The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow A correction has been published
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fu, Y.
Right arrow Articles by Mohan, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fu, Y.
Right arrow Articles by Mohan, C.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Medline Plus Health Information
*Kidney Diseases
The Journal of Immunology, 2006, 176: 632-639.
Copyright © 2006 by The American Association of Immunologists

Innate Stimuli Accentuate End-Organ Damage by Nephrotoxic Antibodies via Fc Receptor and TLR Stimulation and IL-1/TNF-{alpha} Production1

Yuyang Fu*, Chun Xie*, Jianlin Chen*, Jiankun Zhu*, Hui Zhou{ddagger}, James Thomas{dagger}, Xin J. Zhou{ddagger} and Chandra Mohan2,*

* Division of Rheumatology, and Center for Immunology, {dagger} Department of Pediatrics, and {ddagger} Department of Pathology, University of Texas Southwestern Medical Center, Dallas, TX 75390


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Innate stimuli are well recognized as adjuvants of the systemic immune response. However, their role in driving end-organ disease is less well understood. Whereas the passive transfer of glomerular-targeting Abs alone elicited minimal renal disease, the concomitant delivery of innate stimuli triggered severe nephritis, characterized by proliferative glomerulonephritis with crescent formation, and tubulointerstitial disease. Specifically, stimulating TLR2, TLR3, TLR4, and TLR5 by using peptidoglycan, poly(I:C), LPS, and flagellin, respectively, all could facilitate anti-glomerular Ab-elicited nephritis. In this model, innate and immune triggers synergistically activated several cytokines and chemokines, including IL-1, IL-6, TNF-{alpha}, and MCP-1, some of which were demonstrated to be absolutely essential for the development of renal disease. Genetic studies revealed that, whereas the innate trigger is dependent on TLR/IL-1R-associated kinase-mediated signaling, the immune component was contingent on FcR-mediated signals. Importantly, infiltrating leukocytes as well as intrinsic glomerular cells may both serve to integrate these diverse signals. Extrapolating to spontaneous immune-mediated nephritis, although the adaptive immune system may be important in generating end-organ targeting Abs, the extent of damage inflicted by these Abs may be heavily dependent on cues from the innate immune system.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The nephrotoxic serum nephritis (NSN),3 model described by Masugi (1) has been very useful for the study of renal susceptibility to immune-mediated insult. Although it was initially applied to rats, its power and utility really came to the fore when applied to mice. This was due to the ready availability of a large spectrum of murine knockout and transgenic models. Thus, for instance, our understanding of how various molecules such as MCP-1, complement, FcR, GM-CSF, etc., impact the genesis of Ab-mediated glomerulonephritis (GN) has been advanced by NSN-based studies conducted in mice engineered to be deficient in the respective molecules (2, 3, 4, 5, 6, 7, 8, 9, 10).

In the most commonly executed version of the protocol, the mice are first sensitized to rabbit Ig (or sheep Ig) before administering rabbit (or sheep) anti-glomerular basement membrane (anti-GBM) Abs. This constitutes the "accelerated" or "active" NSN model and results in fairly severe renal disease in a strain-dependent manner (11, 12). In contrast, the "passive" administration of anti-GBM Abs alone without any presensitization results in modest disease. Hence, the presence of a glomerular-specific humoral insult alone appears to be insufficient to trigger florid renal disease. The adjuvant used for sensitization in the "active" NSN protocol might potentially be contributing to disease in a couple of different nonmutually exclusive ways. First, it could potentially activate different innate signaling pathways, mediated via TLRs. Second, adjuvant presensitization may be important for the generation of an arsenal of rabbit (or sheep) Ig-reactive T cells, and this autologous phase may play a key role in driving end-organ disease. In contrast, although the host also mounts a humoral immune response to the administered xenogenic insult, this is not believed to contribute to disease in this experimental model (13). To test the first hypothesis (i.e., the triggering of innate immune pathways via TLR may contribute to renal disease), we examined whether different innate triggers might have the potential to synergize with anti-GBM Abs to induce renal disease.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 Disclosures
 References
 
Reagents and nephrotoxic sera

LPS and poly(I:C) were purchased from Sigma-Aldrich, peptidoglycan was purchased from Fluka, and flagellin was purchased from Austral Biologicals. CpG oligonucleotide (TCCATGACGTTCCTGACGTT) was purchased from Integrated DNA Technologies. GBM-reactive nephrotoxic serum of rabbit origin was generated by Lampire Biological Laboratories. Essentially, renal cortices of C57BL/6 (B6) kidneys were minced and then pressed through a series of sieves of decreasing pore size (250-, 150-, and 75-µm mesh). The glomeruli were collected on the finest sieve, washed with cold PBS, and sonicated for 7 min. The glomerular sonicates were then used to immunize rabbits (2 mg/injection per rabbit, three injections administered 21 days apart). Sera obtained from these rabbits 50 days after the primary immunization stained the glomeruli and the GBM strongly, but not the tubules, as determined by immunofluorescence, and is referred to as "nephrotoxic" or "anti-GBM sera" (11, 12). Preimmune rabbit serum was used as a negative control. For some studies, the anti-GBM serum was further purified using protein G columns (Pierce) and papain-digested to generate Fab by Lampire Laboratories. All Ab preparations were quantified using a Coomassie Plus protein assay kit (Pierce) and confirmed to be free of endotoxin using the LAL QCL-1000 kit from BioWhittaker.

Mice and NSN

C57BL/6 (B6), B6.FcR–/–, B6.IL-1R–/–, and B6.TNF-R–/– mice were purchased from The Jackson Laboratory or Taconic. B6.FcR–/– mice are B6 mice deficient for the {gamma}-chain, and hence were negative for Fc{gamma}RI and Fc{gamma}RIII (catalog no. 000583; Taconic Farms). B6.TNF-R–– mice lacked both p55 and p75 (catalog no. 003243; The Jackson Laboratory). B6.IRAK-1–/– (B6.IRAK–/–) mice have been described previously (14). All mice were maintained in an specific pathogen-free colony. Females, aged 2–3 mo, were used for these studies unless otherwise stated. Any observed gender differences were also noted. Innate immune nephritis was induced using a combination of an innate trigger (administered i.p.) and anti-GBM sera (administered i.v.) at various doses as indicated. In the most commonly used protocol, 240 µg of anti-GBM sera (i.v.) and 50 µg of LPS (i.p.) were administered simultaneously. After this challenge, the mice were monitored for evidence of renal disease over a 3-wk period. Twenty-four-hour urine samples were collected from all mice on days 0, 3, 6, 10, 15, and 22 using metabolic cages, with free access to drinking water. Urinary protein concentration was determined using the Coomassie Plus protein assay kit (Pierce) and confirmed by measuring albuminuria using a commercially available kit (Bethyl Laboratories). Blood was collected on days 0, 3, 6, 15, and 22, for measuring blood urea nitrogen (BUN) using a urea nitrogen kit (Sigma-Aldrich). The mice were sacrificed on day 22, and the kidneys were processed for light microscopy as described below.

Histopathology and immunohistochemistry

Three-micrometer sections of formalin-fixed, paraffin-embedded kidney tissues were cut and stained with H&E and periodic acid-Schiff. These sections were examined in a blinded fashion for any evidence of pathology in the glomeruli, tubules, or interstitial areas, as described before (11, 12). The glomeruli were screened for evidence of hypertrophy, proliferative changes, crescent formation, hyaline deposits, fibrosis/sclerosis, and basement membrane thickening. The severity of GN was graded on a 0–4 scale: 0, normal; 1, mild increase in mesangial cellularity and matrix; 2, moderate increase in mesangial cellularity and matrix, with thickening of the GBM; 3, focal endocapillary hypercellularity with obliteration of capillary lumina and a substantial increase in the thickness and irregularity of the GBM; 4, diffuse endocapillary hypercellularity, segmental necrosis, crescents and hyalinized end-stage glomeruli. Likewise, the severity of tubulointerstitial nephritis was graded on a 0–3 scale, based on the extent of tubular atrophy, inflammatory infiltrates, and interstitial fibrosis, as detailed previously (11, 12). The presence of T cells, macrophages, and neutrophils in the target tissue was assessed (by two blinded investigators) after immunohistochemical staining with Abs to CD3, F4/80, or Ly6C, respectively (BD Pharmingen), using a standardized streptavidin-biotin-peroxidase method (11). The degree of infiltration was expressed either as the number of infiltrating cells per 100 glomeruli or the percentage of the interstitial region (divided into 6.25-mm2 grids) bearing stained cells.

Cells and in vitro assays

Primary mesangial cells were derived from 2-mo-old B6 mice, as described previously (15). Bone marrow-derived macrophages were cultured from B6 mice as described elsewhere (16). J774 is a murine macrophage cell line, obtained as a gift from Dr. J. Forman (University of Texas Southwestern Medical Center, Dallas, TX). Both cell types were stimulated with LPS (20 µg/ml) and heat-aggregated (56°C, 30 min) IgG (heat-aggregated IgG (haIgG)), nonimmune rabbit IgG or F(ab)2 (Jackson ImmunoResearch Laboratories) for various time periods. Mediator levels were quantified by real-time PCR as described below or by using commercial ELISA kits (R&D Systems).

Real-time RT-PCR

Total RNA was isolated from the renal cortex or glomerular cells using the RNeasy mini kit (Qiagen) and quantitated spectrophotometrically. Real-time PCR was performed using GeneAmp 5600 (PerkinElmer) using the following primers: GAPDH, 5'-AAC GAC CCC TTC ATT GAC and 3'-TCC ACG ACA TAC TCA GCA C; TNF-{alpha}, 5'-ATG AGC ACA GAA AGC ATG ATC and 3'-TAG AGG CTT GTC ACT CGA ATT; IL-1{alpha}, 5'-GTT CCT GAC TTG TTT GAA and 3'-GGT GAA GTT GGA CAT; IL-1{beta}, 5'-TGA TGA GAA TGA CCT GTT CT and 3'-CTT CTT CAA AGA TGA AGG A; IL-6, 5'-CAC AAA GCC AGA GTC CTT CAG AGA and 3'-CTA GGT TTG CCG AGT AGA TCT; MCP-1, 5'-CCA AGA AGG AAT GGG TCC AGA CAT and 3'-GAA GAC CTT AGG GCA GAT GCA GTT; and IRF-1, 5'-CAT TCA CAC AGG CCG ATA CAA AGC and 3'-CAA CGG AAG TTT GCC TTC CAT GTC.

For each pair of primers, PCR was performed in real time over a range of cycles, and the relationship between the quantity of RNA substrate and the final PCR product was defined. For both the test message and the GAPDH control, the CT was determined, where CT refers to the number of PCR cycles required to reach threshold product intensity. The CT of each test message was first normalized using the CT for GAPDH, assayed in the same sample. The fold change was next calculated using the relative CT method as follows: fold change = 2(normalized CT in resting sample – normalized CT in stimulated sample).

Statistics

For intergroup comparisons, the data were first tested for normality. Where normality tests passed, Student’s t test was applied. Otherwise, a nonparametric Mann-Whitney rank sum test was used. Statistical analyses were performed using SigmaStat (Jandel). All results are expressed as mean ± SEM.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 Disclosures
 References
 
The first innate trigger that was tested was LPS. As depicted in Fig. 1, the coadministration of LPS and anti-GBM sera, but not either alone, resulted in significant proteinuria and elevated BUN in a reproducible fashion in four independent experiments. Interestingly, there was a gender bias in this phenotype, with the females exhibiting significantly higher proteinuria and azotemia, compared with the males (Fig. 1, C and D). In all experiments, disease reached near-maximal levels on day 15, with a variable extent of deterioration over the ensuing week (Fig. 1, A–D). Hence, the degree of proteinuria and BUN was more severe on day 22 (relative to day 15) in 42 and 58% of the mice, respectively. The extent of disease was dose dependent (Fig. 1, E and F). Thus, maximal disease was elicited using 50 µg of LPS and 240 µg of anti-GBM Abs, and this regimen was therefore used for the rest of the study.



View larger version (26K):
[in this window]
[in a new window]
  		FIGURE 1. Concomitant administration of LPS and anti-glomerular Abs triggers proteinuria and azotemia. A and B, Two- to 3-mo-old female B6 mice were challenged with either 50 µg of LPS i.p. alone or 240 µg of anti-glomerular Abs i.v. or both (n = 4–5 each) and monitored for 24-h proteinuria (A) and BUN (B). C and D, Proteinuria and BUN levels in female B6 mice (the same mice as shown in A and B) and age-matched male B6 mice (n = 5), in response to the concomitant administration of anti-glomerular Abs (240 µg, i.v.) and LPS (50 µg, i.p.). In a second experiment, B6 mice injected with anti-GBM plus LPS exhibited 3.28 ± 0.73 mg/24 h urinary protein and 64.5 ± 16.2 mg/dl BUN, both being significantly higher than the control groups (n = 6 each; p < 0.001). In a third confirmatory experiment, B6 mice injected with anti-GBM plus LPS exhibited 5.13 ± 1.24 mg/24 h urinary protein and 90.8 ± 15.9 mg/dl BUN, both being significantly higher than the control groups (n = 6 each; p < 0.001). In a fourth confirmatory study, B6 mice injected with anti-GBM plus LPS exhibited 3.62 ± 0.88 mg/24 h urinary protein and 42.2 ± 8.5 mg/dl BUN, both being significantly higher than the control groups (n = 6 each; p < 0.001). These additional studies represent the control groups shown in Figs. 5 and 6. Lower quantities of LPS or the anti-glomerular Abs were not sufficient to induce proteinuria (E) or elevated BUN (F) in B6 mice (females, aged 2–3 mo, n = 3–5/group). In all study groups, no signs of significant proteinuria or azotemia were noted on days 3 or 6. Each dot represents data obtained from a single mouse. In all plots, the p values shown pertain to comparisons of female B6 mice receiving 50 µg of LPS plus 240 µg of anti-GBM Abs, compared with mice in the other study groups (*, p < 0.05; **, p < 0.01; ***, p < 0.001). The data shown are representative of two independent experiments using similar numbers of mice.

 
The increased proteinuria is likely to be of glomerular origin, because marked albuminuria was also noted (Fig. 2A). The glomeruli of mice receiving both of the insults exhibited a significant degree of cellular proliferation (Fig. 2B) and crescent formation (C). Interestingly, although the anti-GBM Abs targeted only the glomeruli (as determined by immunofluorescence; data not shown; Ref.11), these mice also exhibited severe tubulointerstitial disease (Fig. 2D). In contrast, mice that received LPS or anti-GBM serum alone did not exhibit any glomerular or interstitial inflammation (Fig. 2, B–G). The mice that received both insults also exhibited the highest levels of T cell, macrophage, and neutrophil infiltrates, as illustrated in Fig. 3. Whereas the T cells and macrophages were located both within the glomeruli as well as in the interstitial space, the neutrophils were predominantly interstitial in location.



View larger version (67K):
[in this window]
[in a new window]
  		FIGURE 2. Concomitant administration of LPS and anti-glomerular Abs triggers glomerular and tubulointerstitial disease. The same mice as those studied in Fig. 1, A and B (n = 5/group), were examined for urinary albumin excretion (A), GN scores (B), extent of crescent formation (C; expressed as a percentage of 100 glomeruli examined for crescents), and tubulointerstitial disease scores (D) on day 22, except for the fact that pathology information could not be obtained from one of the mice injected with anti-GBM plus LPS due to death on day 22. Representational details are as defined in Fig. 1. Shown also are representative periodic acid-Schiff-stained kidney sections from mice challenged with anti-GBM Abs alone (E), LPS alone (F), or both (G). Shown magnification, x400. In an additional confirmatory study, B6 mice injected with anti-GBM Abs plus LPS exhibited an average (±SEM) GN score of 2.65 ± 0.37, tubulointerstitial nephritis score of 1.1 ± 0.43, and percentage of crescents of 4.8 ± 2.8%, all being significantly higher than the values in the control groups (n = 10; p < 0.001).

 


View larger version (132K):
[in this window]
[in a new window]
  		FIGURE 3. T cell, macrophage, and neutrophil infiltrates in mice challenged with LPS plus anti-GBM. Depicted are representative immunohistochemistry staining for T cells (using anti-CD3; A–C), macrophages (using anti-F4/80; D–F), and neutrophils (using anti-Ly6C; H–I) in the kidneys of mice injected with anti-GBM Abs alone (A, D, and G), LPS alone (B, E, and H), or both agents (C, F, and I). Shown magnification, x400. The glomeruli from mice challenged with LPS plus anti-GBM Abs exhibited significantly more macrophages (34.4 ± 2.3/100 glomeruli, compared with 0 in both control groups; n = 5/group; p < 1 x 10 –2), and T cells (18.4 ± 1.7/100 glomeruli, compared with 0 in both control groups; n = 5/group; p < 1 x 10–9). Likewise, the renal interstitial space from these same mice also exhibited significantly more macrophages (11 vs 0% in the control groups, n = 5 each, p < 1 x 10–7), T cells (6 vs 0% in the control groups, n = 5 each, p < 1 x 10–6), and neutrophils (2–5% of the interstitium, compared with 0% in the control groups; n = 5/group; p < 10–6). The arrows indicate representative stained cells. The Abs used did not stain the control kidneys (A, B, D, E, G, and H), and the isotype control Ab did not stain any of the sections (data not shown).

 
Next, we asked whether triggers of other TLR might also be effective in inducing nephritis when coadministered with anti-GBM sera. Different TLR triggers were tested at various doses. Peptidoglycan (which triggers via TLR2), poly(I:C) (which triggers via TLR3), and flagellin (which triggers via TLR5) all elicited innate immune nephritis, when coadministered with anti-GBM sera, as evidenced by the increased proteinuria and BUN (Fig. 4). Because the initial doses used for these three TLR triggers showed efficacy, additional doses of these three ligands were not studied. In contrast, CpG oligonucleotide (which triggers via TLR9) was not as effective in inducing innate immune nephritis. This negative result was not due to insufficient dosage, because higher dosages did not alter the outcome (Fig. 4). Hence, triggers delivered via TLR2, TLR3, TLR4, and TLR5 all appeared to have the capacity to facilitate innate immune nephritis in the presence of an anti-GBM immune insult.



View larger version (26K):
[in this window]
[in a new window]
  		FIGURE 4. Different TLR triggers facilitate anti-GBM induced nephritis. Two- to 3-mo-old female B6 mice were challenged with anti-glomerular Abs (240 µg, i.v.) together with i.p. injections of different TLR ligands, and monitored for evidence of proteinuria (A and B) and azotemia (C and D), on day 15 (A and C) and day 22 (B and D). The following doses were used: 500 µg (peptidoglycan (PGN)), 150 µg (poly(I:C) (pI:pC)), 10 µg (flagellin (F’lin)), 50 µg (CpG1 oligonucleotide), and a higher dose of the latter (500 µg; CpG2). Each dot represents data obtained from a single mouse. In all plots, the p values shown pertain to comparisons of mice receiving anti-GBM Abs alone, compared with mice in the other study groups (*, p < 0.05; **, p < 0.01; ***, p < 0.001). The data shown are representative of two independent experiments for each TLR ligand.

 
Given that several TLRs seem to be capable of promoting innate immune nephritis, it appeared likely that the TLR signaling pathway had to be intact in order for these ligands to be effective in triggering nephritis. TLRs signal via MyD88-dependent and MyD88-independent pathways, as reviewed in Refs.17, 18, 19 . IL-1R-associated kinase (IRAK)1 and IRAK4 constitute two early adaptor molecules in this pathway (14, 16, 20, 21). To ascertain whether the TLR signaling pathway was indeed essential for innate immune nephritis to ensue, B6.IRAK1–/– mice were procured and tested for disease susceptibility. As expected, the coadministration of an innate trigger and an anti-GBM insult resulted in minimal disease in B6.IRAK1–/– mice (Fig. 5, A and B). Collectively, these studies underscore the importance of innate signals transmitted via TLR- and IRAK-mediated signaling pathway in mediating nephritis in this model.



View larger version (26K):
[in this window]
[in a new window]
  		FIGURE 5. Nephritis facilitated by innate triggers is contingent on IRAK1-mediated signaling and Fc:FcR-dependent interactions. Two- to 3-mo-old B6 mice that were deficient or sufficient for IRAK1 (n = 11 females each) were challenged with 50 µg of LPS i.p. and 240 µg of anti-glomerular Abs i.v., and monitored for proteinuria (A) and azotemia (B). Two- to 3-mo-old B6 mice that were deficient or sufficient for Fc{gamma}RI and Fc{gamma}RIII (n = 11 females each) were also challenged with 50 µg of LPS i.p. and 240 µg of anti-glomerular Abs i.v. and monitored for proteinuria (C) and azotemia (D). The experiments shown in A–D were drawn from two independent studies, each involving five to six B6 mice and five to six knockout mice. In addition, three to five female B6 mice were challenged with LPS (50 µg, i.p.) plus Fab of anti-glomerular Abs (240 µg, i.v.), or with LPS (50 µg, i.v.) plus nonimmune rabbit sera (240 µg, i.v.), and monitored for proteinuria and azotemia (C and D). The p values shown pertain to comparisons of wild-type B6 mice receiving 50 µg of LPS plus 240 µg anti-GBM Abs, against mice in the other study groups (*, p < 0.05; **, p < 0.01; ***, p < 0.001).

 
Next, we investigated how the anti-GBM Ab component might be contributing to disease. First, the glomerular specificity was absolutely required, because substituting the anti-GBM serum with nonimmune rabbit Ig failed to elicit disease (Fig. 5, C and D). Next, to ascertain whether these Abs were functioning by engaging FcR, we adopted two complementary approaches. First, we generated Fab from protein G-purified anti-GBM Ab and tested their pathogenic potential when coadministered with LPS. Second, we challenged B6.FcR–/– mice with LPS and intact anti-GBM Ab. The findings depicted in Fig. 5, C and D, indicated that the contribution of the anti-GBM Ab to innate immune nephritis was absolutely dependent on Fc/FcR interactions. These observations are consistent with the notion that perhaps the key contribution of the glomerular antigenic specificity of the anti-GBM Abs may simply be to direct the nephrophilic Abs to the GBM; subsequent pathology may largely be Fc mediated.

Because neither LPS nor anti-GBM Ab alone appeared to be sufficient for disease, the binary insult must be particularly effective in activating potentially pathogenic molecular cascades in a synergistic fashion. We therefore examined whether the binary insult had the potential to elicit the rapid transcription of various disease mediators immediately after the insult, before clinical disease became apparent. Indeed, the coadministration of LPS and anti-GBM Abs was far more potent in inducing the rapid expression (i.e., within 2 h) of several cytokines and chemokines (including IL-1, IL-6, TNF-{alpha}, and MCP-1) as well as early transcription factors (such as IRF-1) within the renal cortex, compared with the administration of either trigger alone (Fig. 6, A and B). Although similar patterns were observed when isolated glomeruli were examined, the message levels in the mice subjected to the binary insult were not statistically significant from the levels noted in mice receiving LPS alone (Fig. 6C). Of pertinence, several of these molecules have previously been demonstrated by others to be important in immune nephritis (22, 23, 24, 25, 26, 27, 28, 29, 30). To assess the relevance of these proinflammatory cytokines in mediating disease in this model, mice that were genetically deficient in IL-1R or TNF-R were procured for study. As illustrated in Fig. 6, D and E, B6.IL-1R–/– and B6.TNF-R–/– mice were relatively resistant to innate immune nephritis, compared with wild-type controls.



View larger version (33K):
[in this window]
[in a new window]
  		FIGURE 6. Anti-glomerular Abs and innate triggers synergize to up-regulate pathogenic mediators rapidly. Two- to 3-mo-old B6 females were challenged with 50 µg of LPS i.p. alone, 240 µg of anti-glomerular Abs i.v. alone, or both (n = 3/experiment). Two hours postchallenge, their kidneys were removed. RNA prepared from the renal cortices was assayed for GAPDH, IL-1{alpha}, IL-{beta}, IL-6, TNF-{alpha}, MCP-1, and IRF-1 expression by real-time RT-PCR. Each dot represents data from a single mouse cortex. The indicated Student’s t test p values pertain to comparisons of expression levels following the LPS plus Ab binary insult vs the control groups. A and B, The results of two independent studies, with n = 3 in all experiments. Similar studies were also conducted with glomeruli isolated from an additional panel of B6 mice (n = 3–5/group), 2 h postchallenge (C). Next, 2- to 3-mo-old B6 mice that were deficient for IL-1R or TNF-R (n = 11 females each) were challenged with 50 µg of LPS i.p. and 240 µg of anti-glomerular Abs i.v. and monitored for proteinuria (D) and azotemia (E). D and E, The data shown were pooled from two independent studies with similar findings. Representational details are as defined in Fig. 1.

 
The above findings suggested that the costimulation of the TLR- and FcR-mediated signaling pathways may be particularly powerful in initiating the pathogenic cascade of events leading to nephritis. An important question relates to the key cell types that may serve to sense both the triggers, integrate the respective signals, and initiate the release of pathogenic mediators. Because the synergistic up-regulation of disease mediators occurs in the renal cortex within 2 h postinsult (Fig. 6), systemic leukocytes are unlikely to be important at this early phase, because these cells are distinctly absent at this early time point (data not shown). In contrast, in an ongoing disease, these triggers could potentially engage receptors on infiltrating leukocytes as well. Hence, we tested the ability of these two triggers to costimulate mediator transcription and release both in intrinsic glomerular cells (referred to as "glomerulocytes" in this paper) as well as in leukocytes. As illustrated in Fig. 7, costimulating TLR (by using LPS) and FcR (by using haIgG) together had the potential to augment cytokine production synergistically, both in mesangial cells and in macrophages, in a rapid fashion.



View larger version (27K):
[in this window]
[in a new window]
  		FIGURE 7. Both intrinsic glomerulocytes and infiltrating leukocytes can integrate the binary input from LPS and Abs. B6-derived primary mesangial cells (A–D; Ref.15 ) as well as B6 bone marrow-derived macrophages (BM-Mac; E–H) were triggered with LPS and/or haIgG. RNA harvested 2 h poststimulation was assayed for MCP-1, IL-6, and TNF-{alpha} by real-time RT-PCR (A–C and E–G). In addition, 24-h culture supernatants were also examined by ELISA for cytokine secretion (D and H). The indicated Student’s t test p values pertain to the comparison of cytokine levels following the binary stimulation vs the levels in the control groups combined. The data shown are representative of two to three independent experiments of each type.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
Disclosures
 References
 
Unlike the passive administration of anti-GBM Abs, the active delivery of anti-GBM sera following adjuvant-mediated presensitization has been described to precipitate severe renal disease in the traditional NSN model (1). CFA has been reported to trigger TLR2 and TLR4 (31, 32). Hence, it is reasonable to hypothesize that costimulation via either of these TLRs may be necessary for maximal anti-GBM-induced renal disease in the traditional NSN model. Indeed, the present work revealed that stimulation of TLR4 by LPS, coupled with anti-GBM Ab administration, was sufficient to engender profound renal disease. These findings resonate well with previous findings in the rat model, where LPS, IL-1, and TNF-{alpha} have also been shown to be important for experimental nephritis (29, 33).

Among the other innate stimuli tested, it is interesting to note that TLR2, TLR3, and TLR5 stimulation also triggered renal disease. Although IRAK-dependent costimulation was necessary for innate immune nephritis to ensue, costimulation via TLR9 failed to induce nephritis. This was not due to insufficient innate stimulation, because increasing the dosage of the respective triggers up to 5-fold still failed to elicit disease. In contrast, the observed differences may relate to differential expression of the various TLR in the target tissue. Presently, we do not have a clear understanding of the full complement of TLR that are expressed on the different glomerular cell types. The observed hyperexpression of (and the apparent absolute requirement for) proinflammatory cytokines (e.g., IL-1 and TNF-{alpha}) in our current study is consistent with the demonstrated importance of these molecules in related experimental models of nephritis, as well as spontaneous lupus nephritis (26, 29, 30, 33). These studies also raise hope that at least certain varieties of nephritis may potentially be amenable for therapy by modulating the expression of key proinflammatory cytokines.

In contrast to the innate stimuli, the precise mode of action of the anti-GBM insult may be more complex. On the one hand, the glomerular Ag specificity of this insult appears to be indispensable for pathogenesis. This target specificity may potentially contribute in two ways. First, it is clearly required for targeting the injury to the glomeruli. As a consequence of this specificity, these mice are relatively free of inflammatory damage elsewhere. Importantly, mice challenged with LPS and total rabbit Ig (which had no glomerular specificity) did not succumb to nephritis. Second, it is also conceivable that, once the anti-GBM Abs targeted the glomeruli, they may potentially activate intrinsic glomerulocytes directly by cross-linking yet-to-be-defined surface Ags. The present studies do not directly examine whether the nephrotoxic insult might also be contributing in the latter manner upon binding to selected target Ags on resident glomerular cells.

In contrast, the Fc portion of the anti-GBM Abs may be more important in mediating end-organ disease once the anti-GBM Abs target the glomeruli. This is supported by the in vivo studies illustrating that Fab preparations of anti-GBM Abs (i.e., in the absence of the Fc portion) were rather impotent and by the studies using FcR–/– mice. These findings are consistent with the demonstrated importance of Fc:FcR-based interactions in previous reports of experimental and spontaneous nephritis (34, 35, 36, 37). Indeed, FcR-targeted therapies have been proposed for modulating immune nephritis (38, 39). Anti-GBM Abs planted on the GBM may have the capacity to engage FcR on both the intrinsic glomerulocytes and infiltrating leukocytes. Whereas the former may be absolutely critical in initiating the disease, the latter may play an important role in perpetuating pathology, particularly in the later phases of the disease.

The precise glomerular cell type that may be important for disease initiation remains to be elucidated, although mesangial cells may clearly play a role, based on the present findings. In this context, activating FcRs (i.e., FcRI and FcRIII) have been documented to be expressed on intrinsic murine and human glomerulocytes, albeit at very low levels (37, 40). Given the documented cytokine production profiles of podocytes and endothelial cells, these additional cell types may also play an important role in this context (41, 42, 43). In contrast, there is also evidence that FcR on infiltrating leukocytes may be the more important determinant in driving nephritis (44). Finally, the Fc portion of the anti-GBM sera may potentially be contributing to disease in additional ways; in particular, complement-mediated processes may also be involved in experimental nephritis, as discussed elsewhere (45, 46).

Finally, it is important to consider the physiological and clinical relevance of the present findings. Of the two insults delivered, the clinical relevance of the immune trigger (i.e., the anti-glomerular Ab) is easier to appreciate. In contrast, murine and human lupus nephritis that ensue spontaneously are almost always devoid of LPS (or any of the other TLR ligands used in this study) unless the subject is in overt sepsis. However, it has become clear that several endogenous ligands, including some that are expressed at high levels within the glomerular milieu, such as fibronectin and heat-shock proteins, can also trigger TLRs (47, 48, 49). Hence, it is tantalizing to speculate that at least some varieties of spontaneous nephritis may also be the end result of a two-pronged insult, composed of anti-glomerular Abs, and a yet-to-be-defined endogenous TLR ligand. An important future goal would be to identify endogenous ligands in the glomerular milieu that may be best positioned to engage TLR on resident as well as infiltrating cells. Finally, because infections have clearly been documented to precipitate lupus flares, the model presented in this work may also be an excellent tool for analyzing how sepsis might aggravate anti-glomerular Ab-induced nephritis.


   Disclosures
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
References
 
The authors have no financial conflict of interest.


   Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by National Institutes of Health Grant R01 AR 50812 and by the Arthritis Foundation. Back

2 Address correspondence and reprint requests to Dr. Chandra Mohan, Department of Internal Medicine/Rheumatology, University of Texas Southwestern Medical Center, Mail Code 8884, Y8.204, 5323 Harry Hines Boulevard, Dallas, TX 75390-8884. E-mail address: Chandra.mohan{at}utsouthwestern.edu Back

3 Abbreviations used in this paper: NSN, nephrotoxic serum nephritis; GN, glomerulonephritis; GBM, glomerular basement membrane; BUN, blood urea nitrogen; IRAK, IL-1R-associated kinase; haIgG, heat-aggregated IgG. Back

Received for publication January 19, 2005. Accepted for publication September 15, 2005.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Masugi, M.. 1934. Glomerulonephritis durch das spezifische antinierenserum: ein Beitrag zur Pathogenese der diffusen Glomerulonephritis. Beitr. Pathol. Anat. Allg. Pathol. 92: 429
  2. Le Hir, M., C. Haas, M. Marino, B. Ryffel. 1998. Prevention of crescentic glomerulonephritis induced by anti-glomerular membrane antibody in tumor necrosis factor-deficient mice. Lab. Invest. 78: 1625-1631. [Medline]
  3. Suzuki, Y., I. Shirato, K. Okumura, J. V. Ravetch, T. Takai, Y. Tomino, C. Ra. 1998. Distinct contribution of Fc receptors and angiotensin II-dependent pathways in anti-GBM glomerulonephritis. Kidney Int. 54: 1166-1174. [Medline]
  4. Tesch, G. H., A. Schwarting, K. Kinoshita, H. Y. Lan, B. J. Rollins, V. R. Kelley. 1999. Monocyte chemoattractant protein-1 promotes macrophage-mediated tubular injury, but not glomerular injury, in nephrotoxic serum nephritis. J. Clin. Invest. 103: 73-80. [Medline]
  5. Topham, P. S., V. Csizmadia, D. Soler, D. Hines, C. J. Gerard, D. J. Salant, W. W. Hancock. 1999. Lack of chemokine receptor CCR1 enhances Th1 responses and glomerular injury during nephrotoxic nephritis. J. Clin. Invest. 104: 1549-1557. [Medline]
  6. Janssen, U., T. Ostendorf, S. Gaertner, F. Eitner, H. J. Hedrich, K. J. Assmann, J. Floege. 1998. Improved survival and amelioration of nephrotoxic nephritis in intercellular adhesion molecule-1 knockout mice. J. Am. Soc. Nephrol. 9: 1805-1814. [Abstract]
  7. Sheerin, N. S., T. Springall, M. C. Carroll, B. Hartley, S. H. Sacks. 1997. Protection against anti-glomerular basement membrane-mediated nephritis in C3- and C4-deficient mice. Clin. Exp. Immunol. 110: 403-409. [Medline]
  8. Tang, T., A. Rosenkranz, K. M. Assmann, M. J. Goodman, J. C. Gutierrez-Ramos, M. C. Carroll, R. S. Cotran, T. N. Mayadas. 1997. A role for Mac-1 (CDIIb/CD18) in immune complex-stimulated neutrophil function in vivo: Mac-1 deficiency abrogates sustained Fc{gamma} receptor-dependent neutrophil adhesion and complement-dependent proteinuria in acute glomerulonephritis. J. Exp. Med. 186: 1853-1863. [Abstract/Free Full Text]
  9. Mayadas, T. N., D. L. Mendrick, H. R. Brady, T. Tang, A. Papayianni, K. J. Assmann, D. D. Wagner, R. O. Hynes, R. S. Cotran. 1996. Acute passive anti-glomerular basement membrane nephritis in P-selectin-deficient mice. Kidney Int. 49: 1342-1349. [Medline]
  10. Hébert, M. J., T. Takano, A. Papayianni, H. G. Rennke, A. Minto, D. J. Salant, M. C. Carroll, H. R. Brady. 1998. Acute nephrotoxic serum nephritis in complement knockout mice: relative roles of the classical and alternate pathways in neutrophil recruitment and proteinuria. Nephrol. Dial. Transplant. 13: 2799-2803. [Abstract/Free Full Text]
  11. Xie, C., X. J. Zhou, X. Liu, C. Mohan. 2003. Enhanced intrinsic susceptibility to renal disease in the lupus-facilitating NZW strain. Arthritis Rheum. 48: 1080-1092. [Medline]
  12. Xie, C., R. Ruchi Sharma, H. Wang, X. J. Zhou, C. Mohan. 2004. Strain distribution pattern of susceptibility to immune-mediated nephritis. J. Immunol. 172: 5047-5055. [Abstract/Free Full Text]
  13. Li, S., S. R. Holdsworth, P. G. Tipping. 1997. Antibody-independent crescentic glomerulonephritis in µ chain-deficient mice. Kidney Int. 51: 672-678. [Medline]
  14. Thomas, J. A., J. L. Allen, M. Tsen, T. Dubnicoff, J. Danao, X. C. Liao, S. A. Wasserman. 1999. Impaired cytokine signaling in mice lacking the IL-1 receptor-associated kinase. J. Immunol. 163: 978-984. [Abstract/Free Full Text]
  15. Fu, Y., C. Xie, M. Yan, Q. Li, C. Lu, C. Mohan. 2004. LPS-induced mesangial transcriptomics: evaluating the role of interferon regulatory factor-1. Kidney Int. 67: 1350-1361.
  16. Zhu, J., X. Liu, C. Xie, M. Yan, Y. Yu, E. S. Sobel, E. K. Wakeland, C. Mohan. 2005. Genetic dissection of lupus: T cell hyperactivity as a consequence of hyperstimulatory antigen-presenting cells. J. Clin. Invest. 115: 1869-1878. [Medline]
  17. Akira, S., K. Takeda. 2004. Toll-like receptor signaling. Nat. Rev. Immunol. 4: 499-511. [Medline]
  18. O’Neill, L. A.. 2003. The role of MyD88-like adapters in Toll-like receptor signal transduction. Biochem. Soc. Trans. 3: 643-647.
  19. Takeuchi, O., S. Akira. 2002. MyD88 as a bottleneck in Toll/IL-1 signaling. Curr. Top. Microbiol. Immunol. 270: 155-167. [Medline]
  20. Janssens, S., R. Beyaert. 2003. Functional diversity and regulation of different interleukin-1 receptor-associated kinase family members. Mol. Cell 11: 293-302. [Medline]
  21. Suzuki, N., S. Suzuki, G. S. Duncan, D. G. Millar, T. Wada, C. Mirtsos, H. Takada, A. Wakeham, A. Itie, S. Li, et al 2002. Severe impairment of interleukin-1 and Toll-like receptor signaling in mice lacking IL-1-R-associated kinase 4. Nature 416: 750-756. [Medline]
  22. Lloyd, C. M., A. W. Minto, M. E. Dorf, A. Proudfoot, T. N. Wells, D. J. Salant, J. C. Gutierrez-Ramos. 1997. RANTES and MCP-1 play an important role in the inflammatory phase of crescentic nephritis, but only MCP-1 is involved in crescent formation and interstitial fibrosis. J. Exp. Med. 185: 1371-1380. [Abstract/Free Full Text]
  23. Wada, T., H. Yokoyama, K. Furuichi, K. I. Kobayashi, K. Harada, M. Naruto, S. B. Su, M. Akiyama, N. Mukaida, K. Matsushima. 1996. Intervention of crescentic glomerulonephritis by antibodies to monocyte chemotactic and activating factor/MCP-1. FASEB J. 10: 1418-1425. [Abstract]
  24. Garcia, G. E., Y. Xia, J. Harrison, C. B. Wilson, R. J. Johnson, K. B. Bacon, L. Feng. 2003. Mononuclear cell-infiltrate inhibition by blocking macrophage-derived chemokine results in attenuation of developing crescentic glomerulonephritis. Am. J. Pathol. 162: 1061-1073. [Abstract/Free Full Text]
  25. Karkar, A. M., F. W. Tam, A. Steinkasserer, R. Kurrle, K. Langner, B. J. Scallon, A. Meager, A. J. Rees. 1995. Modulation of antibody-mediated glomerular injury in vivo by IL-1R{alpha}, soluble IL-1 receptor, and soluble TNF receptor. Kidney Int. 48: 1738-1746. [Medline]
  26. Kim, Y. S., S. Zheng, S. H. Yang, H. L. Kim, C. S. Lim, D. W. Chae, R. Chun, J. S. Lee, S. Kim. 2001. Differential expression of various cytokine and chemokine genes between proliferative and nonproliferative glomerulonephritides. Clin. Nephrol. 56: 199-206. [Medline]
  27. Perez de Lema, G., H. Maier, E. Nieto, V. Vielhauer, B. Luckow, F. Mampaso, D. Schlondorff. 2001. Chemokine expression precedes inflammatory cell infiltration and chemokine receptor and cytokine expression during the initiation of murine lupus nephritis. J. Am. Soc. Nephrol. 12: 1369-1382. [Abstract/Free Full Text]
  28. Anders, H. J., V. Vielhauer, M. Kretzler, C. D. Cohen, S. Segerer, B. Luckow, L. Weller, H. J. Grone, D. Schlondorff. 2001. Chemokine and chemokine receptor expression during initiation and resolution of immune complex glomerulonephritis. J. Am. Soc. Nephrol. 12: 919-931. [Abstract/Free Full Text]
  29. Savige, J. A., D. J. Evans, A. J. Rees. 1988. Kinetics of glomerular neutrophil influx after lipopolysaccharide in antibody-mediated injury. Clin. Exp. Immunol. 73: 134-138. [Medline]
  30. Lemay, S., C. Mao, A. K. Singh. 1996. Cytokine gene expression in the MRL/lpr model of lupus nephritis. Kidney Int. 50: 85-93. [Medline]
  31. Lim, S. K.. 2003. Freund adjuvant induces TLR2 but not TLR4 expression in the liver of mice. Int. Immunopharmacol. 3: 115-118. [Medline]
  32. Tsuji, S., M. Matsumoto, O. Takeuchi, S. Akira, I. Azuma, A. Hayashi, K. Toyoshima, T. Seya. 2000. Maturation of human dendritic cells by cell wall skeleton of Mycobacterium bovis bacillus Calmette-Guérin: involvement of Toll-like receptors. Infect. Immun. 68: 6883-6890. [Abstract/Free Full Text]
  33. Karkar, A. M., F. W. Tam, A. Steinkasserer, R. Kurrle, K. Langner, B. J. Scallon, A. Meager, A. J. Rees. 1995. Modulation of antibody-mediated glomerular injury in vivo by IL-1R{alpha}, soluble IL-1 receptor, and soluble TNF receptor. Kidney Int. 48: 1738-1746. [Medline]
  34. Suzuki, Y., I. Shirato, K. Okumura, J. V. Ravetch, T. Takai, Y. Tomino, C. Ra. 1998. Distinct contribution of Fc receptors and angiotensin II-dependent pathways in anti-GBM glomerulonephritis. Kidney Int. 54: 1166-1174. [Medline]
  35. Ravetch, J. V., R. A. Clynes. 1998. Divergent roles for Fc receptors and complement in vivo. Annu. Rev. Immunol. 16: 421-432. [Medline]
  36. Clynes, R., C. Dumitru, J. V. Ravetch. 1998. Uncoupling of immune complex formation and kidney damage in autoimmune glomerulonephritis. Science 279: 1052-1054. [Abstract/Free Full Text]
  37. Radeke, H. H., I. Janssen-Graalfs, E. N. Sowa, N. Chouchakova, J. Skokowa, F. Loscher, R. E. Schmidt, P. Heeringa, J. E. Gessner. 2002. Opposite regulation of type II and III receptors for IgG in mouse glomerular mesangial cells and in the induction of antiglomerular basement membrane nephritis. J. Biol. Chem. 277: 27535-27544. [Abstract/Free Full Text]
  38. Gomez-Guerrero, C., N. Duque, M. T. Casado, C. Pastor, J. Blanco, F. Mampaso, F. Vivanco, J. Egido. 2000. Administration of IgG Fc prevents glomerular injury in experimental immune complex nephritis. J. Immunol. 164: 2092-2101. [Abstract/Free Full Text]
  39. Watanabe, H., D. Sherris, G. S. Gilkeson. 1998. Soluble CD16 in the treatment of murine lupus nephritis. Clin. Immunol. Immunopathol. 88: 91-95. [Medline]
  40. Uciechowski, P., M. Schwarz, J. E. Gessner, R. E. Schmidt, K. Resch, H. H. Radeke. 1998. IFN-{gamma} induces the high-affinity Fc receptor I for IgG (CD64) on human glomerular mesangial cells. Eur. J. Immunol. 28: 2928-2935. [Medline]
  41. Niemir, Z. I., H. Stein, G. Dworacki, P. Mundel, N. Koehl, B. Koch, F. Autschbach, K. Andrassy, E. Ritz, R. Waldherr, H. F. Otto. 1997. Podocytes are the major source of IL-1-{alpha} and IL-1-{beta} in human glomerulonephritides. Kidney Int. 52: 393-403. [Medline]
  42. Mundel, P., S. J. Shankland. 2002. Podocyte biology and response to injury. J. Am. Soc. Nephrol. 13: 3005-3015. [Free Full Text]
  43. Savage, C. O.. 1994. The biology of the glomerulus: endothelial cells. Kidney Int. 45: 314-319. [Medline]
  44. Tarzi, R. M., K. A. Davies, M. G. Robson, L. Fossati-Jimack, T. Saito, M. J. Walport, H. T. Cook. 2002. Nephrotoxic nephritis is mediated by Fc{gamma} receptors on circulating leukocytes and not intrinsic renal cells. Kidney Int. 62: 2087-2096. [Medline]
  45. Quigg, R. J.. 2004. Complement and autoimmune glomerular diseases. Curr. Dir. Autoimmun. 7: 165-180. [Medline]
  46. Quigg, R. J.. 2003. Complement and the kidney. J. Immunol. 17: 3319-3324.
  47. Johnson, G. B., G. J. Brunn, J. L. Platt. 2003. Activation of mammalian Toll-like receptors by endogenous agonists. Crit. Rev. Immunol. 23: 15-44. [Medline]
  48. Vabulas, R. M., P. Ahmad-Nejad, S. Ghose, C. J. Kirschning, R. D. Issels, H. Wagner. 2002. HSP70 as endogenous stimulus of the Toll/IL-1 receptor signal pathway. J. Biol. Chem. 277: 15107-15112. [Abstract/Free Full Text]
  49. Beg, A. A.. 2002. Endogenous ligands of Toll-like receptors: implications for regulating inflammatory and immune responses. Trends Immunol. 23: 509-512. [Medline]



This article has been cited by other articles:


Home page
 J. Immunol.Home page
A.-M. Fairhurst, C. Xie, Y. Fu, A. Wang, C. Boudreaux, X. J. Zhou, R. Cibotti, A. Coyle, J. E. Connolly, E. K. Wakeland, et al.
Type I Interferons Produced by Resident Renal Cells May Promote End-Organ Disease in Autoantibody-Mediated Glomerulonephritis
J. Immunol., November 15, 2009; 183(10): 6831 - 6838.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Renal Physiol.Home page
D. Sharkey, D. S. Gardner, M. E. Symonds, and H. Budge
Maternal nutrient restriction during early fetal kidney development attenuates the renal innate inflammatory response in obese young adult offspring
Am J Physiol Renal Physiol, November 1, 2009; 297(5): F1199 - F1207.
[Abstract] [Full Text] [PDF]

Home page
 J. Am. Soc. Nephrol.Home page
H. J. Brown, H. R. Lock, T. G.A.M. Wolfs, W. A. Buurman, S. H. Sacks, and M. G. Robson
Toll-Like Receptor 4 Ligation on Intrinsic Renal Cells Contributes to the Induction of Antibody-Mediated Glomerulonephritis via CXCL1 and CXCL2
J. Am. Soc. Nephrol., June 1, 2007; 18(6): 1732 - 1739.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
W. Rodriguez, C. Mold, M. Kataranovski, J. A. Hutt, L. L. Marnell, J. S. Verbeek, and T. W. Du Clos
C-Reactive Protein-Mediated Suppression of Nephrotoxic Nephritis: Role of Macrophages, Complement, and Fc{gamma} Receptors
J. Immunol., January 1, 2007; 178(1): 530 - 538.
[Abstract] [Full Text] [PDF]

Home page
 J. Am. Soc. Nephrol.Home page
P. G. Tipping
Toll-Like Receptors: The Interface between Innate and Adaptive Immunity
J. Am. Soc. Nephrol., July 1, 2006; 17(7): 1769 - 1771.
[Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow A correction has been published
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fu, Y.
Right arrow Articles by Mohan, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fu, Y.
Right arrow Articles by Mohan, C.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Medline Plus Health Information
*Kidney Diseases

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS