|
|
||||||||

* Division of Viral Pathogenesis, Department of Medicine, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, MA 02215; and
Tulane National Primate Research Center, Covington, LA 70433
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Although HIV vaccine strategies designed to elicit a high frequency of CD8+ T lymphocytes are being pursued, little attention has been paid to the breadth of these immune responses. Because vaccine-induced CD8+ T lymphocytes mediate control of viremia and therefore slow clinical progression in SIV- or simian human immunodeficiency virus (SHIV)-infected rhesus monkeys (13, 14, 15, 16), investigators are developing vaccine modalities that increase the magnitude of virus-specific CD8+ T lymphocyte responses (17). However, an effective vaccine-elicited CD8+ T lymphocyte response must recognize a diversity of epitopes so as to minimize the impact of individual viral epitope escape mutations. The natural propensity of CD8+ T lymphocytes to focus their recognition of virus on a limited number of dominant epitopes, called immunodominance, presents a substantial obstacle to achieving such a broad cellular response.
An understanding of the mechanisms underlying immunodominance will be needed to allow the development of vaccination strategies for maximizing the breadth of virus-specific CD8+ T lymphocyte responses. Studies have suggested that immunodominance can be a result of the competition between epitope peptides for the Ag-processing machinery of the cell, as well as for MHC binding (18). The repertoire of Ag specificities of the TCRs of the CD8+ T lymphocyte population also may contribute to determining which epitope-specific responses are dominant. Finally, studies have shown that CD8+ T lymphocyte responses specific for immunodominant epitopes may suppress CD8+ T lymphocyte responses specific for subdominant epitopes, a phenomenon referred to as immunodomination (19, 20, 21).
To explore the determinants of epitopic dominance, we investigated whether the evolution of one dominant epitope-specific CD8+ T lymphocyte response influences the evolution of a second dominant response in rhesus monkeys infected with SIV. We identified cohorts of monkeys expressing defined MHC-I molecules and assessed their epitope-specific CD8+ T lymphocyte responses following acute SIV infection.
| Materials and Methods |
|---|
|
|
|---|
All animals used in this study were Indian-origin rhesus monkeys (Macaca mulatta) that were maintained in accordance with the guidelines of the Institutional Animal Care and Use Committee for Harvard Medical School and the Guide for the Care and Use of Laboratory Animals (Institute of Laboratory Animal Resources (U.S.) Committee on Care and Use of Laboratory Animals, 1996). SIVmac251 virus was grown in human PBMCs in vitro, and supernatants from days 314 were pooled and stored at 80°C. The SIVmac251 virus stock had 6.3 x 108 viral copies/ml and
100 ng/ml p27 by ELISA. The monkeys AH88, BF74, BI33, and P503 served as control animals in a lymphocyte depletion study (R. Veazey et al., unpublished observations). These animals received control Ab injections on the day of challenge and on days 3 and 7 after challenge (10, 5, and 5 mg, respectively). Most monkeys were inoculated i.v. with a 1/3000 dilution of SIVmac251 stock in 1 ml of RPMI 1640 medium supplemented with 10% FCS. Monkeys AV52, AW26, and JHB received a 1/100, 1/1,000, and 1/10,000 dilution of SIVmac251, respectively, because they were involved in the titration of the virus stock. Monkey AW26 was not included in the analysis, because it had no measurable T lymphocyte or Ab responses as assessed by the assays used, failed to control viral replication, had a rapid disease progression, and died early (data not shown). Plasma viral RNA levels were measured by the SIV RNA 3.0 bDNA assay using a Quantiplex bDNA System 340 (Bayer), using probes that hybridize to the pol gene of the viral RNA.
Peptides, oligonucleotides, and tetramers
Synthetic peptides were obtained from Quality Control Biochemicals. Peptides included SIVmac251 Tat TL8 (TTPESANL), Gag p11C (CTPYDINQM), Env p54 (TVPWPNASL), Env p15 (CAPPGYALL), Pol p68A (STPPLVRLV), Nef p199RY (YTSGPGIRY), Nef p56 (YTYEAYVRY), and Gag p17G (GSENLKSLY). Oligonucleotides were obtained from BioSource International. Soluble tetrameric complexes containing Mamu-A*01 and either TL8, p11C, p54, p15, or p68A were prepared as described elsewhere (22, 23, 24). To construct soluble tetrameric complexes containing Mamu-A*02 and p199RY, p56, or p17G, an expression plasmid that encoded the extracellular region of Mamu-A*02 linked to a BirA substrate peptide was used (25). The expressed protein was refolded in vitro with human
2-microglobulin in the presence of p199RY, p56, or p17G epitope peptide as described (26). The Mamu-A*02/
2-microglobulin/peptide monomers were purified by gel filtration on a Superdex 200 column (Pharmacia) and biotinylated enzymatically with BirA enzyme (Avidity), following the manufacturers instructions. The efficiency of biotinylation was >80%. A Superdex 200 column was used to remove free biotin from the monomers, and then the biotinlyated monomers were mixed with PE-labeled streptavidin (ProZyme) at a molar ratio of 4:1 and titrated drop-wise to maximize tetramer formation. The Mamu-A*02/peptide-PE tetramers were stored at a concentration of 3040 µg/ml in PBS containing 0.3% BSA, 0.1% sodium azide, and Protease Inhibitor Cocktail Set I (containing 4-(aminoethyl)benzenesulphonyl fluoride, aprotinin, E-64, EDTA, and leupeptin; Calbiochem) at 4°C, and used for staining at 150200 ng/sample.
PCR typing of rhesus monkeys for Mamu-A*01 and Mamu-A*02
DNA was extracted from rhesus monkey PBMCs and amplified using allele-specific primers (27, 28). EDTA-preserved whole blood from monkeys was subjected to Ficoll-diatrizoate density gradient centrifugation to isolate PBMCs, and the washed cell pellets were resuspended in 200 µl of PBS. DNA extraction was then conducted using a QIAamp blood kit (Qiagen). PCR was performed on 500 ng of extracted DNA in a 50-µl reaction consisting of Optimized Buffer B (Invitrogen Life Technologies), 1 mM dNTPs (0.25 mM each), 15 U of AmpliTaq Gold polymerase (Applied Biosystems), and allele-specific primers. The Mamu-A*01-specific primers A*01/F (GACAGCGACGCCGCGAGCCAA) and A*01/R (GCTGCAGCGTCTCCTTCCCC) were each used at a concentration of 0.8 µM. The Mamu-A*02-specific primers A*02/F (GTGGGTGGAGCAGGAGGGTCCA) and A*02/R (CAGCACCTCAGGGTGGCCTCT) were each used at a concentration of 0.8 µM. Primers 5'-MDRB (GCCTCGAGTGTCCCCCCAGCACGT) and 3'-MDRB (GCAAGCTTTCACCTCGCCGCTG) were each used at a concentration of 0.68 µM. The latter primer pair is specific for a conserved MHC class II sequence (based on the rhesus homolog of HLA-DRB3) and was included in the PCR as an internal control. PCR was conducted using a GeneAmp 9600 thermocycler (PerkinElmer). Samples were denatured for 10 min at 96°C, then cycled at 96°C for 25 s and 72°C for 60 s for five cycles; 96°C for 25 s, 65°C for 50 s, and 72°C for 45 s for 21 cycles; and 96°C for 25 s, 55°C for 60 s, and 72°C for 80 s for 4 cycles. Mamu-A*01+ monkeys were identified by the presence of two bands on 2% agarose gels: the expected 260-bp MDRB product and a 685-bp Mamu-A*01-specific product. Mamu-A*02+ monkeys were identified by the presence of the expected 260-bp MDRB product and a 1.3-kb Mamu-A*02-specific product.
Tetramer staining of peptide-specific CD8+ T lymphocytes and flow cytometric analysis
PE-labeled and allophycocyanin-labeled tetrameric complexes were used with FITC-labeled anti-human CD8
(SK1; BD Biosciences) and either PerCP-cyanine 5.5 (PerCP-Cy5.5)-labeled anti-human CD3 (SP34-2; BD Biosciences) or allophycocyanin-labeled anti-rhesus CD3 (FN18; custom conjugated by Beckman Coulter) to stain epitope-specific CD8+ T lymphocytes. One hundred microliters of EDTA-preserved whole blood from rhesus monkeys was incubated, first with PE-labeled tetramer (with or without allophycocyanin-labeled tetramer) for 15 min at room temperature and then with anti-CD8
-FITC and anti-CD3-allophycocyanin (or anti-CD3-PerCP-Cy5.5 if an allophycocyanin-labeled tetramer was used earlier) for 15 min at room temperature. The stained blood was then lysed on an Immunoprep Reagent Q-Prep Workstation (Beckman Coulter), washed with 4 ml of PBS, and fixed in 0.5 ml of PBS containing 1% paraformaldehyde. Samples were analyzed by four-color flow cytometry on a FACSCalibur (BD Biosciences).
ELISPOT analysis
EDTA-preserved whole blood from rhesus monkeys was subjected to Ficoll-diatrizoate density-gradient centrifugation to isolate PBMCs, and cells were then seeded into 96-well plates (Millipore) that had been coated overnight with anti-human IFN-
Ab (B27; BD Pharmingen) at 10 µg/ml in Dulbeccos PBS (Invitrogen Life Technologies). Plates were then washed three times with 0.25% Tween 20 in Dulbeccos PBS. Plates were next blocked for 2 h at 37°C with 5% FCS in Dulbeccos PBS and then washed three times with PBS/Tween and once with RPMI 1640 medium supplemented with 10% FCS. Cells were seeded in RPMI 1640 medium with 10% FCS at a density of 2 x 105 cells per well in triplicate, in the presence of 1 µg/ml peptide, 5 µg/ml PHA-M (Sigma-Aldrich), or medium alone. Plates were then incubated for 18 h at 37°C in a 5% CO2 atmosphere. Plates were washed nine times with PBS/Tween and once with water, and then incubated in the presence of 2 µg/ml biotinylated rabbit polyclonal anti-human IFN-
antiserum (BioSource International) for 2 h at room temperature. Plates were then washed again and incubated with streptavidin-alkaline phosphatase (Southern Biotechnology) for 2 h at room temperature. After a final rinse, a chromogenic substrate was added (1-Step NBT/BCIP; Pierce). After 1015 min, plates were washed thoroughly with water and air-dried. Spots were counted on an imaging system (Hitech Instruments; Image Processing Solutions) using IMAGE-PRO PLUS image processing software (Media Cybernetics).
Sequencing the SIV Nef p199RY epitope in viral RNA in plasma
EDTA-preserved whole blood from Mamu-A*02+ rhesus monkeys sampled 35 days after infection was subjected to Ficoll-diatrizoate density-gradient centrifugation to obtain cell-free plasma. Viral RNA was extracted from plasma using the QIAamp Viral RNA Mini kit (Qiagen). Reverse transcription-PCR was performed on each RNA sample using the Qiagen One-Step RT-PCR kit and primers 9211-F (CAGCAACTGCAGAACCTTG) and 10203-R (ATCAAGAAAGTGGGCGTT) to amplify a 1-kb sequence of cDNA containing the entire nef gene (24, 29). Samples were incubated at 50°C for 30 min, denatured at 95°C for 15 min, and then cycled at 95°C for 30 s, 59°C for 30 s, and 72°C for 60 s for 40 cycles; and then extended at 72°C for 10 min. Each PCR product was ligated into pGEM-T Easy Vector (Promega) and then transformed into competent JM109 cells (Promega), according to the manufacturers instructions. Transformed cells were grown on blue-white plates containing imMedia Amp Agar (Invitrogen Life Technologies), 0.5 mM IPTG (Promega), and 80 µg/ml X-Gal (Promega), and white colonies were selected for sequencing. DNA was extracted using QIAprep Miniprep kit (Qiagen), and sequenced using primers 9536-F (TCCATGGAGAAACCCAGCT) and 10203-R. Approximately 10 clones were sequenced from each plasma sample.
Statistical analyses
Pair-wise comparisons of data from the three cohorts of monkeys were performed using the Wilcoxon rank sum test, using statistical software S-PLUS 6.1 (Insightful). The area under the curve (AUC) for viral load vs time (days 035 and 3570, following infection) was estimated using the trapezoidal method.
| Results |
|---|
|
|
|---|
We initiated studies to define the evolution of immunodominant and subdominant epitope-specific CD8+ T lymphocyte responses in rhesus monkeys during primary SIV infection. Four naive Mamu-A*01+ rhesus monkeys were infected with SIVmac251, and their blood was sampled at weekly intervals for 10 wk to evaluate the development of Mamu-A*01-restricted, SIV epitope-specific CD8+ T lymphocyte responses. Peripheral blood was stained with soluble tetramers constructed with Mamu-A*01 and one of the following well-described SIV epitope peptides: the immunodominant Tat TL8 (TTPESANL) or Gag p11C (CTPYDINQM); or the subdominant Env p54 (TVPWPNASL), Env p15 (CAPPGYALL), or Pol p68A (STPPLVRLV) (23, 24, 30, 31, 32, 33, 34). Gating on CD8+CD3+ lymphocytes, tetramer-binding cells were readily detected in all four SIVmac-infected monkeys by 2 wk postinfection (Fig. 1). Tat TL8-specific CD8+ T lymphocyte responses were measurable by 2 wk after infection, peaked by 2 or 3 wk, and then rapidly declined. This decline occurred in temporal coincidence with the emergence of the early viral escape mutations that uniformly emerge in this viral epitope (24). However, the evolution of Gag p11C-specific CD8+ T lymphocyte responses were less consistent. In monkey AH88, the Gag p11C-specific response rose quickly but then fell sharply before gradually rising again during the acute infection period. In monkey BF74, the Gag p11C-specific response rose more gradually, peaking at 4 wk postinfection, and then declined. The Gag p11C-specific response in monkey BI33 was bimodal, like that in AH88, and had a delayed first peak relative to the Tat TL8-specific response, like that in BF74. In monkey P503, the Gag p11C-specific response had a very slow initial rise, and although it was easily detectable at 2 wk postinfection, it was still increasing 10 wk after infection.
|
CD8+ T lymphocyte responses specific for epitopes of early, nonstructural SIV gene products do not develop more rapidly than those specific for late, structural gene products
To distinguish whether the kinetics of an SIV epitope-specific CD8+ T lymphocyte response was associated with the time at which the gene encoding the epitope is expressed, or rather by the relative immunodominance of the CD8+ T lymphocyte response, we evaluated SIV epitope-specific responses during primary virus infection in naive Mamu-A*02+ rhesus monkeys. We and others have previously identified an immunodominant Mamu-A*02-restricted SIV Nef epitope, p199RY (YTSGPGIRY), as well as two subdominant epitopes, Nef p56 (YTYEAYVRY) and Gag p17G (GSENLKSLY) (25 , 26 , 29 , 35 , and 36 and our unpublished observations). If CD8+ T lymphocyte epitopes of early nonstructural gene products induce rapid T lymphocyte responses and epitopes of late structural gene products induce delayed responses, the Nef p199RY- and p56-specific responses should peak rapidly, and the peak of the Gag p17G-specific response should be delayed. In contrast, if the kinetics of epitope-specific CD8+ T lymphocyte responses is a function of their relative dominance, the Nef p199RY-specific response should peak early, and the peaks of the Nef p56- and Gag p17G-specific responses should be delayed.
Five naive Mamu-A*01Mamu-A*02+ rhesus macaques were infected with SIVmac251, and their blood was evaluated one to two times weekly for 10 wk to assess the development of Mamu-A*02-restricted, SIV epitope-specific CD8+ T lymphocyte responses. In addition to tetramer staining of whole blood, PBMCs were stimulated with the optimal peptide epitopes, and epitope-specific functional responses were assessed by IFN-
ELISPOT assay. Mamu-A*02/Nef p199RY tetramer-binding CD8+ T cells were readily detected in all five SIVmac-infected monkeys by 2 or 3 wk postinfection and were maximal by 3 or 4 wk postinfection (Fig. 2A). Both Nef p56- and Gag p17G-specific responses were detected much later and reached their peaks much later than did the Nef p199RY-specific responses (Fig. 2A and data not shown). The kinetics of the epitope-specific ELISPOT responses was similar (Fig. 2B and data not shown). These findings suggest that CD8+ T lymphocyte responses specific for epitopes encoded by late structural genes are not necessarily delayed relative to those responses specific for epitopes encoded by early nonstructural genes.
|
One of the mechanisms postulated to explain the maintenance of the immunodominance hierarchies of epitope-specific CD8+ T lymphocyte responses is that certain epitope-specific T lymphocyte responses are suppressed by the presence of more dominant T lymphocyte responses specific for other epitopes. To determine whether this phenomenon, referred to as immunodomination, might account for the kinetics of epitope-specific CD8+ T lymphocyte responses in SIV-infected rhesus monkeys, we evaluated the evolution of the CD8+ T lymphocyte response specific for the Mamu-A*02-restricted SIV epitope Nef p199RY in the presence of CD8+ T lymphocyte responses specific for the highly dominant Mamu-A*01-restricted SIV epitopes Tat TL8 and Gag p11C.
To select experimental animals for this study, we screened
400 Indian-origin rhesus monkeys from the Tulane National Primate Research Center for the presence of Mamu-A*01 and Mamu-A*02 genes using a PCR-based technique. The frequencies of the Mamu-A*01 and Mamu-A*02 genes in this monkey colony were 21 and 25%, respectively, and the frequency of double positives was 4.3% (data not shown). Five naive Mamu-A*01+Mamu-A*02+ rhesus monkeys were infected with SIVmac251, and their blood was monitored one to two times weekly for 10 wk to evaluate the development of Mamu-A*01- and Mamu-A*02-restricted, SIV epitope-specific CD8+ T lymphocyte responses. Mamu-A*01-restricted CD8+ T lymphocyte responses specific for the immunodominant epitopes Tat TL8 and Gag p11C were detected by day 17 postinfection in all Mamu-A*01+Mamu-A*02+ monkeys using both tetramer staining (Figs. 3A and 4A) and ELISPOT assays (Figs. 3B and 4B), similar to the kinetics of these responses observed in Mamu-A*01+Mamu-A*02 monkeys. The first peak of these immunodominant Mamu-A*01-restricted responses also was early in the Mamu-A*01+Mamu-A*02+ monkeys, with a median of 17 and 21 days from infection until the first peak of staining with the Gag p11C or Tat TL8 tetramers, respectively, consistent with what was seen in the Mamu-A*01+Mamu-A*02 monkeys (Figs. 3A and 4C). In four of the five Mamu-A*01+Mamu-A*02+ monkeys, the early Gag p11C-specific CD8+ T lymphocyte response peak was followed by a transient fall, and then a subsequent rise over the following weeks.
|
|
The kinetics of SIVmac replication is similar in the different groups of monkeys
The observation that the first peak of Nef p199RY-specific T lymphocyte responses was delayed in Mamu-A*02+ monkeys that also expressed Mamu-A*01 might be explained by a suppression of these responses by the immunodominant Mamu-A*01-restricted responses to Gag p11C and Tat TL8. However, other explanations for this phenomenon are possible. There may have been less virus replication in the Mamu-A*01+Mamu-A*02+ monkeys than in the Mamu-A*01Mamu-A*02+ monkeys and therefore less antigenic stimulation of epitope-specific CD8+ T lymphocyte responses in these animals. In fact, a number of studies have shown better control of SIV replication in rhesus monkeys that express Mamu-A*01 than in Mamu-A*01 monkeys (37, 38, 39, 40, 41). To explore this possibility, plasma virus RNA levels were assessed over time in all of the experimental animals (Fig. 5, AC). The time to peak viremia was comparable among the groups of monkeys, with no significant differences between any pair of groups as determined by the Wilcoxon rank sum test (Fig. 5D). The magnitudes of peak viremia were also comparable among the groups of monkeys (Fig. 5E). Furthermore, the viral loads at day 35 postinfection (when the Nef p199RY-specific responses peaked in Mamu-A*01+Mamu-A*02+ monkeys) and at day 70 postinfection (at viral load set-point), as well as the decreases in viral loads from the peak to days 35 and 70 were not significantly different between any pair of groups (statistics not shown). We also analyzed the AUC for viral load vs time from days 0 to 35 (Fig. 5F) and from days 35 to 70 (statistics not shown) following the infection of each monkey. The medians of the AUCs for each group of monkeys were not significantly different. Thus, differences between groups of monkeys in SIVmac replication kinetics did not account for the differences in the kinetics of the CD8+ T lymphocyte responses specific for Nef p199RY.
|
Another potential explanation for the delay in the peak of Nef p199RY-specific CD8+ T lymphocyte responses in Mamu-A*01+Mamu-A*02+ monkeys is that an increase in the frequency of mutations in the Nef p199RY epitope in these animals may have led to a decrease in the antigenic stimulation of the Nef p199RY-specific CD8+ T lymphocytes. To assess this possibility, we sequenced a 670-bp region from the nef gene of the viruses in the plasma of the Mamu-A*02+ monkeys at 35 days postinfection. We sequenced
10 individual clones from each monkey and compared them to 12 sequenced clones from the challenge stock of SIVmac251 used to infect the animals. The sequences encoded the C-terminal two-thirds of the Nef protein, including the p199RY epitope. Of the
170 aa outside the p199RY epitope, there was, on average, fewer than 1 nonsynonymous mutation per clone (data not shown). However, there were numerous nonsynonymous mutations in the sequence encoding the p199RY epitope, or the 12 aa adjacent to it (Fig. 6). These mutations certainly could affect epitope peptide processing and presentation. In the Mamu-A*01Mamu-A*02+ monkeys, 78100% of the virus in each monkey had mutations in the Nef p199RY epitope (96% overall), and 26% of those mutations were in the residues of the peptide that are most important for binding to Mamu-A*02 (positions 2 and 9) (35, 36). In the Mamu-A*01+Mamu-A*02+ monkeys, 091% of the virus in each monkey had mutations in the Nef p199RY epitope (40% overall), and none of those mutations was in the anchor residues. The mutation frequency in the Nef p199RY epitope in individual monkeys was not associated positively or negatively with their viral loads. The observation that there were fewer mutations in the Nef p199RY epitope of the virus found in Mamu-A*02+ monkeys that also express Mamu-A*01 could not explain why those animals had delayed peak Nef p199RY-specific T lymphocyte responses. Rather, the delay in the maximal Nef p199RY-specific CD8+ T lymphocyte responses could have delayed the generation of the immune pressure that selected for these mutations and thus could account for the delay in the emergence of Nef p199RY escape mutations.
|
| Discussion |
|---|
|
|
|---|
Immunodomination also may account for perturbations in the kinetics of the Gag p11C-specific CD8+ T lymphocyte responses observed in the present study. In the Mamu-A*01+Mamu-A*02 rhesus monkeys, the peaks of the Gag p11C-specific responses were delayed relative to those of the Tat TL8-specific responses in three of four animals. This result is consistent with a suppression of the early Gag p11C-specific responses by the Tat TL8-specific responses and a later rise in the Gag p11C-specific responses as the Tat TL8-specific responses decrease in association with the development of Tat TL8 epitope escape mutations (24). In the one animal in the present study with an early peak Gag p11C-specific response (AH88), there was a sharp decrease in the magnitude of the response after the peak, with a subsequent gradual rise throughout the remainder of the period of acute infection. This early decrease in the Gag p11C-specific CD8+ T lymphocyte population is consistent with a transient suppression of this response by the Tat TL8-specific response.
In the Mamu-A*01+Mamu-A*02+ rhesus monkeys, the Gag p11C-specific CD8+ T lymphocyte responses had bimodal kinetics in four of five animals, and the initial peak responses were small in magnitude relative to the Tat TL8- and Nef p199RY-specific responses. This suggests that the Gag p11C-specific CD8+ T lymphocyte responses were suppressed to a greater extent by the immunodominant Tat TL8- and Nef p199RY-specific responses together than by the Tat TL8-specific responses alone, a finding consistent with the possibility that immunodomination can be an additive phenomenon. Furthermore, the reciprocal suppression of Gag p11C- and Nef p199RY-specific responses suggests that immunodomination can be bidirectional.
The suppression of subdominant epitope-specific CD8+ T lymphocyte responses by immunodominant epitope-specific CD8+ T lymphocyte responses has been described in inbred mice. In murine studies, elimination of an immunodominant epitope-specific CD8+ T lymphocyte response has led to the enhancement of a subdominant epitope-specific CD8+ T lymphocyte response. Such an enhancement of subdominant responses has been shown in situations where the immunodominant epitope-specific CD8+ T lymphocyte response was circumvented by infecting with an immunodominant epitope-negative viral variant (20), by infecting knockout mice lacking the MHC-I molecule that presents the immunodominant epitope (21) or by deleting immunodominant epitope-specific CD8+ T lymphocytes by expressing the immunodominant epitope in the thymus as a transgene (19).
The mechanism underlying immunodomination is unknown. Several groups have shown that immunodomination could be overcome in mice if large numbers of Ag-pulsed dendritic cells were used for immunization, suggesting that immunodomination reflects, at least in part, a competition between CD8+ T lymphocytes for limiting numbers of APCs (42, 43). CD8+ T lymphocytes that successfully compete for Ag-pulsed APCs have been shown to have a particularly high affinity for Ag (44). However, the means by which high-affinity CD8+ T lymphocytes might prevent other CD8+ T lymphocytes from having a functional interaction with APCs is unclear. The lysis of either APCs or subdominant epitope-specific CD8+ T lymphocytes by an immunodominant CTL response could prevent additional CTL responses, but that does not appear to occur (44, 45, 46, 47). Immunodomination has been attenuated in one mouse model by IL-12 (48) and blocked in another by anti-TGF-
Abs (49, 50, 51), implicating cytokines in the phenomenon. Whether the same processes contribute to the suppression of the dominant epitope-specific CD8+ T lymphocyte responses that have been demonstrated during the acute viral infection of primates in this study remains to be determined.
Until now, there has been only limited evidence for a role for immunodomination in determining viral epitope immunodominance hierarchies in infections of species other than mice. These studies have examined chronic viral infections in humans. Höllsberg (52) examined the CD8+ T lymphocyte responses to EBV epitopes presented by HLA-A*02 and HLA-B*07 in healthy humans who were chronically infected with EBV. HLA-A*02-restricted epitope-specific ELISPOT responses were cumulatively reduced in individuals who also expressed HLA-B*07, although the reductions of individual epitope-specific responses were not statistically significant. In a cohort of nine EBV-infected, HLA-A*02+HLA-B*07+ individuals, one had a strong CD8+ T lymphocyte response directed against the immunodominant HLA-A*02-restricted epitope, and seven had strong responses to the immunodominant HLA-B*07-restricted epitope; however, no individuals had strong responses to both epitopes. Lacey et al. (53) studied the CD8+ T lymphocyte responses to immunodominant CMV epitopes presented by HLA-A*02 and HLA-B*07 in chronically infected individuals. Using tetramer staining, the authors showed that CD8+ T lymphocyte responses directed against an HLA-A*02-restricted epitope were dominant in HLA-A*02+HLA-B*07 individuals but weak or absent in HLA-A*02+HLA-B*07+ individuals. Instead, these HLA-A*02+HLA-B*07+ individuals had strong CD8+ T lymphocyte responses directed only against the immunodominant HLA-B*07-restricted epitope. These two studies support the idea that immunodomination operates in outbred species.
The results of the present study indicate that immunodomination occurs during the acute infection of rhesus monkeys with SIV, and is critical in determining the kinetics of epitope-specific CD8+ T lymphocyte responses. We have demonstrated that dominant epitope-specific CD8+ T lymphocyte responses suppress other dominant responses, as well as subdominant responses. The data also suggest that dominant CD8+ T lymphocyte responses can reciprocally suppress one another, and that suppression by multiple dominant CD8+ T lymphocyte responses may be more efficient than that by single dominant CD8+ T lymphocyte responses and may therefore be additive. It will be important to explore the mechanisms underlying this immunodomination and how they can be manipulated to optimize virus-specific CD8+ T lymphocyte responses in the setting of vaccination and infection.
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported by U.S. Public Health Service Grants AI060380-02 (to M.H.N.), AI59080 (to R.S.V.), AI48394 (to J.E.S.), and AI20729 (to N.L.L.) from the National Institute for Allergy and Infectious Diseases. ![]()
2 Address correspondence and reprint requests to Dr. Norman L. Letvin, Division of Viral Pathogenesis, Department of Medicine, Beth Israel Deaconess Medical Center, Harvard Medical School, Research East Room 113, 330 Brookline Avenue, Boston, MA 02215. E-mail address: nletvin{at}bidmc.harvard.edu ![]()
3 Abbreviations used in this paper: MHC-I, MHC class I; AUC, area under the curve. ![]()
Received for publication August 4, 2005. Accepted for publication October 21, 2005.
| References |
|---|
|
|
|---|
2M tetramers to quantitate CD8+ cytotoxic T lymphocytes specific for dominant and nondominant viral epitopes in simian-human immunodeficiency virus-infected rhesus monkeys. J. Virol. 73: 5466-5472.
and suppresses cytolytic T cell responses to unrelated alloantigens. J. Exp. Med. 178: 841-852.
prevent primary cytolytic T lymphocyte responses. Int. Immunol. 10: 355-363. This article has been cited by other articles:
![]() |
E. R. Manuel, W. W. Yeh, M. S. Seaman, K. Furr, M. A. Lifton, S. L. Hulot, P. Autissier, and N. L. Letvin Dominant CD8+ T-Lymphocyte Responses Suppress Expansion of Vaccine-Elicited Subdominant T Lymphocytes in Rhesus Monkeys Challenged with Pathogenic Simian-Human Immunodeficiency Virus J. Virol., October 1, 2009; 83(19): 10028 - 10035. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. A. Colleton, X.-L. Huang, N. M. Melhem, Z. Fan, L. Borowski, G. Rappocciolo, and C. R. Rinaldo Primary Human Immunodeficiency Virus Type 1-Specific CD8+ T-Cell Responses Induced by Myeloid Dendritic Cells J. Virol., June 15, 2009; 83(12): 6288 - 6299. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. L. Turnbull, M. Wong, S. Wang, X. Wei, N. A. Jones, K. E. Conrod, D. Aldam, J. Turner, P. Pellegrino, B. F. Keele, et al. Kinetics of Expansion of Epitope-Specific T Cell Responses during Primary HIV-1 Infection J. Immunol., June 1, 2009; 182(11): 7131 - 7145. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. Permar, H. H. Kang, A. Carville, K. G. Mansfield, R. S. Gelman, S. S. Rao, J. B. Whitney, and N. L. Letvin Potent Simian Immunodeficiency Virus-Specific Cellular Immune Responses in the Breast Milk of Simian Immunodeficiency Virus-Infected, Lactating Rhesus Monkeys J. Immunol., September 1, 2008; 181(5): 3643 - 3650. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. T. Loffredo, A. T. Bean, D. R. Beal, E. J. Leon, G. E. May, S. M. Piaskowski, J. R. Furlott, J. Reed, S. K. Musani, E. G. Rakasz, et al. Patterns of CD8+ Immunodominance May Influence the Ability of Mamu-B*08-Positive Macaques To Naturally Control Simian Immunodeficiency Virus SIVmac239 Replication J. Virol., February 15, 2008; 82(4): 1723 - 1738. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Tzelepis, B. C. G. de Alencar, M. L. O. Penido, C. Claser, A. V. Machado, O. Bruna-Romero, R. T. Gazzinelli, and M. M. Rodrigues Infection with Trypanosoma cruzi Restricts the Repertoire of Parasite-Specific CD8+ T Cells Leading to Immunodominance J. Immunol., February 1, 2008; 180(3): 1737 - 1748. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kwissa, R. R. Amara, H. L. Robinson, B. Moss, S. Alkan, A. Jabbar, F. Villinger, and B. Pulendran Adjuvanting a DNA vaccine with a TLR9 ligand plus Flt3 ligand results in enhanced cellular immunity against the simian immunodeficiency virus J. Exp. Med., October 29, 2007; 204(11): 2733 - 2746. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. T. Loffredo, B. J. Burwitz, E. G. Rakasz, S. P. Spencer, J. J. Stephany, J. P. Giraldo Vela, S. R. Martin, J. Reed, S. M. Piaskowski, J. Furlott, et al. The Antiviral Efficacy of Simian Immunodeficiency Virus-Specific CD8+ T Cells Is Unrelated to Epitope Specificity and Is Abrogated by Viral Escape J. Virol., March 15, 2007; 81(6): 2624 - 2634. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Liu, B. A. Ewald, D. M. Lynch, A. Nanda, S. M. Sumida, and D. H. Barouch Modulation of DNA Vaccine-Elicited CD8+ T-Lymphocyte Epitope Immunodominance Hierarchies J. Virol., December 15, 2006; 80(24): 11991 - 11997. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. R. Manuel, W. A. Charini, P. Sen, F. W. Peyerl, M. J. Kuroda, J. E. Schmitz, P. Autissier, D. A. Sheeter, B. E. Torbett, and N. L. Letvin Contribution of T-Cell Receptor Repertoire Breadth to the Dominance of Epitope-Specific CD8+ T-Lymphocyte Responses J. Virol., December 15, 2006; 80(24): 12032 - 12040. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |