The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow A correction has been published
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Graham, D. B.
Right arrow Articles by McKean, D. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Graham, D. B.
Right arrow Articles by McKean, D. J.
The Journal of Immunology, 2006, 176: 291-300.
Copyright © 2006 by The American Association of Immunologists

Ly9 (CD229)-Deficient Mice Exhibit T Cell Defects yet Do Not Share Several Phenotypic Characteristics Associated with SLAM- and SAP-Deficient Mice1

Daniel B. Graham2,*, Michael P. Bell*, Megan M. McCausland§, Catherine J. Huntoon*, Jan van Deursen{dagger}, William A. Faubion{ddagger}, Shane Crotty§ and David J. McKean3,*

* Department of Immunology, {dagger} Department of Pediatric and Adolescent Medicine, and {ddagger} Department of Gastroenterology, Mayo Clinic College of Medicine, Rochester, MN 55905; and § Division of Vaccine Discovery, La Jolla Institute for Allergy and Immunology, San Diego, CA 92121


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Signaling lymphocyte activation molecule (SLAM) family receptors are critically involved in modulating innate and adaptive immune responses. Several SLAM family receptors have been shown to interact with the adaptor molecule SAP; however, subsequent intracellular signaling is poorly defined. Notably, mutations in SLAM-associated protein (SAP) lead to X-linked lymphoproliferative disease, a rare but fatal immunodeficiency. Although the SLAM family member Ly9 (CD229) is known to interact with SAP, the functions of this receptor have remained elusive. Therefore, we have generated Ly9–/– mice and compared their phenotype with that of SLAM–/– and SAP–/– mice. We report that Ly9–/– T cells exhibit a mild Th2 defect associated with reduced IL-4 production after stimulation with anti-TCR and anti-CD28 in vitro. This defect is similar in magnitude to the previously reported Th2 defect in SLAM–/– mice but is more subtle than that observed in SAP–/– mice. In contrast to SLAM–/– and SAP–/– mice, T cells from Ly9–/– mice proliferate poorly and produce little IL-2 after suboptimal stimulation with anti-CD3 in vitro. We have also found that Ly9–/– macrophages exhibit no defects in cytokine production or bacterial killing as was observed in SLAM–/– macrophages. Additionally, Ly9–/– mice differ from SAP–/– mice in that they foster normal development of NKT cells and mount appropriate T and B cell responses to lymphocytic choriomeningitis virus. We have identified significant phenotypic differences between Ly-9–/– mice as compared with both SLAM–/– and SAP–/– mice. Although Ly9, SLAM, and SAP play a common role in promoting Th2 polarization, Ly-9 is uniquely involved in enhancing T cell activation.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The signaling lymphocyte activation molecule (SLAM)4 family of immunomodulatory receptors is comprised of SLAM (CD150, IPO-3, Slamf1), Ly9 (CD229, Slamf3), 2B4 (CD244, NAIL, C9.1, Slamf4), Ly108 (SF2000, NTB-A, Slamf6), CS-1 (CRACC, 19A, nLy9, Slamf7), and CD2F10 (SF2001, CD84-H1, Slamf9). Like SLAM, Ly9 is reported to be a homophilic receptor with broad expression throughout the hemopoietic system (Refs.1 and 2 and D. B. Graham, M. P. Bell, C. J. Huntoon, and D. J. McKean, submitted for publication). Ly9 expression has been confirmed in T cells, B cells, macrophages, dendritic cells, and granulocytes (our unpublished observations). All of the SLAM family receptors contain tandem IgV and IgC2 sets in their extracellular domains and several contain immune receptor tyrosine based switch motifs (ITSMs)in their cytoplasmic tails. These ITSMs contain the amino acid sequence TxYxxV/I, which comprises a consensus sequence for the Src homology 2 domains of the adaptor molecules SLAM-associated protein (SAP) and Eat-2. Ly9 contains two pairs of IgV IgC2 sets in its extracellular domain and two ITSMs in its cytoplasmic tail. We and others have previously shown that Ly9 can interact with both SAP and Eat-2, although the functional relevance of Ly9 signaling has remained unclear (Refs.3 and 4 and D. B. Graham, M. P. Bell, C. J. Huntoon, and D. J. McKean, submitted for publication).

SAP signaling downstream of SLAM has been extensively studied in the context of T cell activation. As an adaptor molecule, SAP bridges SLAM to the Src family kinase Fyn, which regulates protein kinase C{theta}-dependent NF-{kappa}B activation (5, 6). The importance of this SAP signaling cascade was illustrated when mutations in SAP were found to cause X-linked lymphoproliferative (XLP) disease in humans (7, 8, 9). This fatal immunodeficiency is characterized by fulminant infectious mononucleosis, dysgammaglobulinemia, and/or lymphoproliferative disorders (6). Several aspects of human XLP disease are mimicked in SAP–/– mice, particularly susceptibility to viral infections. Lymphocytic choriomeningitis virus (LCMV) infection in SAP–/– mice results in an exaggerated acute response associated with lymphoproliferation and increased numbers of LCMV-specific CD4 and CD8 T cells secreting large quantities of IFN-{gamma} (10, 11, 12). Interestingly, B cell responses to LCMV are severely compromised in SAP–/– mice, and this defect is dependent on lack of help from CD4 T cells (10). Specifically, SAP–/– mice produce few germinal center B cells, long-lived plasma cells, and LCMV-specific memory B cells (10). A severe defect in B cell memory has also been observed in human XLP patients (13, 14) and is consistent with the hypogammaglobulinemia observed in these patients (6, 15).

As was observed in LCMV-infected mice, CD4 T cells from uninfected SAP–/– mice produce abnormally large quantities of IFN-{gamma} after stimulation in vitro with anti-TCR and anti-CD28 or Ag-pulsed APCs (11, 12). Upon further investigation, SAP–/– CD4 T cells show a strong skewing toward Th1 responses and defects in the production of Th2 cytokines such as IL-4, IL-10, and IL-13 (11, 12). In addition to CD4 T cells, NKT cells contribute to Th1/Th2 polarization by producing large quantities of polarizing cytokines (IFN-{gamma} or IL-4) early in immune responses. Interestingly, SAP–/– mice have virtually no NKT cells, which may exacerbate the observed Th2 defect or impart distinct immunologic defects (16, 17, 18). Also consistent with a Th2 defect is the observation that class switching to IgE is defective in SAP–/– mice, which emphasizes that this T cell defect directly impacts B cell responses (12). Put into context, Th2 responses are very relevant to host defense. Accordingly, SAP–/– mice are more effective at mounting protective Th1 responses to leishmania than their wild-type counterparts (11).

Consistent with the notion that some SLAM signaling is transduced through SAP, the SLAM knockout phenotype resembles several aspects of SAP deficiency in humans. Purified CD4 T cells from SLAM–/– mice produce very little IL-4 and slightly elevated levels of IFN-{gamma} after stimulation with anti-TCR and anti-CD28 or Ag-pulsed APCs in vitro (19). This Th2 defect is much less severe in SLAM–/– mice compared with SAP–/– mice, presumably because additional SLAM family members that signal through SAP are still functional. It was expected that the Th1 skewing observed in SLAM–/– mice would protect them from infection with leishmania, as was observed in SAP–/– mice. Surprisingly, SLAM–/– mice were more susceptible to leishmaniasis than control mice (19). Closer examination revealed that SLAM–/– mice have a SAP-independent macrophage defect that accounts for their inability to control leishmania. Macrophages from SLAM–/– mice produce unusually large quantities of IL-6 and significantly less TNF-{alpha}, IL-12, and NO in response to LPS (19).

Taken together, the SLAM knockout phenotype cannot be explained entirely by disrupted SAP signaling. Furthermore, the SAP knockout phenotype cannot be explained entirely by disrupted signaling downstream of SLAM. Therefore, additional SLAM family receptors must regulate SAP signaling. Because Ly9 resembles SLAM in structure and interacts with SAP, we have generated Ly9–/– mice to address these issues.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Abs and reagents

Fluorescently conjugated Abs specific for CD8 (53-6.7), CD4 (H129.19), CD19 (1D3), CD28 (37.51), CD11c (HL3), IL-4 (11B11), IFN-{gamma} (XMG1.2), Fas (Jo2), B220 (RA3-6B2), CD138, TNF-{alpha}, IFN-{gamma}, and TCR{beta} (H57-597) were purchased from BD Pharmingen or eBioscience. Goat anti-rat IgG, goat anti-rabbit IgG, and streptavidin-HRP were also obtained from BD Pharmingen. Biotinylated anti-IgD was purchased from eBioscience. Polyclonal antisera specific for Ly9 was collected from rabbits that had been immunized with His-tagged Ly9 extracellular domain or Ly9 cytoplasmic tail produced in Escherichia coli. Anti-CD3 (145-2C11) and anti TCR{beta} (H57-597) were purified from hybridoma culture supernatant. CD1d tetramers were generously provided by M. Kronenberg (La Jolla Institute for Allergy and Immunology, San Diego, CA). MHC class I tetramer of Db loaded with LCMV gp33–41 was provided by Dr. H. Cheroutre (La Jolla Institute for Allergy and Immunology).

Generation of Ly9–/– mice

A murine genomic library packaged in {lambda} phage was screened for clones containing the full-length Ly9 gene. A positive clone was used as a template to amplify portions of the Ly9 gene by PCR. The 5' arm was flanked by HpaI restriction sites and contained exon 1 and part of exon 2. The 3' arm was flanked by SmaI restriction sites and contained exons 3 and 4. The 5' and 3' arms were then cloned into the pKO Scrambler targeting vector (Stratagene) flanking a neomycin resistance gene. The targeting vector was then introduced into 129/SvEES cells by homologous recombination, and clones containing the mutant Ly9 allele were screened by Southern blot using a probe complementary to exon 5. A positive embryonic stem cell clone was injected into blastocysts derived from C57BL/6 mice and implanted into pseudopregnant surrogate mothers to generate chimeric mice. These chimeras were subsequently bred with C57BL/6 mice to generate mice heterozygous for the mutated Ly9 allele. F1 heterozygotes were used as breeding stock to generate homozygous Ly9 mutants. All mice were genotyped by PCR. All procedures involving mice were approved by the Institutional Animal Care and use Committees at the Mayo Clinic College of Medicine and the La Jolla Institute for Allergy and Immunology.

FACS analysis

Cell surface staining was performed according to standard procedures. All samples were subsequently analyzed on a FACScan flow cytometer with CellQuest software (BD Biosciences) (see Figs. 2–5) or acquired on a FACSCalibur and analyzed with FlowJo (see Figs. 6 and 7).



View larger version (42K):
[in this window]
[in a new window]
 
FIGURE 2. T cell activation in Ly9–/– mice. A, Thymus and spleen tissues were harvested from mice and stained with the indicated Abs before FACS analysis. B, Splenocytes were stimulated with varying concentrations of anti-CD3 (2C11) for 48 h and labeled with [3H]thymidine for an additional 20 h. Splenocytes from three wild-type and three Ly9–/– mice were analyzed in triplicate (n = 2). C, Splenocytes from three Ly9–/– mice and three littermates were stimulated with anti-CD3 (3 µg/ml) as described in A. After 24 or 48 h, IL-2 was measured by ELISA (n = 3).

 


View larger version (35K):
[in this window]
[in a new window]
 
FIGURE 3. Mild Th2 defect in Ly9–/– mice. A, CD4 T splenic cells were cultured in control, Th1, or Th2 polarizing conditions and then stimulated for 3 days with plate-bound anti-TCR and anti-CD28. After the initial 3-day culture, cells were washed and restimulated overnight with anti-TCR and anti-CD28. The following day, cells were analyzed for intracellular IL-4 and IFN-{gamma} expression. Each sample consisted of T cells pooled from four Ly9–/– mice or four wild-type littermates (n = 4). B, T cells were treated as in A. Cytokines present in supernatant from overnight restimulation cultures were quantified by ELISA. Four pairs of Ly9–/– and wild-type littermates were analyzed in this experiment (n = 4). C, CD4 T cells from four Ly9–/– or four wild-type littermates were stimulated with plate-bound anti-TCR (0.5 µg/ml) and anti-CD28 (5 µg/ml) for 2 days. Subsequently, RNA was isolated from the cells for analysis of GATA3 and T-bet expression by quantitative RT-PCR. The values plotted are arbitrary units relative to GAPDH expression (n = 4). D, Serum was collected from unimmunized mice (6–12 wk old), and IgE was quantified by ELISA (n = 4).

 


View larger version (19K):
[in this window]
[in a new window]
 
FIGURE 4. Normal macrophage function in Ly9–/– mice. A, Thioglycolate elicited macrophages were harvested by peritoneal lavage and adhered to tissue culture plates overnight. The next day, F18 E. coli were cultured with the macrophages for 1 h, free bacteria were washed away, and medium containing gentamicin was added to the macrophages to kill residual extracellular bacteria but spare intracellular bacteria that had been phagocytosed. Macrophages were then cultured for an additional 1 or 5 h, at which point the cells were lysed. Lysates were subsequently plated on Laurie broth agar and cultured overnight to quantify bacterial CFU. Four Ly9–/– mice and four wild-type littermates were used in this experiment (n = 4). B, Peritoneal macrophages were harvested and cultured under the indicated stimulation conditions. After 3 days, culture supernatants were collected and analyzed by ELISA for IL-6 and IL-12. Untx, Untreated. Four Ly9–/– and four littermates were analyzed (n = 1).

 


View larger version (39K):
[in this window]
[in a new window]
 
FIGURE 5. Normal development of NKT cells in Ly9–/– mice. Thymocytes (A) and splenocytes (B) were stained with anti-TCR{beta} and CD1d {alpha}GalCer tetramers to detect NKT cells by FACS. Unloaded (empty) CD1d tetramers were used as a staining control. Data shown are representative of one of four total Ly9–/– mice analyzed.

 


View larger version (31K):
[in this window]
[in a new window]
 
FIGURE 6. B cell responses to LCMV in Ly9–/– mice. A, Splenic germinal center B cells (B220+, IgD, Fashigh, PNA+) were quantified by FACS at both day 8 postinfection and day 15 (the peak of the anti-LCMV germinal center response). Cells shown are gated B220+IgD B cells (p >> 0.05). B, Total plasma cells (CD138+, B220low) from the spleen were quantified by FACS (gated on total splenocytes) at the peak of the acute response (day 8 postinfection) (p >> 0.05). LCMV-specific IgG+ plasma cells were quantified by ELISPOT at day 8 postinfection (peak of the acute response) and at day 39 (memory phase) in both Ly9–/– mice and Ly9+/+ mice (p >> 0.05). Long-lived plasma cells are present in bone marrow and spleen at day 39 postinfection (Ly9–/– n = 4, Ly9+/+ n = 4 at each time point) (n = 2).

 


View larger version (54K):
[in this window]
[in a new window]
 
FIGURE 7. T cell responses to LCMV in Ly9–/– mice. A, LCMV-specific effector CD8 T cells in spleen were quantified at day 8 postinfection by 5 h of stimulation with gp33–41 MHC class I peptide (immunodominant peptide) or gp276–286 and then analyzed by intracellular cytokine staining for IFN-{gamma} and TNF-{alpha} production. (p >> 0.05) B, LCMV-specific CD4 T cells were quantified at day 8 postinfection by 5 h of stimulation with the immunodominant gp61–80 I-Ab MHC class II peptide or subdominant np309–328 I-Ab peptide and then analyzed by intracellular cytokine staining for IFN-{gamma} and TNF-{alpha} production. (p >> 0.05) C, LCMV-specific CD4 T cells were examined for IL-2 and IFN-{gamma} production by intracellular cytokine staining after in vitro restimulation for 5 h with gp61 peptide, done either at day 15 postinfection or day 39 postinfection. D, Memory CD8 T cell IFN-{gamma} and TNF-{alpha} responses were measured at day 39 postinfection by intracellular cytokine staining after in vitro restimulation for 5 h with gp33 peptide (Ly9–/– n = 4, Ly9+/+ n = 4 at each time point.) (n = 2).

 
T cell activation

For proliferation assays, splenocytes were stimulated with anti-CD3 (2C11) for 3 days in round-bottom 96-well plates at a density of 2 x 105 cells per 200 µl per well. During the last 20 h of culture, [3H]thymidine (6.7 Ci/mmol; MB Biochemicals) was added to the cells to achieve a final concentration of 1 µCi/well. Cells were then harvested and [3H]thymidine incorporation was measured on a microtiter plate counter. Alternatively, culture supernatant was harvested after 24 or 48 h in culture, and IL-2 production was measured by ELISA kit (BD Pharmingen).

T cell stimulation and polarization

CD4 T cells were purified from spleen and lymph nodes by positive selection on MACS beads (Miltenyi Biotec) and cultured under neutral conditions or Th1 or Th2 polarizing conditions. T cells were cultured in 24-well plates at a density of 5 x 105 cells per well. Under neutral conditions, T cells were stimulated with the indicated concentrations of plate-bound anti-TCR and anti-CD28 for 3 days. Preliminary experiments identified Ab concentrations that maximized CD28 costimulatory effects. Under Th1 polarizing conditions, cells were stimulated with anti-TCR (0.5 µg/ml) and anti-CD28 (5 µg/ml) with the addition of IL-12 (1 ng/ml; R&D Systems) and anti-IL-4 (10 µg/ml, clone 11B11; BD Pharmingen) for 3 days. Th2 polarizing conditions consisted of anti-TCR (0.5 µg/ml) and anti-CD28 (5 µg/ml) with the addition of IL-4 (100 ng/ml; R&D Systems), anti-IL-12 (10 µg/ml, clone C17.8; BD Pharmingen), and anti-IFN-{gamma} (10 µg/ml, clone R4-6A2; BD Pharmingen) for 3 days. After 3 days in culture, cells were washed and restimulated overnight in 24-well plates at a density of 5 x 105 cells/well. Overnight restimulation consisted of anti-TCR and anti-CD28 at the same concentrations as the initial stimulation. The following day, culture supernatants were harvested for ELISAs, and Golgi Stop (BD Pharmingen) was added to the cells for 8 h before intracellular cytokine staining. ELISAs for IL-4 and IFN-{gamma} were performed as per the manufacturer’s recommendations (R&D Systems). Intracellular cytokine staining with the Cytofix/Cytoperm kit (BD Pharmingen) was performed according to the manufacturer’s recommendations. Cells were then analyzed by FACS.

Quantitative PCR

CD4 T cells were purified from spleen and lymph nodes by positive selection on MACS beads (Miltenyi Biotec) and stimulated for 2 days with anti-TCR (0.5 µg/ml plate bound) and anti-CD28 (5 µg/ml plate bound). RNA was then isolated with TRIzol reagent (Invitrogen Life Technologies) and amplified by quantitative PCR. Reactions contained TaqMan One Step RT-PCR master mix (PE Applied Biosystems), 290 ng template RNA, 25 pmol of primers, and 0.2 pmol of TaqMan probe in a total volume of 50 µl. The following primers and probes were used to detect GATA-binding protein 3: forward CTACCGGGTTCGGATGTAAGTC, reverse GTTCACACACTCCCTGCCTTCT, probe 6FAM-AGGCCCAAGGCACGATCCAGC-TAMRA. The following primers and probes were used to detect T-bet: forward ACCAGAACGCAGAGATCACTCA, reverse CAAAGTTCTCCCGGAATCCTT, probe 6FAM-CTGAAAATCGACAACAACCCCTTTGCC-TAMRA. Primers and probes specific for murine GAPDH were purchased from PE Applied Biosystems. Thermal cycling conditions consisted of a 30 min incubation at 48°C, and an initial denaturation at 95°C for 10 min, followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. Reactions were performed in a spectrofluorometric thermal cycler (ABI PRISM 7700; PE Applied Biosystems). For each run, standard curves were generated with dilutions of total RNA to calculate relative copies of T-bet and GATA3 vs GAPDH.

Quantification of serum IgE

Serum was collected from unimmunized mice (6–12 wk old) and analyzed for IgE by ELISA. Procedures were performed according to the manufacturer’s recommendations (BD Biosciences).

Macrophage functions

Mice were injected i.p. with thioglycolate 5 days before sacrifice. Macrophages were then harvested by peritoneal lavage and cultured overnight at a density of 1 x 106 cells per well in 24-well plates (Corning). A total of 1 x 107 F18 E. coli was added to each well of macrophages for 1 h and then washed thoroughly. Macrophages were cultured for an additional hour in RPMI 1640 containing 100 µg/ml gentamicin. Cells were then lysed in 1% Triton X-100 in water or cultured for an additional 4 h in RPMI 1640 containing 10 µg/ml gentamicin before lysis. Dilutions of the lysate were then plated onto Laurie broth agar and incubated overnight. The next day, colonies were counted to determine CFUs per 1 x 106 macrophages. For cytokine analysis, peritoneal macrophages were harvested from mice that had not received thioglycolate treatment. Cells were cultured in 96-well plates (Corning) at a density of 6.5 x 105 cells per 200 µl per well for 3 days. Stimulation conditions consisted of LPS (200 ng/ml), CpG (10 µg/ml), or medium alone. After 3 days, culture supernatants were harvested and analyzed by ELISA for IL-6 or IL-12 according to manufacturer’s recommendations (R&D Systems).

NKT cells

Spleen and thymus tissue was harvested and minced into a single cell suspension. Cells were then stained with anti-TCR{beta} and CD1d tetramers (1/100 dilution) loaded with {alpha}-galactosylceramide ({alpha}GalCer) or unloaded CD1d tetramers (20). Cells were then analyzed by FACS.

LCMV infections

LCMV experiments were performed similarly to those previously described (10, 12). Plaque-purified clones of the Armstrong strain of LCMV (LCMVarm) were propagated in BHK-21 cells (American Type Culture Collection), and tested for biological activity in vitro and in vivo. A second passage stock of subclone SC3 (LCMVarm-sc3) was used for all LCMVarm experiments. For acute infections, mice received 1 x 105 PFU LCMVarm in a volume of 0.5 ml (suspended in RPMI 1640) by bilateral i.p. inoculation.

Plasma cell ELISPOT

Plasma cells were quantitated by a modification of the ELISPOT method previously reported (10, 21). Sonicated lysate from LCMV-infected BHK-21 cells was used as capture Ag for LCMV-specific ELISPOT. Ninety-six-well MAHA N4510 filter plates were used (Millipore). Goat anti-mouse IgG+M+A (Caltag Laboratories; 62.5 µl/10 ml) was used as capture Ab for total Ig ELISPOTs. LCMV Ag was UV inactivated (300 mJ in Stratalinker 1800; Stratagene) after overnight coating onto ELISPOT plate. Plates were blocked with DMEM plus 10% FCS. Cells of interest were added to the plate in 3x serial dilutions in DMEM plus 10% FCS and incubated at 37°C, 5–8% CO2, for 5–6 h. Biotinylated goat anti-mouse IgG{gamma} (Caltag Laboratories) followed by streptavidin-HRP (Vector Laboratories) was used for detection. 3-Amino-9-ethylcarbazole was used for spot development. Incubation buffers used PBS plus 0.05% Tween 20 plus 1% FCS, and wash buffers used PBS plus 0.05% Tween 20. ELISPOT plates were scanned by an ImmunoSpot Analyzer and machine counted using a standardized set of digital counting parameters we established in ImmunoSpot 3.2 (Cell Technology).

Intracellular cytokine staining, LCMV experiments

A total of 1 x 106 cells was cultured in the absence or presence of the indicated peptide and brefeldin A for 5–6 h at 37°C. H-2Db- or H-2Kb- restricted epitopes were used at 0.2 µg/ml, and I-Ab-restricted epitopes at 2 µg/ml. After staining for surface Ags, cells were fixed and permeabilized with 2% (w/v) paraformaldehyde and 0.1% saponin for 15 min, then stained for the intracellular cytokine of interest in the presence of 0.1% saponin and 2% NCS (GE Healthcare Life Sciences) for 30 min. Cells were washed and then fixed in 2% ultrapure formaldehyde (Polysciences).

Statistical analysis

Tests were performed using Prism 4.0 (GraphPad). Statistics were done using two-tailed, unpaired t test with 95% confidence bounds. Error bars are ±1 SEM. Arithmetic means were used for all analyses.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Generation of Ly9–/– mice

To identify immunologic functions of Ly9, mice containing a targeted disruption of Ly9 exon 2 were generated by homologous recombination in embryonic stem cells (Fig. 1A). Western blotting and FACS analysis of thymocytes and splenocytes, respectively, confirmed that mice homozygous for the mutated allele did not express Ly-9 protein (Fig. 1, BD) yet were viable, fertile, and morphologically indistinguishable from wild-type littermates.



View larger version (24K):
[in this window]
[in a new window]
 
FIGURE 1. Generation of Ly9–/– mice. A, A targeting construct containing a neomycin resistance gene cassette and lacking a 3' portion of exon 2 in the Ly9 gene was introduced into embryonic stem cells by homologous recombination. Embryonic stem cells were injected into blastocysts to create chimeric mice that were subsequently bred to produce Ly9–/– mice. B, Genomic DNA derived from tail specimens of Ly9-mutant mice was digested with PstI for Southern blot analysis using a probe complementary to exon 5. C, Western blot for Ly9 in thymocytes derived from Ly9–/– mice reveals that Ly9 is not expressed in the knockout cells. Ly9 was immunoprecipitated (IP) with polyclonal rabbit antisera specific for the cytoplasmic tail of Ly9 before analysis by immunoblot (IB) using the same Ab. As a control, Abs were used to immunoprecipitate and immunoblot for calnexin. D, FACS analysis of splenocytes derived from Ly9–/– mice demonstrates that Ly9 is not expressed in the knockout cells. Ly9 protein was detected with a rabbit polyclonal Ab directed against the Ly9 extracellular domain.

 
Ly9–/– T cells exhibit activation defects

Both SLAM–/– and SAP–/– mice exhibit normal lymphoid development (11, 12). Similarly, Ly9–/– mice contained normal numbers and percentages of T, B, and myeloid cells in the spleen as well as developing T cells in the thymus (Fig. 2A and our unpublished observations). Strikingly, Ly9–/– splenocytes stimulated for 72 h with anti-CD3 (0.1–10 µg/ml soluble) proliferated significantly less (p << 0.05) than wild-type splenocytes (Fig. 2B). Furthermore, Ly9–/– splenocytes produced significantly less IL-2 after in vitro stimulation with anti-CD3 for 24 or 48 h (p < 0.03) (Fig. 2C) This early T cell activation defect in Ly9–/– mice distinguishes Ly9 from the other SLAM family members and suggests a potential role for Ly9 in T cell activation or costimulation.

Mild Th2 defect in Ly9–/– T cells

Having shown that Ly9–/– mice exhibit an early T cell activation defect, we sought to determine whether later-developing Th1 or Th2 responses were skewed. SLAM–/– and SAP–/– T cells are defective at producing Th2 cytokines and produce excessive quantities of Th1 cytokines (5, 11, 12). Similarly, we found that Ly9–/– CD4 T cells produced less IL-4 compared with wild-type T cells in response to stimulation in vitro (Fig. 3). This defect was mild yet significant. In these experiments, purified CD4 T cells were stimulated in vitro with anti-TCR and anti-CD28 for 3 days. T cells were then restimulated overnight under identical conditions and evaluated for cytokine production by FACS or ELISA. Intracellular cytokine staining demonstrated that fewer Ly9–/– CD4 T cells expressed IL-4 compared with wild-type cells (Fig. 3A). Further analysis showed that Ly9–/– CD4 T cells displayed Th1 skewing as determined by intracellular staining for IFN-{gamma} (Fig. 3A). Interestingly, culturing Ly9–/– CD4 T cells under Th1 or Th2 polarizing conditions induced normal production of IL-4 and IFN-{gamma}, respectively (Fig. 3, A and B). The implication is that Ly9–/– T cells are mildly defective in producing Th2 cytokines, but they can respond appropriately to cytokine stimulation. Notably, IL-2 production was normal in Ly9–/– T cells after 3 days of stimulation in vitro with anti-TCR and anti-CD28 (data not shown). Thus, CD28-mediated costimulation appeared to rescue the T cell activation defect described in Fig. 2.

ELISA-based quantification of cytokine production revealed that stimulation with low doses of anti-TCR (0.25 µg/ml plate bound) and anti-CD28 elicited reduced IL-4 production in Ly9–/– T cells compared with wild-type cells (p < 0.015; Fig. 3B). At higher doses of anti-TCR (0.5 and 1 µg/ml plate bound) and anti-CD28, Ly9–/– T cells exhibited a modest reduction in IL-4 production that did not reach statistical significance (Fig. 3B). In contrast, analysis of cytokine production by ELISA demonstrated comparable production of IFN-{gamma} in Ly9–/– T cells and wild-type T cells (Fig. 3B).

In addition, quantitative RT-PCR was used to compare levels of the Th1-inducing transcription factor T-bet and the Th2-inducing transcription factor GATA3 in Ly9–/– vs wild-type mice (Fig. 3C). Activated CD4 T cells from Ly9–/– mice consistently produced fewer transcripts for GATA3 and more transcripts for T-bet, but the observed differences did not reach statistical significance (Fig. 3C).

The Th2 cytokine defect reported in SAP–/– mice was also associated with reduced serum IgE (12). Based on the observation that Ly9–/– T cells exhibit defects in IL-4 production, and IL-4 plays an important role in class switching to IgE, we measured levels of serum IgE in Ly9–/– mice. We observed a slight reduction in serum IgE in unimmunized Ly9–/– mice compared with wild-type mice, but this difference did not reach statistical significance (Fig. 3D). Taken together, Ly9–/– mice appear to have very mild Th2 defects. Similarly, the magnitude of the Th2 defects previously reported in SLAM–/– T cells and Ly108–/– T cells are also very mild (19, 22). It is likely that several SLAM family receptors contribute to Th2 polarization and may compensate for Ly9 in its absence.

Normal macrophage functions in Ly9–/– mice

In addition to the Th2 defect, the most notable phenotype in SLAM–/– mice was a macrophage defect. Because macrophages do not express SAP, this finding identified a SAP-independent function for SLAM (19). SLAM and Ly9 share significant homology within their cytoplasmic tails, and we have shown that both receptors interact with several signaling intermediates in common besides SAP (D. B. Graham, M. P. Bell, C. J. Huntoon, and D. J. McKean, submitted for publication). Therefore, we pursued a function for Ly9 in macrophages. Ly9–/– macrophages were capable of killing Gram-negative E. coli as efficiently as wild-type macrophages (Fig. 4A). In these experiments, thioglycolate-elicited peritoneal macrophages were cultured with live E. coli for 1 h, and free bacteria that had not been phagocytosed were subsequently washed away. Macrophages were then cultured for an additional 1 or 5 h, at which point, viable bacteria that had been internalized by the macrophages were cultured overnight on agar to quantify CFUs. At the 5-h time point, Ly9–/– and wild-type macrophages contained 3.5-fold fewer CFUs than at the 1-h time point (Fig. 4A). During this 4 h culture, Ly9–/– macrophages killed two-thirds of the bacteria they had phagocytosed during the first hour (Fig. 4A). Notably, Ly9–/– macrophages phagocytosed bacteria as efficiently as wild-type macrophages, as indicated by large numbers of CFUs measured at the 1-h time point (Fig. 4A).

SLAM–/– macrophages were also previously reported to produce excessive quantities of IL-6 and deficient levels of IL-12 after stimulation with LPS (19). In contrast, peritoneal macrophages from Ly9–/– and wild-type mice produced comparable quantities of IL-6 and IL-12 after stimulation with LPS or CpG, respectively (Fig. 4B). Despite the fact that Ly9 is expressed on wild-type macrophages, its absence does not result in a phenotype resembling that of SLAM–/– macrophages.

Normal development of NKT cells in Ly9–/– mice

The most recent phenotype documented in SAP–/– mice and in XLP patients is a lack of NKT cells (16, 17, 18). Evidence suggests that SAP and Fyn are required for the development of NKT cells but not traditional T cells or NK cells (16, 17, 18, 23). However, it is not known which receptors may regulate this SAP-dependent Fyn activation. Ly9 and several other SLAM family receptors are prime candidates, as they become up-regulated on NKT cells during development. NKT cells from the spleen and thymus of Ly9–/– and wild-type mice were stained with anti-TCR{beta} and CD1d tetramers loaded with {alpha}GalCer. As a negative control, cells were stained with unloaded (empty) CD1d tetramers. Examination of Ly9–/– mice revealed normal percentages of NKT cells in the thymus and spleen, suggesting that Ly9 alone is not required for NKT cell development (Fig. 5).

Normal responses to LCMV in Ly9–/– mice

XLP patients and SAP–/– mice exhibit profound defects in controlling viral infections (6), whereas SLAM–/– mice have not been examined in this context. Interestingly, SAP–/– mice mount an exaggerated early T cell response to an acute LCMV infection but fail to generate long term humoral immunity to the virus due to defective T cell help for B cells (6, 10, 11, 12). There are also reports of B cell defects in SAP–/– mice (24, 25). We postulated that if Ly9 signals through SAP, immune responses to LCMV would result in similar outcomes in Ly9–/– mice compared with SAP–/– mice. However, responses to LCMV were not compromised in Ly9–/– mice. SAP–/– mice have previously been shown to produce few germinal centers after infection (10). In contrast, Ly9–/– mice generated normal numbers of germinal center B cells (Fig. 6A). Additionally, Ly9–/– mice produced normal numbers of total plasma cells and LCMV-specific plasma cells at day 8 postinfection (Fig. 6B). Furthermore, long-lived plasma cells were generated in Ly9–/– mice and were present at 39 days after infection (Fig. 6C). Overall, Ly9–/– mice showed no defects in B cell responses to LCMV at any time point examined.

In contrast to SAP–/– mice, which mount an unusually strong acute T cell response to LCMV, Ly9–/– mice did not exhibit T cell hyperproliferation (Fig. 7). At day 8, the peak of the acute response, the numbers of CD8 T splenic cells specific for dominant (gp33) and subdominant (gp276) LCMV MHC class I epitopes were comparable in Ly-9–/– and wild-type littermates, nor was there any alteration in cytokine production (Fig. 7A). Numbers of gp33-specific CD8 T cells were also normal by MHC class I tetramer staining (data not shown). CD4 T cell responses were also examined after LCMV infection. Normal numbers of virus-specific CD4 T cells specific for dominant (gp61) and subdominant (np309) LCMV MHC class II epitopes were observed in splenocytes from Ly9–/– mice at the peak of the T cell response (Fig. 7B). Moreover, the amount of IFN-{gamma} and TNF-{alpha} production by those CD4 T cell was comparable in Ly9–/– mice and wild-type littermates (Fig. 7B). Because a clear defect in IL-2 production was observed by anti-CD3 stimulation of Ly9–/– CD4 T cells in vitro (Fig. 2), we examined the ability of Ly9–/– LCMV-specific CD4 T cells to produce IL-2 after stimulation with viral peptide (gp61). IL-2 production by Ly9–/– LCMV-specific CD4 T cells was normal (Fig. 7C). However, LCMV infection is strongly immunogenic, and therefore, the Ly9-dependent defect in IL-2 production observed earlier (Fig. 2) is apparently overcome by other costimulatory pathways in the context of an LCMV infection (Fig. 7C). Finally, we examined the ability of Ly9–/– mice to generate memory T cells, as memory is a key aspect of T cell biology (26). Numbers of LCMV-specific memory CD8 and CD4 T cells were normal in Ly9–/– mice (Fig. 7, C and D). The fact that Ly9–/– mice showed no defects in responding to LCMV indicates that Ly9 is not responsible, or not solely responsible, for initiating SAP signaling during viral infections.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
We sought to explore the in vivo functions and mechanisms of Ly9, a receptor with poorly characterized biological functions. Therefore, we generated Ly9–/– mice to compare their phenotype to that of SLAM–/– and SAP–/– mice. The objectives were to compare and contrast the functions of SLAM and Ly9 and to determine which, if any, of the defects observed in SAP–/– mice may be attributable to defective signaling downstream of Ly9. The single common feature among Ly9–/–, SLAM–/–, and SAP–/– mice is a Th2 defect, although the magnitude of the defect varies in the three mice (11, 12, 19). The reduction in IL-4 production observed in Ly9–/– T cells is modest and could be masked by compensation of additional SLAM family members that perform redundant functions. Our observations support the idea that because SLAM and Ly9 signal through SAP, both receptors may contribute to Th2 polarization additively. Accordingly, SAP–/– mice exhibit a nearly complete Th2 defect, whereas SLAM–/– and Ly9–/– mice show a partial defect (11, 12, 19).

Although Ly9 and SLAM share structural features and interact with SAP, we found important differences in the phenotypes of SLAM–/–, SAP–/–, and Ly9–/– mice. Ly9–/– mice do not exhibit macrophage defects resembling those found in SLAM–/– mice (19) but not in SAP–/– mice. Furthermore, Ly9–/– mice do not display any overt defects in NKT cell development and do not exhibit defective responses to LCMV, as was observed in SAP–/– mice (10, 11, 12, 16, 17). During the acute phase of LCMV infection, SAP–/– mice mount abnormally strong CD8 and CD4 T cell responses, whereas Ly9–/– mice generate CD8 and CD4 T cell responses to LCMV that are comparable to wild-type mice (10, 11, 12). Ly9–/– mice also differ from SAP–/– mice in that they exhibit no defects in T cell-dependent B cell responses to LCMV, including germinal center formation and the production of long-lived plasma cells (10). These observations suggest that additional SLAM family receptors regulate diverse SAP functions. However, we cannot rule out the possibility that other SLAM family receptors compensate for Ly9 deficiency and obscure any obvious defects.

Unexpectedly, the phenotype of Ly9–/– mice is distinct from that of SLAM–/– and SAP–/– mice. Our finding that Ly9–/– T cells proliferate poorly and produce little IL-2 after in vitro stimulation with anti-CD3 suggests that Ly9 may play an important role in T cell activation. In contrast, a recent study proposed that Ly9 partially down-regulates human T cell responses (27). These studies examined TCR signaling events after stimulation of T cells with anti-CD3 and anti-Ly9. However, there is no evidence that the anti-Ly9 Abs used in that study are receptor agonists. Our analyses of murine Ly9–/– T cells demonstrate that Ly9 may enhance T cell activation.

Presently, the relevant ligand for Ly9 in the context of T cell activation is unknown. It is possible that homotypic interactions between Ly9 on T cells and APCs promote T cell activation (Ref.28 and D. B. Graham, M. P. Bell, C. J. Huntoon, and D. J. McKean, submitted for publication). However, artificial APCs expressing Ly9 do not enhance IL-2 production in CD4 T cells, which argues against homotypic Ly9 interactions being involved in T cell activation (our unpublished observations). Alternatively, the ligand for Ly9 may not be itself but an uncharacterized molecule on APCs or other leukocytes. Ultimately, it is not clear whether Ly9 is a ligand or a receptor. Further investigation will be required to elucidate the mechanisms of Ly9 signaling in the context of T cell activation.

Although several mechanistic questions remain, in vitro assays with Ly9–/– T cells indicate a novel role for Ly9 in regulating T cell proliferation, IL-2 production, and Th2 polarization. The Th2 defect observed in Ly9–/– mice is common to SLAM–/– and SAP–/– mice; however, the T cell activation defect is unique to Ly9–/– mice. Additionally, we found that Ly9 does not control several of the biological responses previously shown to be regulated by SLAM and SAP. Unlike SLAM–/– mice, Ly9-deficiency does not lead to macrophage defects. Furthermore, Ly9–/– mice differ from SAP–/– mice in that they generate NKT cells and mount appropriate T and B cell responses to LCMV. Our findings reveal novel functions for Ly9 that distinguish it from the other SLAM family receptors.


    Acknowledgments
 
We thank Drs. Pam Schwartzberg and Jennifer Cannons (National Institutes of Health, Bethesda, MD) for technical assistance and valuable discussions, and we are grateful to Rafi Ahmed (Emory University, Atlanta, GA) for providing viral seed stocks. Mike Thompson (Mayo Clinic, Rochester, MN), Chuck Prickett and Fernando Vasquez (La Jolla Institute for Allergy and Immunology) provided excellent animal care assistance.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by grants from the National Institutes of Health (AI44959 to D.J.M.; T32 AI07425 to D.B.G.) and by a Cancer Research Institute Investigator Award (to S.C.). Back

2 Current address: Department of Pathology and Immunology, Washington University, St Louis, MO. Back

3 Address correspondence and reprint requests to Dr. David J. McKean, Department of Immunology, First Street S.W., Mayo Clinic College of Medicine, Rochester, MN 55905. E-mail address: mckean.david{at}mayo.edu Back

4 Abbreviations used in this paper: SLAM, signaling lymphocyte activation molecule; SAP, SLAM-associated protein; ITSM, immune receptor tyrosine based switch motif; {alpha}GalCer, {alpha}-galactosylceramide; LCMV, lymphocytic choriomeningitis virus; LCMVarm, Armstrong strain of LCMV; XLP, X-linked lymphoproliferative. Back

Received for publication July 1, 2005. Accepted for publication October 20, 2005.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Romero, X., N. Zapater, M. Calvo, S. G. Kalko, M. A. de la Fuente, V. Tovar, C. Ockeloen, P. Pizcueta, P. Engel. 2005. CD229 (Ly9) lymphocyte cell surface receptor interacts homophilically through its N-terminal domain and relocalizes to the immunological synapse. J. Immunol. 174: 7033-7042. [Abstract/Free Full Text]
  2. Mavaddat, N., D. W. Mason, P. D. Atkinson, E. J. Evans, R. J. C. Gilbert, D. I. Stuart, J. A. Fennelly, A. N. Barclay, S. J. Davis, M. H. Brown. 2000. Signaling lymphocytic activation molecule (CDw150) is homophilic but self-associates with very low affinity. J. Biol. Chem. 275: 28100-28109. [Abstract/Free Full Text]
  3. Sayos, J., M. Martin, A. Chen, M. Simarro, D. Howie, M. Morra, P. Engel, C. Terhorst. 2001. Cell surface receptors Ly-9 and CD84 recruit the X-linked lymphoproliferative disease gene product SAP. Blood 97: 3867-3874. [Abstract/Free Full Text]
  4. Li, C., C. Iosef, C. Y. Jia, V. K. M. Han, S. S. C. Li. 2003. Dual functional roles for the X-linked lymphoproliferative syndrome gene product SAP/SH2D1A in signaling through the signaling lymphocyte activation molecule (SLAM) family of immune receptors. J. Biol. Chem. 278: 3852-3859. [Abstract/Free Full Text]
  5. Cannons, J. L., L. J. Yu, B. Hill, L. A. Mijares, D. Dombroski, K. E. Nichols, A. Antonellis, G. A. Koretzky, K. Gardner, P. L. Schwartzberg. 2004. SAP regulates TH2 differentiation and PKC-{theta}-mediated activation of NF-{kappa}B1. Immunity 21: 693-706. [Medline]
  6. Nichols, K. E., C. S. Ma, J. L. Cannons, P. L. Schwartzberg, S. G. Tangye. 2005. Molecular and cellular pathogenesis of X-linked lymphoproliferative disease. Immunol. Rev. 203: 180-199. [Medline]
  7. Coffey, A. J., R. A. Brooksbank, O. Brandau, T. Oohashi, G. R. Howell, J. M. Bye, A. P. Cahn, J. Durham, P. Heath, P. Wray, et al 1998. Host response to EBV infection in X-linked lymphoproliferative disease results from mutations in an SH2-domain encoding gene. Nat. Genet. 20: 129-135. [Medline]
  8. Sayos, J., C. Wu, M. Morra, N. Wang, X. Zhang, D. Allen, S. van Schaik, L. Notarangelo, R. Geha, M. G. Roncaralo, et al 1998. The X-linked lymphoproliferative disease gene product SAP regulates signals induced through the co-receptor SLAM. Nature 395: 462-469. [Medline]
  9. Nichols, K. E., D. P. Harkin, S. Levitz, M. Krainer, K. A. Koloquist, C. Genovese, A. Bernard, M. Ferguson, L. Zuo, E. Snyder, et al 1998. Inactivating mutations in an SH2 domain-encoding gene in X-linked lymphoproliferative syndrome. Proc. Natl. Acad. Sci. USA 95: 13765-13770. [Abstract/Free Full Text]
  10. Crotty, S., E. N. Kersh, J. Cannons, P. L. Schwartzberg, R. Ahmed. 2003. SAP is required for generating long-term humoral immunity. Nature 421: 282-287. [Medline]
  11. Wu, C., K. B. Nguyen, G. C. Pien, N. Wang, C. Gullo, D. Howie, M. Rodriguez Sosa, M. J. Edwards, P. Borrow, A. R. Satoskar, et al 2001. SAP controls T cell responses to virus and terminal differentiation of TH2 cells. Nat. Immunol. 2: 410-414. [Medline]
  12. Czar, M. J., E. N. Kersh, L. A. Mijares, G. Lanier, J. Lewis, G. Yap, A. Chen, A. Sher, C. S. Duckett, R. Ahmed, P. L. Schwartzberg. 2001. Altered lymphocyte responses and cytokine production in mice deficient in the X-linked lymphoproliferative disease gene SH2D1A/DSHP/SAP. Proc. Natl. Acad. Sci. USA 98: 7449-7454. [Abstract/Free Full Text]
  13. Ma, C. S., N. J. Hare, K. E. Nichols, L. Dupre, G. Adolfi, M. G. Roncarolo, S. Adelstein, P. D. Hodgkin, S. G. Tangye. 2005. Impaired humoral immunity in X-linked lymphoproliferative disease with defective IL-10 production by CD4+ T cells. J. Clin. Invest. 115: 1049-1059. [Medline]
  14. Malbran, A., L. Belmonte, B. Ruibal-Ares, P. Bare, I. Massud, C. Parodi, M. Felippo, R. Hodinka, K. Haines, K. E. Nichols, M. M. de Bracco. 2004. Loss of circulating CD27+ memory B cells and CCR4+ T cells occurring in association with elevated EBV loads in XLP patients surviving primary EBV infection. Blood 103: 1625-1631. [Abstract/Free Full Text]
  15. Morra, M., D. Howie, M. S. Grande, J. Sayos, N. Wang, C. Wu, P. Engel, C. Terhorst. 2001. X-linked lymphoproliferative disease: a progressive immunodeficiency. Annu. Rev. Immunol. 19: 657-682. [Medline]
  16. Nichols, K. E., J. Hom, S. Y. Gong, A. Ganguly, C. S. Ma, J. L. Cannons, S. G. Tangye, P. L. Schwartzberg, G. A. Koretzky, P. L. Stein. 2005. Regulation of NKT cell development by SAP, the protein defective in XLP. Nat. Med. 11: 340-345. [Medline]
  17. Paquier, B., L. Yin, M. C. Fondaneche, F. Relouzat, C. Bloch-Queyrat, N. Lambert, A. Fischer, G. de Saint-Basile, S. Latour. 2005. Defective NKT cell development in mice and humans lacking the adapter SAP, the X-linked lymphoproliferative syndrome gene product. J. Exp. Med. 201: 695-701. [Abstract/Free Full Text]
  18. Chung, B., A. Aoukaty, J. Dutz, C. Terhorst, R. Tan. 2005. Signaling lymphocytic activation molecule-associated protein controls NKT cell functions. J. Immunol. 174: 3153-3157. [Abstract/Free Full Text]
  19. Wang, N., A. Satoskar, W. Faubion, D. Howie, S. Okamoto, S. Feske, C. Gullo, K. Clarke, M. Rodriquez Sosa, A. H. Sharpe, C. Terhorst. 2004. The cell surface receptor SLAM controls T cell and macrophage functions. J. Exp. Med. 199: 1255-1264. [Abstract/Free Full Text]
  20. Matsuda, J. L., O. V. Naidenko, L. Gapin, T. Nakayama, M. Taniguchi, C. R. Wang, Y. Koezuka, M. Kronenberg. 2000. Tracking the response of natural killer T cells to a glycolipid antigen using CD1d tetramers. J. Exp. Med. 192: 741-754. [Abstract/Free Full Text]
  21. Slifka, M. K., R. Antia, J. K. Whitmire, R. Ahmed. 1998. Humoral immunity due to long-lived plasma cells. Immunity 8: 363-372. [Medline]
  22. Howie, D., F. S. Laroux, M. Morra, A. R. Satoskar, L. E. Rosas, W. A. Faubion, A. Julien, S. Rietdijk, A. J. Coyle, C. Fraser, C. Terhorst. 2005. The SLAM family receptor Ly108 controls T cell and neutrophil functions. J. Immunol. 174: 5931-5935. [Abstract/Free Full Text]
  23. Gadue, P., L. Yin, S. Jain, P. L. Stein. 2004. Restoration of NK T cell development in fyn-mutant mice by a TCR reveals a requirement for Fyn during early NK T cell ontogeny. J. Immunol. 172: 6093-6100. [Abstract/Free Full Text]
  24. Morra, M., R. A. Barrington, A. C. Abadia-Molina, S. Okamoto, A. Julien, C. Gullo, A. Kalsy, M. J. Edwards, G. Chen, R. Spolski, et al 2005. Defective B cell responses in the absence of SH2D1APNAS. Proc. Natl. Acad. Sci. USA 102: 4819-484. [Abstract/Free Full Text]
  25. Al-Alem, U., C. Li, N. Forey, F. Relouzat, M. C. Fondanèche, S. V. Tavtigian, Z. Wang, S. Latour, L. Yin. 2005. Impaired Ig class switch in mice deficient for the X-linked lymphoproliferative disease gene Sap. Blood 106: 2069-2075. [Abstract/Free Full Text]
  26. Crotty, S., R. Ahmed. 2004. Immunological memory in humans. Semin. Immunol. 16: 197-203. [Medline]
  27. Martin, M., J. M. Del Valle, I. N. Saborit, P. Engel. 2005. Identification of Grb2 as a novel binding partner of the signaling lymphocytic activation molecule-associated protein binding receptor CD229. J. Immunol. 174: 5977-5986. [Abstract/Free Full Text]
  28. Romero, X., N. Zapater, M. Calvo, S. G. Kalko, M. A. de la Fuente, V. Tovar, C. Ockeloen, P. Pizcueta, P. Engel. 2005. CD229 (Ly9) lymphocyte cell surface receptor interacts homophilically through its N-terminal domain and relocalizes to the immunological synapse. J. Immunol. 174: 7033-7042. [Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Immunol.Home page
C. Kamperschroer, D. M. Roberts, Y. Zhang, N.-p. Weng, and S. L. Swain
SAP Enables T Cells to Help B Cells by a Mechanism Distinct from Th Cell Programming or CD40 Ligand Regulation
J. Immunol., September 15, 2008; 181(6): 3994 - 4003.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Felices and L. J. Berg
The Tec Kinases Itk and Rlk Regulate NKT Cell Maturation, Cytokine Production, and Survival
J. Immunol., March 1, 2008; 180(5): 3007 - 3018.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
Q. Yan, V. N. Malashkevich, A. Fedorov, E. Fedorov, E. Cao, J. W. Lary, J. L. Cole, S. G. Nathenson, and S. C. Almo
Structure of CD84 provides insight into SLAM family function
PNAS, June 19, 2007; 104(25): 10583 - 10588.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Radhakrishnan, K. R. Wiehagen, V. Pulko, V. Van Keulen, W. A. Faubion, K. L. Knutson, and L. R. Pease
Induction of a Th1 Response from Th2-Polarized T Cells by Activated Dendritic Cells: Dependence on TCR:Peptide-MHC Interaction, ICAM-1, IL-12, and IFN-{gamma}
J. Immunol., March 15, 2007; 178(6): 3583 - 3592.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. M. McCausland, I. Yusuf, H. Tran, N. Ono, Y. Yanagi, and S. Crotty
SAP Regulation of Follicular Helper CD4 T Cell Development and Humoral Immunity Is Independent of SLAM and Fyn Kinase
J. Immunol., January 15, 2007; 178(2): 817 - 828.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. Crotty, M. M. McCausland, R. D. Aubert, E. J. Wherry, and R. Ahmed
Hypogammaglobulinemia and exacerbated CD8 T-cell-mediated immunopathology in SAP-deficient mice with chronic LCMV infection mimics human XLP disease
Blood, November 1, 2006; 108(9): 3085 - 3093.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow A correction has been published
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Graham, D. B.
Right arrow Articles by McKean, D. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Graham, D. B.
Right arrow Articles by McKean, D. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS