The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Newberg, M. H.
Right arrow Articles by Letvin, N. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Newberg, M. H.
Right arrow Articles by Letvin, N. L.
The Journal of Immunology, 2006, 176: 319-328.
Copyright © 2006 by The American Association of Immunologists

Immunodomination in the Evolution of Dominant Epitope-Specific CD8+ T Lymphocyte Responses in Simian Immunodeficiency Virus-Infected Rhesus Monkeys1

Michael H. Newberg*, Kimberly J. McEvers*, Darci A. Gorgone*, Michelle A. Lifton*, Susanne H. C. Baumeister*, Ronald S. Veazey{dagger}, Jörn E. Schmitz* and Norman L. Letvin2,*

* Division of Viral Pathogenesis, Department of Medicine, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, MA 02215; and {dagger} Tulane National Primate Research Center, Covington, LA 70433


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Because the control of HIV-1 replication is largely dependent on CD8+ T lymphocyte responses specific for immunodominant viral epitopes, vaccine strategies that increase the breadth of dominant epitope-specific responses should contribute to containing HIV-1 spread. Developing strategies to elicit such broad immune responses will require an understanding of the mechanisms responsible for focusing CD8+ T lymphocyte recognition on a limited number of epitopes. To explore this biology, we identified cohorts of rhesus monkeys that expressed the MHC class I molecules Mamu-A*01, Mamu-A*02, or both, and assessed the evolution of their dominant epitope-specific CD8+ T lymphocyte responses (Gag p11C- and Tat TL8-specific in the Mamu-A*01+ and Nef p199RY-specific in the Mamu-A*02+ monkeys) following acute SIV infection. The Mamu-A*02+ monkeys that also expressed Mamu-A*01 exhibited a significant delay in the evolution of the CD8+ T lymphocyte responses specific for the dominant Mamu-A*02-restricted SIV epitope, Nef p199RY. This delay in kinetics was not due to differences in viral load kinetics or magnitude or in viral escape mutations, but was associated with the evolution of the Mamu-A*01-restricted CD8+ T lymphocyte responses to the highly dominant SIV epitopes Gag p11C and Tat TL8. Thus, the evolution of dominant epitope-specific CD8+ T lymphocyte responses can be suppressed by other dominant epitope-specific responses, and this immunodomination is important in determining the kinetics of dominant epitope-specific responses.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Virus-specific CD8+ T lymphocyte responses are critically important for controlling viral replication in humans infected with HIV-1 and in rhesus monkeys infected with SIV (1, 2, 3). The pivotal role of this cellular immune response is dramatically illustrated in studies in which the in vivo depletion of CD8+ T lymphocytes in rhesus monkeys infected with SIV resulted in a loss of viral containment (4, 5, 6). Because virus-specific CD8+ T lymphocyte responses focus on a limited number of 8- to 10-aa dominant epitopes, the control of HIV/SIV replication by CD8+ T lymphocyte responses is largely dependent on the responses to a limited number of dominant epitopes. Loss of even a single dominant epitope-specific CD8+ T lymphocyte response through viral escape mutation has led to loss of viral containment and disease progression (7, 8, 9). Moreover, there is evidence that the efficiency of viral control by CD8+ T lymphocytes increases as the number of epitopes recognized by virus-specific CD8+ T lymphocytes increases. HIV-infected individuals with maximum heterozygosity of MHC class I (MHC-I)3 loci, and thus the greatest number of peptide-binding specificities, have the most stable clinical course, whereas homozygosity is associated with rapid disease progression (10, 11, 12). Taken together, these results suggest that increasing the number of dominant epitope-specific CD8+ T lymphocyte responses in an individual might improve the effectiveness of CD8+ T lymphocytes in controlling viral replication.

Although HIV vaccine strategies designed to elicit a high frequency of CD8+ T lymphocytes are being pursued, little attention has been paid to the breadth of these immune responses. Because vaccine-induced CD8+ T lymphocytes mediate control of viremia and therefore slow clinical progression in SIV- or simian human immunodeficiency virus (SHIV)-infected rhesus monkeys (13, 14, 15, 16), investigators are developing vaccine modalities that increase the magnitude of virus-specific CD8+ T lymphocyte responses (17). However, an effective vaccine-elicited CD8+ T lymphocyte response must recognize a diversity of epitopes so as to minimize the impact of individual viral epitope escape mutations. The natural propensity of CD8+ T lymphocytes to focus their recognition of virus on a limited number of dominant epitopes, called immunodominance, presents a substantial obstacle to achieving such a broad cellular response.

An understanding of the mechanisms underlying immunodominance will be needed to allow the development of vaccination strategies for maximizing the breadth of virus-specific CD8+ T lymphocyte responses. Studies have suggested that immunodominance can be a result of the competition between epitope peptides for the Ag-processing machinery of the cell, as well as for MHC binding (18). The repertoire of Ag specificities of the TCRs of the CD8+ T lymphocyte population also may contribute to determining which epitope-specific responses are dominant. Finally, studies have shown that CD8+ T lymphocyte responses specific for immunodominant epitopes may suppress CD8+ T lymphocyte responses specific for subdominant epitopes, a phenomenon referred to as immunodomination (19, 20, 21).

To explore the determinants of epitopic dominance, we investigated whether the evolution of one dominant epitope-specific CD8+ T lymphocyte response influences the evolution of a second dominant response in rhesus monkeys infected with SIV. We identified cohorts of monkeys expressing defined MHC-I molecules and assessed their epitope-specific CD8+ T lymphocyte responses following acute SIV infection.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Animals, SIVmac251 virus stock, and viral loads

All animals used in this study were Indian-origin rhesus monkeys (Macaca mulatta) that were maintained in accordance with the guidelines of the Institutional Animal Care and Use Committee for Harvard Medical School and the Guide for the Care and Use of Laboratory Animals (Institute of Laboratory Animal Resources (U.S.) Committee on Care and Use of Laboratory Animals, 1996). SIVmac251 virus was grown in human PBMCs in vitro, and supernatants from days 3–14 were pooled and stored at –80°C. The SIVmac251 virus stock had 6.3 x 108 viral copies/ml and ~100 ng/ml p27 by ELISA. The monkeys AH88, BF74, BI33, and P503 served as control animals in a lymphocyte depletion study (R. Veazey et al., unpublished observations). These animals received control Ab injections on the day of challenge and on days 3 and 7 after challenge (10, 5, and 5 mg, respectively). Most monkeys were inoculated i.v. with a 1/3000 dilution of SIVmac251 stock in 1 ml of RPMI 1640 medium supplemented with 10% FCS. Monkeys AV52, AW26, and JHB received a 1/100, 1/1,000, and 1/10,000 dilution of SIVmac251, respectively, because they were involved in the titration of the virus stock. Monkey AW26 was not included in the analysis, because it had no measurable T lymphocyte or Ab responses as assessed by the assays used, failed to control viral replication, had a rapid disease progression, and died early (data not shown). Plasma viral RNA levels were measured by the SIV RNA 3.0 bDNA assay using a Quantiplex bDNA System 340 (Bayer), using probes that hybridize to the pol gene of the viral RNA.

Peptides, oligonucleotides, and tetramers

Synthetic peptides were obtained from Quality Control Biochemicals. Peptides included SIVmac251 Tat TL8 (TTPESANL), Gag p11C (CTPYDINQM), Env p54 (TVPWPNASL), Env p15 (CAPPGYALL), Pol p68A (STPPLVRLV), Nef p199RY (YTSGPGIRY), Nef p56 (YTYEAYVRY), and Gag p17G (GSENLKSLY). Oligonucleotides were obtained from BioSource International. Soluble tetrameric complexes containing Mamu-A*01 and either TL8, p11C, p54, p15, or p68A were prepared as described elsewhere (22, 23, 24). To construct soluble tetrameric complexes containing Mamu-A*02 and p199RY, p56, or p17G, an expression plasmid that encoded the extracellular region of Mamu-A*02 linked to a BirA substrate peptide was used (25). The expressed protein was refolded in vitro with human {beta}2-microglobulin in the presence of p199RY, p56, or p17G epitope peptide as described (26). The Mamu-A*02/{beta}2-microglobulin/peptide monomers were purified by gel filtration on a Superdex 200 column (Pharmacia) and biotinylated enzymatically with BirA enzyme (Avidity), following the manufacturer’s instructions. The efficiency of biotinylation was >80%. A Superdex 200 column was used to remove free biotin from the monomers, and then the biotinlyated monomers were mixed with PE-labeled streptavidin (ProZyme) at a molar ratio of 4:1 and titrated drop-wise to maximize tetramer formation. The Mamu-A*02/peptide-PE tetramers were stored at a concentration of 30–40 µg/ml in PBS containing 0.3% BSA, 0.1% sodium azide, and Protease Inhibitor Cocktail Set I (containing 4-(aminoethyl)benzenesulphonyl fluoride, aprotinin, E-64, EDTA, and leupeptin; Calbiochem) at 4°C, and used for staining at 150–200 ng/sample.

PCR typing of rhesus monkeys for Mamu-A*01 and Mamu-A*02

DNA was extracted from rhesus monkey PBMCs and amplified using allele-specific primers (27, 28). EDTA-preserved whole blood from monkeys was subjected to Ficoll-diatrizoate density gradient centrifugation to isolate PBMCs, and the washed cell pellets were resuspended in 200 µl of PBS. DNA extraction was then conducted using a QIAamp blood kit (Qiagen). PCR was performed on 500 ng of extracted DNA in a 50-µl reaction consisting of Optimized Buffer B (Invitrogen Life Technologies), 1 mM dNTPs (0.25 mM each), 15 U of AmpliTaq Gold polymerase (Applied Biosystems), and allele-specific primers. The Mamu-A*01-specific primers A*01/F (GACAGCGACGCCGCGAGCCAA) and A*01/R (GCTGCAGCGTCTCCTTCCCC) were each used at a concentration of 0.8 µM. The Mamu-A*02-specific primers A*02/F (GTGGGTGGAGCAGGAGGGTCCA) and A*02/R (CAGCACCTCAGGGTGGCCTCT) were each used at a concentration of 0.8 µM. Primers 5'-MDRB (GCCTCGAGTGTCCCCCCAGCACGT) and 3'-MDRB (GCAAGCTTTCACCTCGCCGCTG) were each used at a concentration of 0.68 µM. The latter primer pair is specific for a conserved MHC class II sequence (based on the rhesus homolog of HLA-DRB3) and was included in the PCR as an internal control. PCR was conducted using a GeneAmp 9600 thermocycler (PerkinElmer). Samples were denatured for 10 min at 96°C, then cycled at 96°C for 25 s and 72°C for 60 s for five cycles; 96°C for 25 s, 65°C for 50 s, and 72°C for 45 s for 21 cycles; and 96°C for 25 s, 55°C for 60 s, and 72°C for 80 s for 4 cycles. Mamu-A*01+ monkeys were identified by the presence of two bands on 2% agarose gels: the expected 260-bp MDRB product and a 685-bp Mamu-A*01-specific product. Mamu-A*02+ monkeys were identified by the presence of the expected 260-bp MDRB product and a 1.3-kb Mamu-A*02-specific product.

Tetramer staining of peptide-specific CD8+ T lymphocytes and flow cytometric analysis

PE-labeled and allophycocyanin-labeled tetrameric complexes were used with FITC-labeled anti-human CD8{alpha} (SK1; BD Biosciences) and either PerCP-cyanine 5.5 (PerCP-Cy5.5)-labeled anti-human CD3 (SP34-2; BD Biosciences) or allophycocyanin-labeled anti-rhesus CD3 (FN18; custom conjugated by Beckman Coulter) to stain epitope-specific CD8+ T lymphocytes. One hundred microliters of EDTA-preserved whole blood from rhesus monkeys was incubated, first with PE-labeled tetramer (with or without allophycocyanin-labeled tetramer) for 15 min at room temperature and then with anti-CD8{alpha}-FITC and anti-CD3-allophycocyanin (or anti-CD3-PerCP-Cy5.5 if an allophycocyanin-labeled tetramer was used earlier) for 15 min at room temperature. The stained blood was then lysed on an Immunoprep Reagent Q-Prep Workstation (Beckman Coulter), washed with 4 ml of PBS, and fixed in 0.5 ml of PBS containing 1% paraformaldehyde. Samples were analyzed by four-color flow cytometry on a FACSCalibur (BD Biosciences).

ELISPOT analysis

EDTA-preserved whole blood from rhesus monkeys was subjected to Ficoll-diatrizoate density-gradient centrifugation to isolate PBMCs, and cells were then seeded into 96-well plates (Millipore) that had been coated overnight with anti-human IFN-{gamma} Ab (B27; BD Pharmingen) at 10 µg/ml in Dulbecco’s PBS (Invitrogen Life Technologies). Plates were then washed three times with 0.25% Tween 20 in Dulbecco’s PBS. Plates were next blocked for 2 h at 37°C with 5% FCS in Dulbecco’s PBS and then washed three times with PBS/Tween and once with RPMI 1640 medium supplemented with 10% FCS. Cells were seeded in RPMI 1640 medium with 10% FCS at a density of 2 x 105 cells per well in triplicate, in the presence of 1 µg/ml peptide, 5 µg/ml PHA-M (Sigma-Aldrich), or medium alone. Plates were then incubated for 18 h at 37°C in a 5% CO2 atmosphere. Plates were washed nine times with PBS/Tween and once with water, and then incubated in the presence of 2 µg/ml biotinylated rabbit polyclonal anti-human IFN-{gamma} antiserum (BioSource International) for 2 h at room temperature. Plates were then washed again and incubated with streptavidin-alkaline phosphatase (Southern Biotechnology) for 2 h at room temperature. After a final rinse, a chromogenic substrate was added (1-Step NBT/BCIP; Pierce). After 10–15 min, plates were washed thoroughly with water and air-dried. Spots were counted on an imaging system (Hitech Instruments; Image Processing Solutions) using IMAGE-PRO PLUS image processing software (Media Cybernetics).

Sequencing the SIV Nef p199RY epitope in viral RNA in plasma

EDTA-preserved whole blood from Mamu-A*02+ rhesus monkeys sampled 35 days after infection was subjected to Ficoll-diatrizoate density-gradient centrifugation to obtain cell-free plasma. Viral RNA was extracted from plasma using the QIAamp Viral RNA Mini kit (Qiagen). Reverse transcription-PCR was performed on each RNA sample using the Qiagen One-Step RT-PCR kit and primers 9211-F (CAGCAACTGCAGAACCTTG) and 10203-R (ATCAAGAAAGTGGGCGTT) to amplify a 1-kb sequence of cDNA containing the entire nef gene (24, 29). Samples were incubated at 50°C for 30 min, denatured at 95°C for 15 min, and then cycled at 95°C for 30 s, 59°C for 30 s, and 72°C for 60 s for 40 cycles; and then extended at 72°C for 10 min. Each PCR product was ligated into pGEM-T Easy Vector (Promega) and then transformed into competent JM109 cells (Promega), according to the manufacturer’s instructions. Transformed cells were grown on blue-white plates containing imMedia Amp Agar (Invitrogen Life Technologies), 0.5 mM IPTG (Promega), and 80 µg/ml X-Gal (Promega), and white colonies were selected for sequencing. DNA was extracted using QIAprep Miniprep kit (Qiagen), and sequenced using primers 9536-F (TCCATGGAGAAACCCAGCT) and 10203-R. Approximately 10 clones were sequenced from each plasma sample.

Statistical analyses

Pair-wise comparisons of data from the three cohorts of monkeys were performed using the Wilcoxon rank sum test, using statistical software S-PLUS 6.1 (Insightful). The area under the curve (AUC) for viral load vs time (days 0–35 and 35–70, following infection) was estimated using the trapezoidal method.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Gag p11C-specific CD8+ T lymphocyte responses develop more slowly than Tat TL8-specific responses

We initiated studies to define the evolution of immunodominant and subdominant epitope-specific CD8+ T lymphocyte responses in rhesus monkeys during primary SIV infection. Four naive Mamu-A*01+ rhesus monkeys were infected with SIVmac251, and their blood was sampled at weekly intervals for 10 wk to evaluate the development of Mamu-A*01-restricted, SIV epitope-specific CD8+ T lymphocyte responses. Peripheral blood was stained with soluble tetramers constructed with Mamu-A*01 and one of the following well-described SIV epitope peptides: the immunodominant Tat TL8 (TTPESANL) or Gag p11C (CTPYDINQM); or the subdominant Env p54 (TVPWPNASL), Env p15 (CAPPGYALL), or Pol p68A (STPPLVRLV) (23, 24, 30, 31, 32, 33, 34). Gating on CD8+CD3+ lymphocytes, tetramer-binding cells were readily detected in all four SIVmac-infected monkeys by 2 wk postinfection (Fig. 1). Tat TL8-specific CD8+ T lymphocyte responses were measurable by 2 wk after infection, peaked by 2 or 3 wk, and then rapidly declined. This decline occurred in temporal coincidence with the emergence of the early viral escape mutations that uniformly emerge in this viral epitope (24). However, the evolution of Gag p11C-specific CD8+ T lymphocyte responses were less consistent. In monkey AH88, the Gag p11C-specific response rose quickly but then fell sharply before gradually rising again during the acute infection period. In monkey BF74, the Gag p11C-specific response rose more gradually, peaking at 4 wk postinfection, and then declined. The Gag p11C-specific response in monkey BI33 was bimodal, like that in AH88, and had a delayed first peak relative to the Tat TL8-specific response, like that in BF74. In monkey P503, the Gag p11C-specific response had a very slow initial rise, and although it was easily detectable at 2 wk postinfection, it was still increasing 10 wk after infection.



View larger version (21K):
[in this window]
[in a new window]
 
FIGURE 1. Development of Mamu-A*01-restricted, SIV epitope-specific T lymphocyte responses in SIVmac251-infected Mamu-A*01+ rhesus monkeys. Four Mamu-A*01+ rhesus monkeys were infected with SIVmac251, and the development of T lymphocyte responses specific for the Mamu-A*01-restricted epitopes Gag p11C, Env p15, Env p54, Pol p68A, and Tat TL8 was followed by tetramer staining of whole blood. Shown are the percentages of cells gated on the lymphocyte population that stained positively for CD3, CD8{alpha}, and a soluble tetramer complex containing Mamu-A*01 and the indicated epitope peptide.

 
One possible explanation for the delay in the peak of the Gag p11C-specific CD8+ T lymphocyte response relative to the Tat TL8-specific response seen in all of these monkeys is that Gag is a late viral structural protein and therefore elicits a later immune response than the early nonstructural Tat protein. The kinetics of the Mamu-A*01-restricted CD8+ T lymphocyte responses specific for the subdominant epitopes Env p54, Env p15, and Pol p68A was consistent with this possibility. All of these subdominant epitopes are derived from late structural gene products, and all elicited CD8+ T lymphocyte responses that did not peak until at least 4 wk postinfection and/or had bimodal kinetics (Fig. 1 and data not shown). However, because these CD8+ T lymphocyte responses were both specific for subdominant epitopes and also recognized late structural gene products, it was not possible to distinguish the relative contributions of these two factors in determining the kinetics of these responses.

CD8+ T lymphocyte responses specific for epitopes of early, nonstructural SIV gene products do not develop more rapidly than those specific for late, structural gene products

To distinguish whether the kinetics of an SIV epitope-specific CD8+ T lymphocyte response was associated with the time at which the gene encoding the epitope is expressed, or rather by the relative immunodominance of the CD8+ T lymphocyte response, we evaluated SIV epitope-specific responses during primary virus infection in naive Mamu-A*02+ rhesus monkeys. We and others have previously identified an immunodominant Mamu-A*02-restricted SIV Nef epitope, p199RY (YTSGPGIRY), as well as two subdominant epitopes, Nef p56 (YTYEAYVRY) and Gag p17G (GSENLKSLY) (25 , 26 , 29 , 35 , and 36 and our unpublished observations). If CD8+ T lymphocyte epitopes of early nonstructural gene products induce rapid T lymphocyte responses and epitopes of late structural gene products induce delayed responses, the Nef p199RY- and p56-specific responses should peak rapidly, and the peak of the Gag p17G-specific response should be delayed. In contrast, if the kinetics of epitope-specific CD8+ T lymphocyte responses is a function of their relative dominance, the Nef p199RY-specific response should peak early, and the peaks of the Nef p56- and Gag p17G-specific responses should be delayed.

Five naive Mamu-A*01Mamu-A*02+ rhesus macaques were infected with SIVmac251, and their blood was evaluated one to two times weekly for 10 wk to assess the development of Mamu-A*02-restricted, SIV epitope-specific CD8+ T lymphocyte responses. In addition to tetramer staining of whole blood, PBMCs were stimulated with the optimal peptide epitopes, and epitope-specific functional responses were assessed by IFN-{gamma} ELISPOT assay. Mamu-A*02/Nef p199RY tetramer-binding CD8+ T cells were readily detected in all five SIVmac-infected monkeys by 2 or 3 wk postinfection and were maximal by 3 or 4 wk postinfection (Fig. 2A). Both Nef p56- and Gag p17G-specific responses were detected much later and reached their peaks much later than did the Nef p199RY-specific responses (Fig. 2A and data not shown). The kinetics of the epitope-specific ELISPOT responses was similar (Fig. 2B and data not shown). These findings suggest that CD8+ T lymphocyte responses specific for epitopes encoded by late structural genes are not necessarily delayed relative to those responses specific for epitopes encoded by early nonstructural genes.



View larger version (42K):
[in this window]
[in a new window]
 
FIGURE 2. Development of Mamu-A*02-restricted, SIV epitope-specific T lymphocyte responses in SIVmac251-infected Mamu-A*02+ rhesus monkeys. Five Mamu-A*02+ rhesus monkeys were infected with SIVmac251, and the development of T lymphocyte responses specific for the Mamu-A*02-restricted epitopes Nef p199RY, Nef p56, and Gag p17G was followed by tetramer staining of whole blood (A) or by ELISPOT assay (B). A, Shown are the percentages of cells gated on the lymphocyte population that stained positively for CD3, CD8{alpha}, and a soluble tetramer complex containing Mamu-A*02 and the indicated epitope peptide. B, PBMCs from the indicated monkeys were stimulated for 18 h with 1 µg/ml epitope peptide as shown or medium alone, and IFN-{gamma}-producing cells were visualized by ELISPOT assay. The number of spot-forming cells per 106 PBMC is shown as the median of triplicate wells minus the median of five medium control wells.

 
The peaks of Mamu-A*02-restricted Nef p199RY-specific CD8+ T lymphocyte responses are delayed in the presence of immunodominant Mamu-A*01-restricted responses

One of the mechanisms postulated to explain the maintenance of the immunodominance hierarchies of epitope-specific CD8+ T lymphocyte responses is that certain epitope-specific T lymphocyte responses are suppressed by the presence of more dominant T lymphocyte responses specific for other epitopes. To determine whether this phenomenon, referred to as immunodomination, might account for the kinetics of epitope-specific CD8+ T lymphocyte responses in SIV-infected rhesus monkeys, we evaluated the evolution of the CD8+ T lymphocyte response specific for the Mamu-A*02-restricted SIV epitope Nef p199RY in the presence of CD8+ T lymphocyte responses specific for the highly dominant Mamu-A*01-restricted SIV epitopes Tat TL8 and Gag p11C.

To select experimental animals for this study, we screened ~400 Indian-origin rhesus monkeys from the Tulane National Primate Research Center for the presence of Mamu-A*01 and Mamu-A*02 genes using a PCR-based technique. The frequencies of the Mamu-A*01 and Mamu-A*02 genes in this monkey colony were 21 and 25%, respectively, and the frequency of double positives was 4.3% (data not shown). Five naive Mamu-A*01+Mamu-A*02+ rhesus monkeys were infected with SIVmac251, and their blood was monitored one to two times weekly for 10 wk to evaluate the development of Mamu-A*01- and Mamu-A*02-restricted, SIV epitope-specific CD8+ T lymphocyte responses. Mamu-A*01-restricted CD8+ T lymphocyte responses specific for the immunodominant epitopes Tat TL8 and Gag p11C were detected by day 17 postinfection in all Mamu-A*01+Mamu-A*02+ monkeys using both tetramer staining (Figs. 3A and 4A) and ELISPOT assays (Figs. 3B and 4B), similar to the kinetics of these responses observed in Mamu-A*01+Mamu-A*02 monkeys. The first peak of these immunodominant Mamu-A*01-restricted responses also was early in the Mamu-A*01+Mamu-A*02+ monkeys, with a median of 17 and 21 days from infection until the first peak of staining with the Gag p11C or Tat TL8 tetramers, respectively, consistent with what was seen in the Mamu-A*01+Mamu-A*02 monkeys (Figs. 3A and 4C). In four of the five Mamu-A*01+Mamu-A*02+ monkeys, the early Gag p11C-specific CD8+ T lymphocyte response peak was followed by a transient fall, and then a subsequent rise over the following weeks.



View larger version (45K):
[in this window]
[in a new window]
 
FIGURE 3. Development of Mamu-A*01- and Mamu-A*02-restricted, SIV epitope-specific T lymphocyte responses in SIVmac251-infected Mamu-A*01+Mamu-A*02+ rhesus monkeys. Five Mamu-A*01+Mamu-A*02+ rhesus monkeys were infected with SIVmac251, and the development of T lymphocyte responses specific for the Mamu-A*01-restricted epitopes Gag p11C and Tat TL8, and the Mamu-A*02-restricted epitope Nef p199RY was followed by tetramer staining of whole blood (A) or by ELISPOT assay (B). A, Shown are the percentages of cells gated on the lymphocyte population that stained positively for CD3, CD8{alpha}, and a soluble tetramer complex containing Mamu-A*01 or Mamu-A*02 and the indicated epitope peptide. B, PBMCs from the indicated monkeys were stimulated for 18 h with 1 µg/ml epitope peptide as shown or medium alone, and IFN-{gamma}-producing cells were visualized by ELISPOT assay. The number of spot-forming cells per 106 PBMC is shown as the median of triplicate wells minus the median of five medium control wells.

 


View larger version (24K):
[in this window]
[in a new window]
 
FIGURE 4. Peak, but not the first detection, of Nef p199RY epitope-specific T lymphocyte responses are delayed in Mamu-A*02+ rhesus monkeys that also express Mamu-A*01. The time until onset (A and B) and peak (C and D) of SIV epitope-specific T lymphocyte responses are shown for Nef p199RY, Gag p11C, and Tat TL8 in Mamu-A*01+(A*01), Mamu-A*01+Mamu-A*02+ (A*01/A*02), and Mamu-A*02+ (A*02) rhesus monkeys. Epitope-specific T lymphocyte responses are evaluated by tetramer staining (A and C) and ELISPOT assay (B and D). Values are shown for individual animals ({diamondsuit}), and the median of each group ({blacksquare}). Times to development of Nef p199RY epitope-specific responses for Mamu-A*02+ (A*02) and Mamu-A*01+Mamu-A*02+ (A*01/A*02) rhesus monkeys are compared using the Wilcoxon rank sum test.

 
The Mamu-A*02-specific Nef p199RY-specific T lymphocyte responses also were detected in all Mamu-A*01+Mamu-A*02+ monkeys using both tetramer staining (Figs. 3A and 4A) and ELISPOT assay (Figs. 3B and 4B) by day 17 postinfection, an interval following infection not significantly different from that observed in Mamu-A*01Mamu-A*02+ monkeys. However, the first peak of Nef p199RY-specific responses in Mamu-A*01+Mamu-A*02+ monkeys was delayed to a median of 35 days postinfection as quantified by both tetramer staining (Figs. 3A and 4C) and ELISPOT assay (Figs. 3B and 4D). The difference between this interval and the median of 17 days between infection and peak Nef p199RY-specific responses observed in Mamu-A*01Mamu-A*02+ monkeys was highly significant (p < 0.01) as determined by tetramer staining and nearly significant (p = 0.057) as determined by ELISPOT assay. This delay in the kinetics of the Mamu-A*02-specific Nef p199RY-specific T lymphocyte response, in the presence of the highly dominant Mamu-A*01-restricted T lymphocyte responses specific for the Tat TL8 and Gag p11C epitopes, is consistent with the phenomenon of immunodomination.

The kinetics of SIVmac replication is similar in the different groups of monkeys

The observation that the first peak of Nef p199RY-specific T lymphocyte responses was delayed in Mamu-A*02+ monkeys that also expressed Mamu-A*01 might be explained by a suppression of these responses by the immunodominant Mamu-A*01-restricted responses to Gag p11C and Tat TL8. However, other explanations for this phenomenon are possible. There may have been less virus replication in the Mamu-A*01+Mamu-A*02+ monkeys than in the Mamu-A*01Mamu-A*02+ monkeys and therefore less antigenic stimulation of epitope-specific CD8+ T lymphocyte responses in these animals. In fact, a number of studies have shown better control of SIV replication in rhesus monkeys that express Mamu-A*01 than in Mamu-A*01 monkeys (37, 38, 39, 40, 41). To explore this possibility, plasma virus RNA levels were assessed over time in all of the experimental animals (Fig. 5, A–C). The time to peak viremia was comparable among the groups of monkeys, with no significant differences between any pair of groups as determined by the Wilcoxon rank sum test (Fig. 5D). The magnitudes of peak viremia were also comparable among the groups of monkeys (Fig. 5E). Furthermore, the viral loads at day 35 postinfection (when the Nef p199RY-specific responses peaked in Mamu-A*01+Mamu-A*02+ monkeys) and at day 70 postinfection (at viral load set-point), as well as the decreases in viral loads from the peak to days 35 and 70 were not significantly different between any pair of groups (statistics not shown). We also analyzed the AUC for viral load vs time from days 0 to 35 (Fig. 5F) and from days 35 to 70 (statistics not shown) following the infection of each monkey. The medians of the AUCs for each group of monkeys were not significantly different. Thus, differences between groups of monkeys in SIVmac replication kinetics did not account for the differences in the kinetics of the CD8+ T lymphocyte responses specific for Nef p199RY.



View larger version (40K):
[in this window]
[in a new window]
 
FIGURE 5. SIV viral load kinetics and magnitude are not associated with the delayed peak of the Nef p199RY epitope-specific T lymphocyte responses in Mamu-A*02+ rhesus monkeys that also express Mamu-A*01. SIV viral loads are shown for individual Mamu-A*01+(A; A*01), Mamu-A*02+(B; A*02), and Mamu-A*01+Mamu-A*02+ (C; A*01/A*02) rhesus monkeys. D, The time to peak viral load is shown for each animal ({diamondsuit}), and the median is shown for each group ({blacksquare}). A pairwise comparison was performed for each pair of groups by the Wilcoxon rank sum test and was not significant for all three comparisons. E, The magnitude of peak viral load is shown for each animal ({diamondsuit}), and the median is shown for each group ({blacksquare}). A pairwise comparison was performed for each pair of groups by the Wilcoxon rank sum test and was not significant for all three comparisons. F, The AUC for viral load from infection through day 35 is shown for each animal ({diamondsuit}), and the median is shown for each group ({blacksquare}). A pairwise comparison was performed for each pair of groups by the Wilcoxon rank sum test and was not significant for all three comparisons.

 
Fewer mutations in the Nef p199RY epitope are found in Mamu-A*02+ monkeys that also express Mamu-A*01

Another potential explanation for the delay in the peak of Nef p199RY-specific CD8+ T lymphocyte responses in Mamu-A*01+Mamu-A*02+ monkeys is that an increase in the frequency of mutations in the Nef p199RY epitope in these animals may have led to a decrease in the antigenic stimulation of the Nef p199RY-specific CD8+ T lymphocytes. To assess this possibility, we sequenced a 670-bp region from the nef gene of the viruses in the plasma of the Mamu-A*02+ monkeys at 35 days postinfection. We sequenced ~10 individual clones from each monkey and compared them to 12 sequenced clones from the challenge stock of SIVmac251 used to infect the animals. The sequences encoded the C-terminal two-thirds of the Nef protein, including the p199RY epitope. Of the ~170 aa outside the p199RY epitope, there was, on average, fewer than 1 nonsynonymous mutation per clone (data not shown). However, there were numerous nonsynonymous mutations in the sequence encoding the p199RY epitope, or the 1–2 aa adjacent to it (Fig. 6). These mutations certainly could affect epitope peptide processing and presentation. In the Mamu-A*01Mamu-A*02+ monkeys, 78–100% of the virus in each monkey had mutations in the Nef p199RY epitope (96% overall), and 26% of those mutations were in the residues of the peptide that are most important for binding to Mamu-A*02 (positions 2 and 9) (35, 36). In the Mamu-A*01+Mamu-A*02+ monkeys, 0–91% of the virus in each monkey had mutations in the Nef p199RY epitope (40% overall), and none of those mutations was in the anchor residues. The mutation frequency in the Nef p199RY epitope in individual monkeys was not associated positively or negatively with their viral loads. The observation that there were fewer mutations in the Nef p199RY epitope of the virus found in Mamu-A*02+ monkeys that also express Mamu-A*01 could not explain why those animals had delayed peak Nef p199RY-specific T lymphocyte responses. Rather, the delay in the maximal Nef p199RY-specific CD8+ T lymphocyte responses could have delayed the generation of the immune pressure that selected for these mutations and thus could account for the delay in the emergence of Nef p199RY escape mutations.



View larger version (17K):
[in this window]
[in a new window]
 
FIGURE 6. Mutations in the Mamu-A*02-restricted CTL epitope Nef p199RY in SIV-infected Mamu-A*02+ rhesus monkeys. Plasma from Mamu-A*02+ rhesus monkeys that were positive or negative for Mamu-A*01 as indicated, 35 days after infection with SIVmac251, was used for viral RNA extraction, reverse transcription, and cloning of a portion of the nef gene containing the p199RY epitope. Approximately 10 clones from each animal and from the original challenge stock of SIVmac251 used to infect the animals were sequenced. The region encoding the 9-aa peptide epitope p199RY and two additional amino acid residues on the N-terminal side of the epitope are shown, with differences from the consensus SIVmac sequence noted.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
It is important to understand the mechanism underlying the delayed kinetics of Mamu-A*02-restricted Nef p199RY-specific CD8+ T lymphocyte responses in Mamu-A*02+ rhesus monkeys that also express Mamu-A*01. These delayed kinetics could not be explained by changes in the kinetics or magnitude of viral load in the Mamu-A*01+Mamu-A*02+ animals. Nor were the delayed kinetics associated with a rapid emergence of mutations in the Nef p199RY epitope. In fact, Nef p199RY epitope mutations were reduced in number in Mamu-A*01+Mamu-A*02+ rhesus monkeys, consistent with the expected reduced selection pressure resulting from the delayed Nef p199RY-specific CD8+ T lymphocyte response. Therefore, it is most likely that the delayed kinetics of Mamu-A*02-restricted Nef p199RY-specific CD8+ T lymphocyte responses in Mamu-A*02+ rhesus monkeys that also express Mamu-A*01 is due to the direct suppression of those responses by the immunodominant Mamu-A*01-restricted Gag p11C- and Tat TL8-specific responses.

Immunodomination also may account for perturbations in the kinetics of the Gag p11C-specific CD8+ T lymphocyte responses observed in the present study. In the Mamu-A*01+Mamu-A*02 rhesus monkeys, the peaks of the Gag p11C-specific responses were delayed relative to those of the Tat TL8-specific responses in three of four animals. This result is consistent with a suppression of the early Gag p11C-specific responses by the Tat TL8-specific responses and a later rise in the Gag p11C-specific responses as the Tat TL8-specific responses decrease in association with the development of Tat TL8 epitope escape mutations (24). In the one animal in the present study with an early peak Gag p11C-specific response (AH88), there was a sharp decrease in the magnitude of the response after the peak, with a subsequent gradual rise throughout the remainder of the period of acute infection. This early decrease in the Gag p11C-specific CD8+ T lymphocyte population is consistent with a transient suppression of this response by the Tat TL8-specific response.

In the Mamu-A*01+Mamu-A*02+ rhesus monkeys, the Gag p11C-specific CD8+ T lymphocyte responses had bimodal kinetics in four of five animals, and the initial peak responses were small in magnitude relative to the Tat TL8- and Nef p199RY-specific responses. This suggests that the Gag p11C-specific CD8+ T lymphocyte responses were suppressed to a greater extent by the immunodominant Tat TL8- and Nef p199RY-specific responses together than by the Tat TL8-specific responses alone, a finding consistent with the possibility that immunodomination can be an additive phenomenon. Furthermore, the reciprocal suppression of Gag p11C- and Nef p199RY-specific responses suggests that immunodomination can be bidirectional.

The suppression of subdominant epitope-specific CD8+ T lymphocyte responses by immunodominant epitope-specific CD8+ T lymphocyte responses has been described in inbred mice. In murine studies, elimination of an immunodominant epitope-specific CD8+ T lymphocyte response has led to the enhancement of a subdominant epitope-specific CD8+ T lymphocyte response. Such an enhancement of subdominant responses has been shown in situations where the immunodominant epitope-specific CD8+ T lymphocyte response was circumvented by infecting with an immunodominant epitope-negative viral variant (20), by infecting knockout mice lacking the MHC-I molecule that presents the immunodominant epitope (21) or by deleting immunodominant epitope-specific CD8+ T lymphocytes by expressing the immunodominant epitope in the thymus as a transgene (19).

The mechanism underlying immunodomination is unknown. Several groups have shown that immunodomination could be overcome in mice if large numbers of Ag-pulsed dendritic cells were used for immunization, suggesting that immunodomination reflects, at least in part, a competition between CD8+ T lymphocytes for limiting numbers of APCs (42, 43). CD8+ T lymphocytes that successfully compete for Ag-pulsed APCs have been shown to have a particularly high affinity for Ag (44). However, the means by which high-affinity CD8+ T lymphocytes might prevent other CD8+ T lymphocytes from having a functional interaction with APCs is unclear. The lysis of either APCs or subdominant epitope-specific CD8+ T lymphocytes by an immunodominant CTL response could prevent additional CTL responses, but that does not appear to occur (44, 45, 46, 47). Immunodomination has been attenuated in one mouse model by IL-12 (48) and blocked in another by anti-TGF-{beta} Abs (49, 50, 51), implicating cytokines in the phenomenon. Whether the same processes contribute to the suppression of the dominant epitope-specific CD8+ T lymphocyte responses that have been demonstrated during the acute viral infection of primates in this study remains to be determined.

Until now, there has been only limited evidence for a role for immunodomination in determining viral epitope immunodominance hierarchies in infections of species other than mice. These studies have examined chronic viral infections in humans. Höllsberg (52) examined the CD8+ T lymphocyte responses to EBV epitopes presented by HLA-A*02 and HLA-B*07 in healthy humans who were chronically infected with EBV. HLA-A*02-restricted epitope-specific ELISPOT responses were cumulatively reduced in individuals who also expressed HLA-B*07, although the reductions of individual epitope-specific responses were not statistically significant. In a cohort of nine EBV-infected, HLA-A*02+HLA-B*07+ individuals, one had a strong CD8+ T lymphocyte response directed against the immunodominant HLA-A*02-restricted epitope, and seven had strong responses to the immunodominant HLA-B*07-restricted epitope; however, no individuals had strong responses to both epitopes. Lacey et al. (53) studied the CD8+ T lymphocyte responses to immunodominant CMV epitopes presented by HLA-A*02 and HLA-B*07 in chronically infected individuals. Using tetramer staining, the authors showed that CD8+ T lymphocyte responses directed against an HLA-A*02-restricted epitope were dominant in HLA-A*02+HLA-B*07 individuals but weak or absent in HLA-A*02+HLA-B*07+ individuals. Instead, these HLA-A*02+HLA-B*07+ individuals had strong CD8+ T lymphocyte responses directed only against the immunodominant HLA-B*07-restricted epitope. These two studies support the idea that immunodomination operates in outbred species.

The results of the present study indicate that immunodomination occurs during the acute infection of rhesus monkeys with SIV, and is critical in determining the kinetics of epitope-specific CD8+ T lymphocyte responses. We have demonstrated that dominant epitope-specific CD8+ T lymphocyte responses suppress other dominant responses, as well as subdominant responses. The data also suggest that dominant CD8+ T lymphocyte responses can reciprocally suppress one another, and that suppression by multiple dominant CD8+ T lymphocyte responses may be more efficient than that by single dominant CD8+ T lymphocyte responses and may therefore be additive. It will be important to explore the mechanisms underlying this immunodomination and how they can be manipulated to optimize virus-specific CD8+ T lymphocyte responses in the setting of vaccination and infection.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by U.S. Public Health Service Grants AI060380-02 (to M.H.N.), AI59080 (to R.S.V.), AI48394 (to J.E.S.), and AI20729 (to N.L.L.) from the National Institute for Allergy and Infectious Diseases. Back

2 Address correspondence and reprint requests to Dr. Norman L. Letvin, Division of Viral Pathogenesis, Department of Medicine, Beth Israel Deaconess Medical Center, Harvard Medical School, Research East Room 113, 330 Brookline Avenue, Boston, MA 02215. E-mail address: nletvin{at}bidmc.harvard.edu Back

3 Abbreviations used in this paper: MHC-I, MHC class I; AUC, area under the curve. Back

Received for publication August 4, 2005. Accepted for publication October 21, 2005.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Walker, C. M., D. J. Moody, D. P. Stites, J. A. Levy. 1986. CD8+ lymphocytes can control HIV infection in vitro by suppressing virus replication. Science 234: 1563-1566. [Abstract/Free Full Text]
  2. Koup, R. A., J. T. Safrit, Y. Cao, C. A. Andrews, G. McLeod, W. Borkowsky, C. Farthing, D. D. Ho. 1994. Temporal association of cellular immune responses with the initial control of viremia in primary human immunodeficiency virus type 1 syndrome. J. Virol. 68: 4650-4655. [Abstract/Free Full Text]
  3. Kuroda, M. J., J. E. Schmitz, W. A. Charini, C. E. Nickerson, M. A. Lifton, C. I. Lord, M. A. Forman, N. L. Letvin. 1999. Emergence of CTL coincides with clearance of virus during primary simian immunodeficiency virus infection in rhesus monkeys. J. Immunol. 162: 5127-5133. [Abstract/Free Full Text]
  4. Matano, T., R. Shibata, C. Siemon, M. Connors, H. C. Lane, M. A. Martin. 1998. Administration of an anti-CD8 monoclonal antibody interferes with the clearance of chimeric simian/human immunodeficiency virus during primary infections of rhesus macaques. J. Virol. 72: 164-169. [Abstract/Free Full Text]
  5. Jin, X., D. E. Bauer, S. E. Tuttleton, S. Lewin, A. Gettie, J. Blanchard, C. E. Irwin, J. T. Safrit, J. Mittler, L. Weinberger, et al 1999. Dramatic rise in plasma viremia after CD8+ T cell depletion in simian immunodeficiency virus-infected macaques. J. Exp. Med. 189: 991-998. [Abstract/Free Full Text]
  6. Schmitz, J. E., M. J. Kuroda, S. Santra, V. G. Sasseville, M. A. Simon, M. A. Lifton, P. Racz, K. Tenner-Racz, M. Dalesandro, B. J. Scallon, et al 1999. Control of viremia in simian immunodeficiency virus infection by CD8+ lymphocytes. Science 283: 857-860. [Abstract/Free Full Text]
  7. Goulder, P. J., R. E. Phillips, R. A. Colbert, S. McAdam, G. Ogg, M. A. Nowak, P. Giangrande, G. Luzzi, B. Morgan, A. Edwards, et al 1997. Late escape from an immunodominant cytotoxic T-lymphocyte response associated with progression to AIDS. Nat. Med. 3: 212-217. [Medline]
  8. Barouch, D. H., J. Kunstman, M. J. Kuroda, J. E. Schmitz, S. Santra, F. W. Peyerl, G. R. Krivulka, K. Beaudry, M. A. Lifton, D. A. Gorgone, et al 2002. Eventual AIDS vaccine failure in a rhesus monkey by viral escape from cytotoxic T lymphocytes. Nature 415: 335-339. [Medline]
  9. Barouch, D. H., J. Kunstman, J. Glowczwskie, K. J. Kunstman, M. A. Egan, F. W. Peyerl, S. Santra, M. J. Kuroda, J. E. Schmitz, K. Beaudry, et al 2003. Viral escape from dominant simian immunodeficiency virus epitope-specific cytotoxic T lymphocytes in DNA-vaccinated rhesus monkeys. J. Virol. 77: 7367-7375. [Abstract/Free Full Text]
  10. Tang, J., C. Costello, I. P. Keet, C. Rivers, S. Leblanc, E. Karita, S. Allen, R. A. Kaslow. 1999. HLA class I homozygosity accelerates disease progression in human immunodeficiency virus type 1 infection. AIDS Res. Hum. Retroviruses 15: 317-324. [Medline]
  11. Keet, I. P., J. Tang, M. R. Klein, S. LeBlanc, C. Enger, C. Rivers, R. J. Apple, D. Mann, J. J. Goedert, F. Miedema, R. A. Kaslow. 1999. Consistent associations of HLA class I and II and transporter gene products with progression of human immunodeficiency virus type 1 infection in homosexual men. J. Infect. Dis. 180: 299-309. [Medline]
  12. Carrington, M., G. W. Nelson, M. P. Martin, T. Kissner, D. Vlahov, J. J. Goedert, R. Kaslow, S. Buchbinder, K. Hoots, S. J. O’Brien. 1999. HLA and HIV-1: heterozygote advantage and B*35-Cw*04 disadvantage. Science 283: 1748-1752. [Abstract/Free Full Text]
  13. Amara, R. R., F. Villinger, J. D. Altman, S. L. Lydy, S. P. O’Neil, S. I. Staprans, D. C. Montefiori, Y. Xu, J. G. Herndon, L. S. Wyatt, et al 2001. Control of a mucosal challenge and prevention of AIDS by a multiprotein DNA/MVA vaccine. Science 292: 69-74. [Medline]
  14. Barouch, D. H., S. Santra, J. E. Schmitz, M. J. Kuroda, T. M. Fu, W. Wagner, M. Bilska, A. Craiu, X. X. Zheng, G. R. Krivulka, et al 2000. Control of viremia and prevention of clinical AIDS in rhesus monkeys by cytokine-augmented DNA vaccination. Science 290: 486-492. [Abstract/Free Full Text]
  15. Egan, M. A., W. A. Charini, M. J. Kuroda, J. E. Schmitz, P. Racz, K. Tenner-Racz, K. Manson, M. Wyand, M. A. Lifton, C. E. Nickerson, et al 2000. Simian immunodeficiency virus (SIV) gag DNA-vaccinated rhesus monkeys develop secondary cytotoxic T-lymphocyte responses and control viral replication after pathogenic SIV infection. J. Virol. 74: 7485-7495. [Abstract/Free Full Text]
  16. Seth, A., I. Ourmanov, M. J. Kuroda, J. E. Schmitz, M. W. Carroll, L. S. Wyatt, B. Moss, M. A. Forman, V. M. Hirsch, N. L. Letvin. 1998. Recombinant modified vaccinia virus Ankara-simian immunodeficiency virus gag pol elicits cytotoxic T lymphocytes in rhesus monkeys detected by a major histocompatibility complex class I/peptide tetramer. Proc. Natl. Acad. Sci. USA 95: 10112-10116. [Abstract/Free Full Text]
  17. Letvin, N. L.. 2005. Progress toward an HIV vaccine. Annu. Rev. Med. 56: 213-223. [Medline]
  18. Yewdell, J. W., J. R. Bennink. 1999. Immunodominance in major histocompatibility complex class I-restricted T lymphocyte responses. Annu. Rev. Immunol. 17: 51-88. [Medline]
  19. von Herrath, M. G., J. Dockter, M. Nerenberg, J. E. Gairin, M. B. Oldstone. 1994. Thymic selection and adaptability of cytotoxic T lymphocyte responses in transgenic mice expressing a viral protein in the thymus. J. Exp. Med. 180: 1901-1910. [Abstract/Free Full Text]
  20. Weidt, G., O. Utermohlen, J. Heukeshoven, F. Lehmann-Grube, W. Deppert. 1998. Relationship among immunodominance of single CD8+ T cell epitopes, virus load, and kinetics of primary antiviral CTL response. J. Immunol. 160: 2923-2931. [Abstract/Free Full Text]
  21. van der Most, R. G., L. E. Harrington, V. Giuggio, P. L. Mahar, R. Ahmed. 2002. Yellow fever virus 17D envelope and NS3 proteins are major targets of the antiviral T cell response in mice. Virology 296: 117-124. [Medline]
  22. Kuroda, M. J., J. E. Schmitz, D. H. Barouch, A. Craiu, T. M. Allen, A. Sette, D. I. Watkins, M. A. Forman, N. L. Letvin. 1998. Analysis of Gag-specific cytotoxic T lymphocytes in simian immunodeficiency virus-infected rhesus monkeys by cell staining with a tetrameric major histocompatibility complex class I-peptide complex. J. Exp. Med. 187: 1373-1381. [Abstract/Free Full Text]
  23. Egan, M. A., M. J. Kuroda, G. Voss, J. E. Schmitz, W. A. Charini, C. I. Lord, M. A. Forman, N. L. Letvin. 1999. Use of major histocompatibility complex class I/peptide/{beta}2M tetramers to quantitate CD8+ cytotoxic T lymphocytes specific for dominant and nondominant viral epitopes in simian-human immunodeficiency virus-infected rhesus monkeys. J. Virol. 73: 5466-5472. [Abstract/Free Full Text]
  24. Allen, T. M., D. H. O’Connor, P. Jing, J. L. Dzuris, B. R. Mothe, T. U. Vogel, E. Dunphy, M. E. Liebl, C. Emerson, N. Wilson, et al 2000. Tat-specific cytotoxic T lymphocytes select for SIV escape variants during resolution of primary viraemia. Nature 407: 386-390. [Medline]
  25. Newberg, M. H., M. J. Kuroda, W. A. Charini, A. Miura, C. I. Lord, J. E. Schmitz, D. A. Gorgone, M. A. Lifton, K. Kuus-Reichel, N. L. Letvin. 2002. A simian immunodeficiency virus nef peptide is a dominant cytotoxic T lymphocyte epitope in Indian-origin rhesus monkeys expressing the common MHC class I allele mamu-A*02. Virology 301: 365-373. [Medline]
  26. Garboczi, D. N., D. T. Hung, D. C. Wiley. 1992. HLA-A2-peptide complexes: refolding and crystallization of molecules expressed in Escherichia coli and complexed with single antigenic peptides. Proc. Natl. Acad. Sci. USA 89: 3429-3433. [Abstract/Free Full Text]
  27. Knapp, L. A., E. Lehmann, M. S. Piekarczyk, J. A. Urvater, D. I. Watkins. 1997. A high frequency of Mamu-A*01 in the rhesus macaque detected by polymerase chain reaction with sequence-specific primers and direct sequencing. Tissue Antigens 50: 657-661. [Medline]
  28. Robinson, S., W. A. Charini, M. H. Newberg, M. J. Kuroda, C. I. Lord, N. L. Letvin. 2001. A commonly recognized simian immunodeficiency virus Nef epitope presented to cytotoxic T lymphocytes of Indian-origin rhesus monkeys by the prevalent major histocompatibility complex class I allele Mamu-A*02. J. Virol. 75: 10179-10186. [Abstract/Free Full Text]
  29. O’Connor, D. H., T. M. Allen, T. U. Vogel, P. Jing, I. P. DeSouza, E. Dodds, E. J. Dunphy, C. Melsaether, B. Mothe, H. Yamamoto, et al 2002. Acute phase cytotoxic T lymphocyte escape is a hallmark of simian immunodeficiency virus infection. Nat. Med. 8: 493-499. [Medline]
  30. Mothe, B. R., H. Horton, D. K. Carter, T. M. Allen, M. E. Liebl, P. Skinner, T. U. Vogel, S. Fuenger, K. Vielhuber, W. Rehrauer, et al 2002. Dominance of CD8 responses specific for epitopes bound by a single major histocompatibility complex class I molecule during the acute phase of viral infection. J. Virol. 76: 875-884. [Abstract/Free Full Text]
  31. Miller, M. D., H. Yamamoto, A. L. Hughes, D. I. Watkins, N. L. Letvin. 1991. Definition of an epitope and MHC class I molecule recognized by gag-specific cytotoxic T lymphocytes in SIVmac-infected rhesus monkeys. J. Immunol. 147: 320-329. [Abstract]
  32. Allen, T. M., J. Sidney, M. F. del Guercio, R. L. Glickman, G. L. Lensmeyer, D. A. Wiebe, R. DeMars, C. D. Pauza, R. P. Johnson, A. Sette, D. I. Watkins. 1998. Characterization of the peptide binding motif of a rhesus MHC class I molecule (Mamu-A*01) that binds an immunodominant CTL epitope from simian immunodeficiency virus. J. Immunol. 160: 6062-6071. [Abstract/Free Full Text]
  33. Allen, T. M., B. R. Mothe, J. Sidney, P. Jing, J. L. Dzuris, M. E. Liebl, T. U. Vogel, D. H. O’Connor, X. Wang, M. C. Wussow, et al 2001. CD8+ lymphocytes from simian immunodeficiency virus-infected rhesus macaques recognize 14 different epitopes bound by the major histocompatibility complex class I molecule mamu-A*01: implications for vaccine design and testing. J. Virol. 75: 738-749. [Abstract/Free Full Text]
  34. Furchner, M., A. L. Erickson, T. Allen, D. I. Watkins, A. Sette, P. R. Johnson, C. M. Walker. 1999. The simian immunodeficiency virus envelope glycoprotein contains two epitopes presented by the Mamu-A*01 class I molecule. J. Virol. 73: 8035-8039. [Abstract/Free Full Text]
  35. Vogel, T. U., T. C. Friedrich, D. H. O’Connor, W. Rehrauer, E. J. Dodds, H. Hickman, W. Hildebrand, J. Sidney, A. Sette, A. Hughes, et al 2002. Escape in one of two cytotoxic T-lymphocyte epitopes bound by a high-frequency major histocompatibility complex class I molecule, Mamu-A*02: a paradigm for virus evolution and persistence?. J. Virol. 76: 11623-11636. [Abstract/Free Full Text]
  36. Loffredo, J. T., J. Sidney, C. Wojewoda, E. Dodds, M. R. Reynolds, G. Napoe, B. R. Mothe, D. H. O’Connor, N. A. Wilson, D. I. Watkins, A. Sette. 2004. Identification of seventeen new simian immunodeficiency virus-derived CD8+ T cell epitopes restricted by the high frequency molecule, Mamu-A*02, and potential escape from CTL recognition. J. Immunol. 173: 5064-5076. [Abstract/Free Full Text]
  37. Mothe, B. R., J. Weinfurter, C. Wang, W. Rehrauer, N. Wilson, T. M. Allen, D. B. Allison, D. I. Watkins. 2003. Expression of the major histocompatibility complex class I molecule Mamu-A*01 is associated with control of simian immunodeficiency virus SIVmac239 replication. J. Virol. 77: 2736-2740. [Abstract/Free Full Text]
  38. Muhl, T., M. Krawczak, P. Ten Haaft, G. Hunsmann, U. Sauermann. 2002. MHC class I alleles influence set-point viral load and survival time in simian immunodeficiency virus-infected rhesus monkeys. J. Immunol. 169: 3438-3446. [Abstract/Free Full Text]
  39. O’Connor, D. H., B. R. Mothe, J. T. Weinfurter, S. Fuenger, W. M. Rehrauer, P. Jing, R. R. Rudersdorf, M. E. Liebl, K. Krebs, J. Vasquez, et al 2003. Major histocompatibility complex class I alleles associated with slow simian immunodeficiency virus disease progression bind epitopes recognized by dominant acute-phase cytotoxic-T-lymphocyte responses. J. Virol. 77: 9029-9040. [Abstract/Free Full Text]
  40. Pal, R., D. Venzon, N. L. Letvin, S. Santra, D. C. Montefiori, N. R. Miller, E. Tryniszewska, M. G. Lewis, T. C. VanCott, V. Hirsch, et al 2002. ALVAC-SIV-gag-pol-env-based vaccination and macaque major histocompatibility complex class I (A*01) delay simian immunodeficiency virus SIVmac-induced immunodeficiency. J. Virol. 76: 292-302. [Abstract/Free Full Text]
  41. Zhang, Z. Q., T. M. Fu, D. R. Casimiro, M. E. Davies, X. Liang, W. A. Schleif, L. Handt, L. Tussey, M. Chen, A. Tang, et al 2002. Mamu-A*01 allele-mediated attenuation of disease progression in simian-human immunodeficiency virus infection. J. Virol. 76: 12845-12854. [Abstract/Free Full Text]
  42. Sandberg, J. K., P. Grufman, E. Z. Wolpert, L. Franksson, B. J. Chambers, K. Karre. 1998. Superdominance among immunodominant H-2Kb-restricted epitopes and reversal by dendritic cell-mediated antigen delivery. J. Immunol. 160: 3163-3169. [Abstract/Free Full Text]
  43. Kedl, R. M., W. A. Rees, D. A. Hildeman, B. Schaefer, T. Mitchell, J. Kappler, P. Marrack. 2000. T cells compete for access to antigen-bearing antigen-presenting cells. J. Exp. Med. 192: 1105-1113. [Abstract/Free Full Text]
  44. Kedl, R. M., B. C. Schaefer, J. W. Kappler, P. Marrack. 2002. T cells down-modulate peptide-MHC complexes on APCs in vivo. Nat. Immunol. 3: 27-32. [Medline]
  45. Loyer, V., P. Fontaine, S. Pion, F. Hetu, D. C. Roy, C. Perreault. 1999. The in vivo fate of APCs displaying minor H antigen and/or MHC differences is regulated by CTLs specific for immunodominant class I-associated epitopes. J. Immunol. 163: 6462-6467. [Abstract/Free Full Text]
  46. Roy-Proulx, G., M. C. Meunier, A. M. Lanteigne, S. Brochu, C. Perreault. 2001. Immunodomination results from functional differences between competing CTL. Eur. J. Immunol. 31: 2284-2292. [Medline]
  47. Chen, W., K. Pang, K. A. Masterman, G. Kennedy, S. Basta, N. Dimopoulos, F. Hornung, M. Smyth, J. R. Bennink, J. W. Yewdell. 2004. Reversal in the immunodominance hierarchy in secondary CD8+ T cell responses to influenza A virus: roles for cross-presentation and lysis-independent immunodomination. J. Immunol. 173: 5021-5027. [Abstract/Free Full Text]
  48. Eberl, G., B. Kessler, L. P. Eberl, M. J. Brunda, D. Valmori, G. Corradin. 1996. Immunodominance of cytotoxic T lymphocyte epitopes co-injected in vivo and modulation by interleukin-12. Eur. J. Immunol. 26: 2709-2716. [Medline]
  49. Rowley, D. A., R. M. Stach. 1993. A first or dominant immunization. I. Suppression of simultaneous cytolytic T cell responses to unrelated alloantigens. J. Exp. Med. 178: 835-840. [Abstract/Free Full Text]
  50. Stach, R. M., D. A. Rowley. 1993. A first or dominant immunization. II. Induced immunoglobulin carries transforming growth factor-{beta} and suppresses cytolytic T cell responses to unrelated alloantigens. J. Exp. Med. 178: 841-852. [Abstract/Free Full Text]
  51. Rowley, D. A., R. M. Stach. 1998. B lymphocytes secreting IgG linked to latent transforming growth factor-{beta} prevent primary cytolytic T lymphocyte responses. Int. Immunol. 10: 355-363. [Abstract/Free Full Text]
  52. Höllsberg, P.. 2002. Contribution of HLA class I allele expression to CD8+ T-cell responses against Epstein-Barr virus. Scand. J. Immunol. 55: 189-195. [Medline]
  53. Lacey, S. F., M. C. Villacres, C. La Rosa, Z. Wang, J. Longmate, J. Martinez, J. C. Brewer, S. Mekhoubad, R. Maas, J. M. Leedom, et al 2003. Relative dominance of HLA-B*07-restricted CD8+ T-lymphocyte immune responses to human cytomegalovirus pp65 in persons sharing HLA-A*02 and HLA-B*07 alleles. Hum. Immunol. 64: 440-452. [Medline]



This article has been cited by other articles:


Home page
J. Virol.Home page
E. R. Manuel, W. W. Yeh, M. S. Seaman, K. Furr, M. A. Lifton, S. L. Hulot, P. Autissier, and N. L. Letvin
Dominant CD8+ T-Lymphocyte Responses Suppress Expansion of Vaccine-Elicited Subdominant T Lymphocytes in Rhesus Monkeys Challenged with Pathogenic Simian-Human Immunodeficiency Virus
J. Virol., October 1, 2009; 83(19): 10028 - 10035.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
B. A. Colleton, X.-L. Huang, N. M. Melhem, Z. Fan, L. Borowski, G. Rappocciolo, and C. R. Rinaldo
Primary Human Immunodeficiency Virus Type 1-Specific CD8+ T-Cell Responses Induced by Myeloid Dendritic Cells
J. Virol., June 15, 2009; 83(12): 6288 - 6299.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
E. L. Turnbull, M. Wong, S. Wang, X. Wei, N. A. Jones, K. E. Conrod, D. Aldam, J. Turner, P. Pellegrino, B. F. Keele, et al.
Kinetics of Expansion of Epitope-Specific T Cell Responses during Primary HIV-1 Infection
J. Immunol., June 1, 2009; 182(11): 7131 - 7145.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. R. Permar, H. H. Kang, A. Carville, K. G. Mansfield, R. S. Gelman, S. S. Rao, J. B. Whitney, and N. L. Letvin
Potent Simian Immunodeficiency Virus-Specific Cellular Immune Responses in the Breast Milk of Simian Immunodeficiency Virus-Infected, Lactating Rhesus Monkeys
J. Immunol., September 1, 2008; 181(5): 3643 - 3650.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
J. T. Loffredo, A. T. Bean, D. R. Beal, E. J. Leon, G. E. May, S. M. Piaskowski, J. R. Furlott, J. Reed, S. K. Musani, E. G. Rakasz, et al.
Patterns of CD8+ Immunodominance May Influence the Ability of Mamu-B*08-Positive Macaques To Naturally Control Simian Immunodeficiency Virus SIVmac239 Replication
J. Virol., February 15, 2008; 82(4): 1723 - 1738.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
F. Tzelepis, B. C. G. de Alencar, M. L. O. Penido, C. Claser, A. V. Machado, O. Bruna-Romero, R. T. Gazzinelli, and M. M. Rodrigues
Infection with Trypanosoma cruzi Restricts the Repertoire of Parasite-Specific CD8+ T Cells Leading to Immunodominance
J. Immunol., February 1, 2008; 180(3): 1737 - 1748.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
M. Kwissa, R. R. Amara, H. L. Robinson, B. Moss, S. Alkan, A. Jabbar, F. Villinger, and B. Pulendran
Adjuvanting a DNA vaccine with a TLR9 ligand plus Flt3 ligand results in enhanced cellular immunity against the simian immunodeficiency virus
J. Exp. Med., October 29, 2007; 204(11): 2733 - 2746.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
J. T. Loffredo, B. J. Burwitz, E. G. Rakasz, S. P. Spencer, J. J. Stephany, J. P. Giraldo Vela, S. R. Martin, J. Reed, S. M. Piaskowski, J. Furlott, et al.
The Antiviral Efficacy of Simian Immunodeficiency Virus-Specific CD8+ T Cells Is Unrelated to Epitope Specificity and Is Abrogated by Viral Escape
J. Virol., March 15, 2007; 81(6): 2624 - 2634.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
J. Liu, B. A. Ewald, D. M. Lynch, A. Nanda, S. M. Sumida, and D. H. Barouch
Modulation of DNA Vaccine-Elicited CD8+ T-Lymphocyte Epitope Immunodominance Hierarchies
J. Virol., December 15, 2006; 80(24): 11991 - 11997.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
E. R. Manuel, W. A. Charini, P. Sen, F. W. Peyerl, M. J. Kuroda, J. E. Schmitz, P. Autissier, D. A. Sheeter, B. E. Torbett, and N. L. Letvin
Contribution of T-Cell Receptor Repertoire Breadth to the Dominance of Epitope-Specific CD8+ T-Lymphocyte Responses
J. Virol., December 15, 2006; 80(24): 12032 - 12040.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Newberg, M. H.
Right arrow Articles by Letvin, N. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Newberg, M. H.
Right arrow Articles by Letvin, N. L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS