mice and transferred into RIP-mOVA Rag–/– recipients. The recipient mice were immunized with OVA in adjuvant and followed for the development of diabetes. The CD25+ cells failed to induce diabetes. In contrast, all mice that had been transferred with anergic CD25– cells and immunized developed diabetes within 3 wk (Fig. 7A). DO11 T cells were isolated from these mice 4 wk after transfer and analyzed for cytokine production by intracellular cytokine stains. Consistent with diabetes development, the CD25– cells produced IL-2 and IFN-{gamma}, whereas CD25+ regulatory T cells lacked cytokine production (Fig. 7B). Thus, immunization in a model of autoimmunity will make anergic cells autoaggressive, although the same anergic cells do not respond to systemic self-Ag alone (Fig. 2A). In contrast to anergic cells, transfer into RIP-mOVA Rag–/– recipients followed by immunization does not break the unresponsiveness of regulatory T cells.


Figure 7
View larger version (17K):
[in this window]
[in a new window]
  		FIGURE 7. Anergic cells can induce autoimmune diabetes. KJ1–26+CD4+CD25– and KJ1-26+CD4+CD25+ cells from DO11 x sOVA Tg mice or KJ1-26+CD4+CD25– cells from DO11 mice were isolated by cell sorting, and 2 x 105 cells were transferred into RIP-mOVA Rag–/– mice. The recipients were immunized with OVA/IFA the following day. A, Blood glucose readings of recipient mice from week 0 to week 6 are shown. All mice transferred with CD25+ cells remained normoglycemic for >5 wk. Data are from one representative experiment of two. B, Peripheral and pancreatic lymph nodes (LN) of recipients were harvested after 4 wk, restimulated with OVA and APCs, and stained for intracellular cytokines. The average percentage of cytokine-positive KJ1-26+CD4+ cells from two individual mice per group is shown. One representative experiment of two is shown.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
Disclosures
 References
 
The studies in this paper were designed to analyze the properties of anergic and regulatory T cells induced in the same lymphocyte population by a known systemic Ag. By crossing a TCR Tg mouse with a strain that expresses a circulating form of the Ag recognized by the TCR, we have generated both anergic and regulatory T cells with the same Ag specificity in the population that survives thymic deletion. It is therefore possible to compare the functional responses and biochemical properties of these cells in a way that is not feasible in most experimental systems.

In DO11 x sOVA Tg mice, a large fraction of the DO11 cells is deleted in the thymus; among the survivors, ~30% express CD25 (Fig. 1). CD25– cells isolated from these mice are hyporesponsive to the same circulating form of OVA in vivo or to stimulation with the Ag ex vivo (Fig. 2), thus fulfilling the essential criteria for T cell anergy. Interestingly, these anergic cells can be induced to respond at high Ag concentrations (Fig. 2B). More significantly, the anergic cells are able to elicit pathologic reactions against tissue (islet) OVA if the cells are removed from the systemic tolerogen and exposed to an immunogenic form of the Ag (Fig. 7). It has long been suspected that anergy can be broken by strong Ags or by an encounter with microbes, and this loss of the tolerant state results in autoimmune reactions (4, 46, 47, 48, 49). Our studies formally demonstrate that T cells that are chronically exposed to a circulating Ag are unresponsive to the same Ag in vivo but can react strongly to other forms of that Ag. Thus, anergy appears to be a state of "desensitization" that is not permanent and can be overcome by strong external stimuli (17, 50, 51, 52).

The CD25+ cells that develop in the DO11 x sOVA Tg mice have the functional characteristics of Tregs because they inhibit the responses of normal DO11 cells in coculture assays (Fig. 3). In this experimental situation, CD25– DO11 cells have no regulatory function. This is different from other double Tg models in which CD25– cells also show suppressive function, and it may be related to the amount of the Ag or to the way the Ag is presented (16). As expected, the CD25+ Tregs are incapable of mediating pathologic reactions. By this criterion, Tregs are fundamentally different from anergic T cells.

To examine the molecular basis of T cell anergy, we have initiated a study of gene expression profiles in anergic T cells. An important aspect of our studies is that, for the first time, we have compared anergic and regulatory T cells expressing the same Ag receptor and induced by the same self-Ag. This analysis reveals interesting differences between the two cell populations.

Regulatory cells have a clear and distinct molecular signature, as is now widely accepted (27, 28). We found many of the genes that have been described and would be expected to be regulatory based on various methods of detection, the most abundantly expressed of which are Cd25, Foxp3, and Ctla4 (29, 30, 31). Furthermore, it has recently been shown that Treg efficiency can be triggered directly via TLR stimulation (53). The NF-{kappa}B-related genes (RelB, Traf1, and NF{kappa}B2) that are up-regulated in Treg may be important in mediating this effect.

Activated cells present a unique gene expression profile that distinguishes them from both anergic and regulatory T cells. In contrast, anergic cells do not have such a clear signature (Fig. 4). We find that anergic cells regulate many genes in the same fashion as activated or regulatory T cells or both groups. However, the great majority of these genes are regulated at the same or higher magnitude in the activated or regulatory population as compared with anergic cells. This finding suggests that anergic cells have responded to self-Ag but failed to become fully activated or to develop into regulatory cells. It is interesting to note that many genes are regulated in a similar fashion in both anergic and regulatory T cells (Fig. 4 and supplemental Table I). These overlapping genes, such as CD5, GITR, CD38, and neuropilin, may reflect Ag encounter in a tolerogenic rather than immunogenic fashion and may be necessary for preventing the response of T cells, e.g., by varying activation thresholds, but do not confer full commitment to the regulatory T cell lineage. CD5 has been suggested to play a role in down-regulation of TCR responses by recruitment of SHP-1 protein phosphatase (54), and CD5 protein surface expression in our model correlates with RNA levels (data not shown).

How a tolerogenic stimulus is different from an immunogenic stimulus and how these stimuli result in strikingly different functional consequences are fundamental questions. Our results suggest that lymphocyte activation and anergy are associated with surprisingly overlapping cellular responses. For instance, even anergic T cells express abundant transcripts for cytokines thought to be typical of effector responses (IFN-{gamma} and IL-4). The reason why anergic cells do not continuously produce these cytokines when exposed to a self-Ag is because anergy is associated with a proximal signaling block in response to the Ag. This phenomenon has been called "tuning" of the activation threshold of T cells (17). Clearly, however, anergic cells retain their capacity to develop into effector cells, even effector cells capable of causing disease (Fig. 7).

The situation appears to be fundamentally different in regulatory T cells, which show functional responses reflected in the patterns of gene expression that are very different from those in anergiccells. These differences suggest that anergic and regulatory cells do not share a common lineage or developmental pathway.

In summary, by using a simple Tg experimental system with a true self-Ag, our results demonstrate that anergy as a mechanism of tolerance is a fundamentally different process from the development of regulatory T cells. It is important to determine whether either or both of these control pathways are triggered by exposure to different forms of Ags, including self-Ags and chronic microbial infections. Gene expression profiling may be an approach for comparing the relative development of these control mechanisms and how they can be manipulated.


   Acknowledgments
 
We are indebted to S. Jiang and C. McArthur for expert cell sorting and C. Benitez for mouse typing. We thank the members of the Abbas Laboratory and Bluestone Laboratory for helpful discussion.


   Disclosures
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
References
 
The authors have no financial conflict of interest.


   Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by National Institutes of Health Grant PO1 AI35297 and Deutsche Forschungsgemeinschaft Fellowships KN 533/1-1 and LO 808/1-1. Back

2 These authors contributed equally to this work. Back

3 Current address: City of Hope Medical Center, Duarte, CA 91010. Back

4 Address correspondence and reprint requests to Dr. Abul K. Abbas, Department of Pathology, University of California San Francisco, 505 Parnassus Avenue, M590, San Francisco, CA 94143-0511. E-mail address: abul.abbas{at}ucsf.edu Back

5 Abbreviations used in this paper: Tg, transgenic; HPRT, hypoxanthine phosphoribosyltransferase; mOVA, membrane-bound OVA; sOVA, soluble form of OVA; RIP, rat insulin promoter; RMA, robust multiarray average; Treg, CD25+ regulatory T cell. Back

6 The online version of this article contains supplemental material. Back

Received for publication August 9, 2005. Accepted for publication March 15, 2006.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Rocha, B., H. von Boehmer. 1991. Peripheral selection of the T cell repertoire. Science 251: 1225-1228. [Abstract/Free Full Text]
  2. Maloy, K. J., F. Powrie. 2001. Regulatory T cells in the control of immune pathology. Nat. Immunol. 2: 816-822. [Medline]
  3. Schwartz, R. H.. 2003. T cell anergy. Annu. Rev. Immunol. 21: 305-334. [Medline]
  4. Walker, L. S., A. K. Abbas. 2002. The enemy within: keeping self-reactive T cells at bay in the periphery. Nat. Rev. Immunol. 2: 11-19. [Medline]
  5. Shevach, E. M.. 2002. CD4+CD25+ suppressor T cells: more questions than answers. Nat. Rev. Immunol. 2: 389-400. [Medline]
  6. Sakaguchi, S., N. Sakaguchi, J. Shimizu, S. Yamazaki, T. Sakihama, M. Itoh, Y. Kuniyasu, T. Nomura, M. Toda, T. Takahashi. 2001. Immunologic tolerance maintained by CD25+CD4+ regulatory T cells: their common role in controlling autoimmunity, tumor immunity, and transplantation tolerance. Immunol. Rev. 182: 18-32. [Medline]
  7. Marrack, P., J. Kappler. 2004. Control of T cell viability. Annu. Rev. Immunol. 22: 765-787. [Medline]
  8. Schwartz, R. H.. 1996. Models of T cell anergy: is there a common molecular mechanism?. J. Exp. Med. 184: 1-8. [Free Full Text]
  9. Mueller, D. L., M. K. Jenkins, L. Chiodetti, R. H. Schwartz. 1990. An intracellular calcium increase and protein kinase C activation fail to initiate T cell proliferation in the absence of a costimulatory signal. J. Immunol. 144: 3701-3709. [Abstract]
  10. Jenkins, M. K., C. A. Chen, G. Jung, D. L. Mueller, R. H. Schwartz. 1990. Inhibition of antigen-specific proliferation of type 1 murine T cell clones after stimulation with immobilized anti-CD3 monoclonal antibody. J. Immunol. 144: 16-22. [Abstract]
  11. Pape, K. A., R. Merica, A. Mondino, A. Khoruts, M. K. Jenkins. 1998. Direct evidence that functionally impaired CD4+ T cells persist in vivo following induction of peripheral tolerance. J. Immunol. 160: 4719-4729. [Abstract/Free Full Text]
  12. Perez, V. L., L. Van Parijs, A. Biuckians, X. X. Zheng, T. B. Strom, A. K. Abbas. 1997. Induction of peripheral T cell tolerance in vivo requires CTLA-4 engagement. Immunity 6: 411-417. [Medline]
  13. Lanoue, A., C. Bona, H. von Boehmer, A. Sarukhan. 1997. Conditions that induce tolerance in mature CD4+ T cells. J. Exp. Med. 185: 405-414. [Abstract/Free Full Text]
  14. Adler, A. J., C. T. Huang, G. S. Yochum, D. W. Marsh, D. M. Pardoll. 2000. In vivo CD4+ T cell tolerance induction versus priming is independent of the rate and number of cell divisions. J. Immunol. 164: 649-655. [Abstract/Free Full Text]
  15. Jordan, M. S., M. P. Riley, H. von Boehmer, A. J. Caton. 2000. Anergy and suppression regulate CD4(+) T cell responses to a self peptide. Eur. J. Immunol. 30: 136-144. [Medline]
  16. Apostolou, I., A. Sarukhan, L. Klein, H. von Boehmer. 2002. Origin of regulatory T cells with known specificity for antigen. Nat. Immunol. 3: 756-763. [Medline]
  17. Singh, N. J., R. H. Schwartz. 2003. The strength of persistent antigenic stimulation modulates adaptive tolerance in peripheral CD4+ T cells. J. Exp. Med. 198: 1107-1117. [Abstract/Free Full Text]
  18. Lohr, J., B. Knoechel, E. C. Kahn, A. K. Abbas. 2004. Role of B7 in T cell tolerance. J. Immunol. 173: 5028-5035. [Abstract/Free Full Text]
  19. Palmiter, R. D., E. P. Sandgren, D. M. Koeller, R. L. Brinster. 1993. Distal regulatory elements from the mouse metallothionein locus stimulate gene expression in transgenic mice. Mol. Cell. Biol. 13: 5266-5275. [Abstract/Free Full Text]
  20. Kurts, C., H. Kosaka, F. R. Carbone, J. F. Miller, W. R. Heath. 1997. Class I-restricted cross-presentation of exogenous self-antigens leads to deletion of autoreactive CD8(+) T cells. J. Exp. Med. 186: 239-245. [Abstract/Free Full Text]
  21. Lohr, J., B. Knoechel, S. Jiang, A. H. Sharpe, A. K. Abbas. 2003. The inhibitory function of B7 costimulators in T cell responses to foreign and self-antigens. Nat. Immunol. 4: 664-669. [Medline]
  22. Howland, K. C., L. J. Ausubel, C. A. London, A. K. Abbas. 2000. The roles of CD28 and CD40 ligand in T cell activation and tolerance. J. Immunol. 164: 4465-4470. [Abstract/Free Full Text]
  23. Grogan, J. L., M. Mohrs, B. Harmon, D. A. Lacy, J. W. Sedat, R. M. Locksley. 2001. Early transcription and silencing of cytokine genes underlie polarization of T helper cell subsets. Immunity 14: 205-215. [Medline]
  24. Sakaguchi, S.. 2000. Regulatory T cells: key controllers of immunologic self-tolerance. Cell 101: 455-458. [Medline]
  25. Kawahata, K., Y. Misaki, M. Yamauchi, S. Tsunekawa, K. Setoguchi, J. Miyazaki, K. Yamamoto. 2002. Generation of CD4(+)CD25(+) regulatory T cells from autoreactive T cells simultaneously with their negative selection in the thymus and from nonautoreactive T cells by endogenous TCR expression. J. Immunol. 168: 4399-4405. [Abstract/Free Full Text]
  26. Walker, L. S., A. Chodos, M. Eggena, H. Dooms, A. K. Abbas. 2003. Antigen-dependent proliferation of CD4+CD25+ regulatory T cells in vivo. J. Exp. Med. 198: 249-258. [Abstract/Free Full Text]
  27. Gavin, M. A., S. R. Clarke, E. Negrou, A. Gallegos, A. Rudensky. 2002. Homeostasis and anergy of CD4(+)CD25(+) suppressor T cells in vivo. Nat. Immunol. 3: 33-41. [Medline]
  28. McHugh, R. S., M. J. Whitters, C. A. Piccirillo, D. A. Young, E. M. Shevach, M. Collins, M. C. Byrne. 2002. CD4(+)CD25(+) immunoregulatory T cells: gene expression analysis reveals a functional role for the glucocorticoid-induced TNF receptor. Immunity 16: 311-323. [Medline]
  29. Hori, S., T. Nomura, S. Sakaguchi. 2003. Control of regulatory T cell development by the transcription factor Foxp3. Science 299: 1057-1061. [Abstract/Free Full Text]
  30. Fontenot, J. D., M. A. Gavin, A. Y. Rudensky. 2003. Foxp3 programs the development and function of CD4+CD25+ regulatory T cells. Nat. Immunol. 4: 330-336. [Medline]
  31. Khattri, R., T. Cox, S. A. Yasayko, F. Ramsdell. 2003. An essential role for Scurfin in CD4+CD25+ T regulatory cells. Nat. Immunol. 4: 337-342. [Medline]
  32. Chiariello, M., M. J. Marinissen, J. S. Gutkind. 2000. Multiple mitogen-activated protein kinase signaling pathways connect the cot oncoprotein to the c-jun promoter and to cellular transformation. Mol. Cell. Biol. 20: 1747-1758. [Abstract/Free Full Text]
  33. Macian, F., F. Garcia-Cozar, S. H. Im, H. F. Horton, M. C. Byrne, A. Rao. 2002. Transcriptional mechanisms underlying lymphocyte tolerance. Cell 109: 719-731. [Medline]
  34. Zabel, B. A., W. W. Agace, J. J. Campbell, H. M. Heath, D. Parent, A. I. Roberts, E. C. Ebert, N. Kassam, S. Qin, M. Zovko, et al 1999. Human G protein-coupled receptor GPR-9–6/CC chemokine receptor 9 is selectively expressed on intestinal homing T lymphocytes, mucosal lymphocytes, and thymocytes and is required for thymus-expressed chemokine-mediated chemotaxis. J. Exp. Med. 190: 1241-1256. [Abstract/Free Full Text]
  35. Zaballos, A., J. Gutierrez, R. Varona, C. Ardavin, G. Marquez. 1999. Cutting edge: identification of the orphan chemokine receptor GPR-9–6 as CCR9, the receptor for the chemokine TECK. J. Immunol. 162: 5671-5675. [Abstract/Free Full Text]
  36. Rabin, R. L., M. A. Alston, J. C. Sircus, B. Knollmann-Ritschel, C. Moratz, D. Ngo, J. M. Farber. 2003. CXCR3 is induced early on the pathway of CD4+ T cell differentiation and bridges central and peripheral functions. J. Immunol. 171: 2812-2824. [Abstract/Free Full Text]
  37. McAdam, A. J., T. T. Chang, A. E. Lumelsky, E. A. Greenfield, V. A. Boussiotis, J. S. Duke-Cohan, T. Chernova, N. Malenkovich, C. Jabs, V. K. Kuchroo, et al 2000. Mouse inducible costimulatory molecule (ICOS) expression is enhanced by CD28 costimulation and regulates differentiation of CD4+ T cells. J. Immunol. 165: 5035-5040. [Abstract/Free Full Text]
  38. Coyle, A. J., S. Lehar, C. Lloyd, J. Tian, T. Delaney, S. Manning, T. Nguyen, T. Burwell, H. Schneider, J. A. Gonzalo, et al 2000. The CD28-related molecule ICOS is required for effective T cell-dependent immune responses. Immunity 13: 95-105. [Medline]
  39. Lechner, O., J. Lauber, A. Franzke, A. Sarukhan, H. von Boehmer, J. Buer. 2001. Fingerprints of anergic T cells. Curr. Biol. 11: 587-595. [Medline]
  40. Shimizu, J., S. Yamazaki, T. Takahashi, Y. Ishida, S. Sakaguchi. 2002. Stimulation of CD25(+)CD4(+) regulatory T cells through GITR breaks immunological self-tolerance. Nat. Immunol. 3: 135-142. [Medline]
  41. Li, R., D. M. Page. 2001. Requirement for a complex array of costimulators in the negative selection of autoreactive thymocytes in vivo. J. Immunol. 166: 6050-6056. [Abstract/Free Full Text]
  42. Page, D. M.. 1999. Cutting edge: thymic selection and autoreactivity are regulated by multiple coreceptors involved in T cell activation. J. Immunol. 163: 3577-3581. [Abstract/Free Full Text]
  43. Bruder, D., M. Probst-Kepper, A. M. Westendorf, R. Geffers, S. Beissert, K. Loser, H. von Boehmer, J. Buer, W. Hansen. 2004. Neuropilin-1: a surface marker of regulatory T cells. Eur. J. Immunol. 34: 623-630. [Medline]
  44. Read, S., S. Mauze, C. Asseman, A. Bean, R. Coffman, F. Powrie. 1998. CD38+ CD45RB(low) CD4+ T cells: a population of T cells with immune regulatory activities in vitro. Eur. J. Immunol. 28: 3435-3447. [Medline]
  45. Eggena, M. P., L. S. Walker, V. Nagabhushanam, L. Barron, A. Chodos, A. K. Abbas. 2004. Cooperative roles of CTLA-4 and regulatory T cells in tolerance to an islet cell antigen. J. Exp. Med. 199: 1725-1730. [Abstract/Free Full Text]
  46. Sevilla, N., D. Homann, M. von Herrath, F. Rodriguez, S. Harkins, J. L. Whitton, M. B. Oldstone. 2000. Virus-induced diabetes in a transgenic model: role of cross-reacting viruses and quantitation of effector T cells needed to cause disease. J. Virol. 74: 3284-3292. [Abstract/Free Full Text]
  47. Horwitz, M. S., A. Ilic, C. Fine, E. Rodriguez, N. Sarvetnick. 2002. Presented antigen from damaged pancreatic beta cells activates autoreactive T cells in virus-mediated autoimmune diabetes. J. Clin. Invest. 109: 79-87. [Medline]
  48. Benoist, C., D. Mathis. 2001. Autoimmunity provoked by infection: how good is the case for T cell epitope mimicry?. Nat. Immunol. 2: 797-801. [Medline]
  49. Stefanova, I., J. R. Dorfman, M. Tsukamoto, R. N. Germain. 2003. On the role of self-recognition in T cell responses to foreign antigen. Immunol. Rev. 191: 97-106. [Medline]
  50. Adelstein, S., H. Pritchard-Briscoe, T. A. Anderson, J. Crosbie, G. Gammon, R. H. Loblay, A. Basten, C. C. Goodnow. 1991. Induction of self-tolerance in T cells but not B cells of transgenic mice expressing little self antigen. Science 251: 1223-1225. [Abstract/Free Full Text]
  51. Tanchot, C., D. L. Barber, L. Chiodetti, R. H. Schwartz. 2001. Adaptive tolerance of CD4+ T cells in vivo: multiple thresholds in response to a constant level of antigen presentation. J. Immunol. 167: 2030-2039. [Abstract/Free Full Text]
  52. Grossman, Z., W. E. Paul. 2001. Autoreactivity, dynamic tuning, and selectivity. Curr. Opin. Immunol. 13: 687-698. [Medline]
  53. Caramalho, I., T. Lopes-Carvalho, D. Ostler, S. Zelenay, M. Haury, J. Demengeot. 2003. Regulatory T cells selectively express Toll-like receptors and are activated by lipopolysaccharide. J. Exp. Med. 197: 403-411. [Abstract/Free Full Text]
  54. Perez-Villar, J. J., G. S. Whitney, M. A. Bowen, D. H. Hewgill, A. A. Aruffo, S. B. Kanner. 1999. CD5 negatively regulates the T-cell antigen receptor signal transduction pathway: involvement of SH2-containing phosphotyrosine phosphatase SHP-1. Mol. Cell. Biol. 19: 2903-2912. [Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 J. Immunol.Home page
M. Kuczma, R. Podolsky, N. Garge, D. Daniely, R. Pacholczyk, L. Ignatowicz, and P. Kraj
Foxp3-Deficient Regulatory T Cells Do Not Revert into Conventional Effector CD4+ T Cells but Constitute a Unique Cell Subset
J. Immunol., September 15, 2009; 183(6): 3731 - 3741.
[Abstract] [Full Text] [PDF]

Home page
 Int ImmunolHome page
G. Noel, C. Brinster, G. Semana, and D. Bruniquel
Modulation of the TCR stimulation strength can render human activated CD4+ T cells suppressive
Int. Immunol., September 1, 2009; 21(9): 1025 - 1036.
[Abstract] [Full Text] [PDF]

Home page
 JEMHome page
N. Soto-Nieves, I. Puga, B. T. Abe, S. Bandyopadhyay, I. Baine, A. Rao, and F. Macian
Transcriptional complexes formed by NFAT dimers regulate the induction of T cell tolerance
J. Exp. Med., April 13, 2009; 206(4): 867 - 876.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
L. Barron, B. Knoechel, J. Lohr, and A. K. Abbas
Cutting Edge: Contributions of Apoptosis and Anergy to Systemic T Cell Tolerance
J. Immunol., March 1, 2008; 180(5): 2762 - 2766.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
W. Hansen, A. M. Westendorf, S. Reinwald, D. Bruder, S. Deppenmeier, L. Groebe, M. Probst-Kepper, A. D. Gruber, R. Geffers, and J. Buer
Chronic Antigen Stimulation In Vivo Induces a Distinct Population of Antigen-Specific Foxp3 CD25 Regulatory T Cells
J. Immunol., December 15, 2007; 179(12): 8059 - 8068.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
S. A. Joosten, K. E. van Meijgaarden, N. D. L. Savage, T. de Boer, F. Triebel, A. van der Wal, E. de Heer, M. R. Klein, A. Geluk, and T. H. M. Ottenhoff
Identification of a human CD8+ regulatory T cell subset that mediates suppression through the chemokine CC chemokine ligand 4
PNAS, May 8, 2007; 104(19): 8029 - 8034.
[Abstract] [Full Text] [PDF]

Home page
 JEMHome page
J. Lohr, B. Knoechel, J. J. Wang, A. V. Villarino, and A. K. Abbas
Role of IL-17 and regulatory T lymphocytes in a systemic autoimmune disease
J. Exp. Med., December 25, 2006; 203(13): 2785 - 2791.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Knoechel, B.
Right arrow Articles by Abbas, A. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Knoechel, B.
Right arrow Articles by Abbas, A. K.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS