|
|
||||||||




* Department of Immunology,
Department of Pediatric and Adolescent Medicine, and
Department of Gastroenterology, Mayo Clinic College of Medicine, Rochester, MN 55905; and
Division of Vaccine Discovery, La Jolla Institute for Allergy and Immunology, San Diego, CA 92121
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
SAP signaling downstream of SLAM has been extensively studied in the context of T cell activation. As an adaptor molecule, SAP bridges SLAM to the Src family kinase Fyn, which regulates protein kinase C
-dependent NF-
B activation (5, 6). The importance of this SAP signaling cascade was illustrated when mutations in SAP were found to cause X-linked lymphoproliferative (XLP) disease in humans (7, 8, 9). This fatal immunodeficiency is characterized by fulminant infectious mononucleosis, dysgammaglobulinemia, and/or lymphoproliferative disorders (6). Several aspects of human XLP disease are mimicked in SAP/ mice, particularly susceptibility to viral infections. Lymphocytic choriomeningitis virus (LCMV) infection in SAP/ mice results in an exaggerated acute response associated with lymphoproliferation and increased numbers of LCMV-specific CD4 and CD8 T cells secreting large quantities of IFN-
(10, 11, 12). Interestingly, B cell responses to LCMV are severely compromised in SAP/ mice, and this defect is dependent on lack of help from CD4 T cells (10). Specifically, SAP/ mice produce few germinal center B cells, long-lived plasma cells, and LCMV-specific memory B cells (10). A severe defect in B cell memory has also been observed in human XLP patients (13, 14) and is consistent with the hypogammaglobulinemia observed in these patients (6, 15).
As was observed in LCMV-infected mice, CD4 T cells from uninfected SAP/ mice produce abnormally large quantities of IFN-
after stimulation in vitro with anti-TCR and anti-CD28 or Ag-pulsed APCs (11, 12). Upon further investigation, SAP/ CD4 T cells show a strong skewing toward Th1 responses and defects in the production of Th2 cytokines such as IL-4, IL-10, and IL-13 (11, 12). In addition to CD4 T cells, NKT cells contribute to Th1/Th2 polarization by producing large quantities of polarizing cytokines (IFN-
or IL-4) early in immune responses. Interestingly, SAP/ mice have virtually no NKT cells, which may exacerbate the observed Th2 defect or impart distinct immunologic defects (16, 17, 18). Also consistent with a Th2 defect is the observation that class switching to IgE is defective in SAP/ mice, which emphasizes that this T cell defect directly impacts B cell responses (12). Put into context, Th2 responses are very relevant to host defense. Accordingly, SAP/ mice are more effective at mounting protective Th1 responses to leishmania than their wild-type counterparts (11).
Consistent with the notion that some SLAM signaling is transduced through SAP, the SLAM knockout phenotype resembles several aspects of SAP deficiency in humans. Purified CD4 T cells from SLAM/ mice produce very little IL-4 and slightly elevated levels of IFN-
after stimulation with anti-TCR and anti-CD28 or Ag-pulsed APCs in vitro (19). This Th2 defect is much less severe in SLAM/ mice compared with SAP/ mice, presumably because additional SLAM family members that signal through SAP are still functional. It was expected that the Th1 skewing observed in SLAM/ mice would protect them from infection with leishmania, as was observed in SAP/ mice. Surprisingly, SLAM/ mice were more susceptible to leishmaniasis than control mice (19). Closer examination revealed that SLAM/ mice have a SAP-independent macrophage defect that accounts for their inability to control leishmania. Macrophages from SLAM/ mice produce unusually large quantities of IL-6 and significantly less TNF-
, IL-12, and NO in response to LPS (19).
Taken together, the SLAM knockout phenotype cannot be explained entirely by disrupted SAP signaling. Furthermore, the SAP knockout phenotype cannot be explained entirely by disrupted signaling downstream of SLAM. Therefore, additional SLAM family receptors must regulate SAP signaling. Because Ly9 resembles SLAM in structure and interacts with SAP, we have generated Ly9/ mice to address these issues.
| Materials and Methods |
|---|
|
|
|---|
Fluorescently conjugated Abs specific for CD8 (53-6.7), CD4 (H129.19), CD19 (1D3), CD28 (37.51), CD11c (HL3), IL-4 (11B11), IFN-
(XMG1.2), Fas (Jo2), B220 (RA3-6B2), CD138, TNF-
, IFN-
, and TCR
(H57-597) were purchased from BD Pharmingen or eBioscience. Goat anti-rat IgG, goat anti-rabbit IgG, and streptavidin-HRP were also obtained from BD Pharmingen. Biotinylated anti-IgD was purchased from eBioscience. Polyclonal antisera specific for Ly9 was collected from rabbits that had been immunized with His-tagged Ly9 extracellular domain or Ly9 cytoplasmic tail produced in Escherichia coli. Anti-CD3 (145-2C11) and anti TCR
(H57-597) were purified from hybridoma culture supernatant. CD1d tetramers were generously provided by M. Kronenberg (La Jolla Institute for Allergy and Immunology, San Diego, CA). MHC class I tetramer of Db loaded with LCMV gp3341 was provided by Dr. H. Cheroutre (La Jolla Institute for Allergy and Immunology).
Generation of Ly9/ mice
A murine genomic library packaged in
phage was screened for clones containing the full-length Ly9 gene. A positive clone was used as a template to amplify portions of the Ly9 gene by PCR. The 5' arm was flanked by HpaI restriction sites and contained exon 1 and part of exon 2. The 3' arm was flanked by SmaI restriction sites and contained exons 3 and 4. The 5' and 3' arms were then cloned into the pKO Scrambler targeting vector (Stratagene) flanking a neomycin resistance gene. The targeting vector was then introduced into 129/SvEES cells by homologous recombination, and clones containing the mutant Ly9 allele were screened by Southern blot using a probe complementary to exon 5. A positive embryonic stem cell clone was injected into blastocysts derived from C57BL/6 mice and implanted into pseudopregnant surrogate mothers to generate chimeric mice. These chimeras were subsequently bred with C57BL/6 mice to generate mice heterozygous for the mutated Ly9 allele. F1 heterozygotes were used as breeding stock to generate homozygous Ly9 mutants. All mice were genotyped by PCR. All procedures involving mice were approved by the Institutional Animal Care and use Committees at the Mayo Clinic College of Medicine and the La Jolla Institute for Allergy and Immunology.
FACS analysis
Cell surface staining was performed according to standard procedures. All samples were subsequently analyzed on a FACScan flow cytometer with CellQuest software (BD Biosciences) (see Figs. 25) or acquired on a FACSCalibur and analyzed with FlowJo (see Figs. 6 and 7).
|
|
|
|
|
|
For proliferation assays, splenocytes were stimulated with anti-CD3 (2C11) for 3 days in round-bottom 96-well plates at a density of 2 x 105 cells per 200 µl per well. During the last 20 h of culture, [3H]thymidine (6.7 Ci/mmol; MB Biochemicals) was added to the cells to achieve a final concentration of 1 µCi/well. Cells were then harvested and [3H]thymidine incorporation was measured on a microtiter plate counter. Alternatively, culture supernatant was harvested after 24 or 48 h in culture, and IL-2 production was measured by ELISA kit (BD Pharmingen).
T cell stimulation and polarization
CD4 T cells were purified from spleen and lymph nodes by positive selection on MACS beads (Miltenyi Biotec) and cultured under neutral conditions or Th1 or Th2 polarizing conditions. T cells were cultured in 24-well plates at a density of 5 x 105 cells per well. Under neutral conditions, T cells were stimulated with the indicated concentrations of plate-bound anti-TCR and anti-CD28 for 3 days. Preliminary experiments identified Ab concentrations that maximized CD28 costimulatory effects. Under Th1 polarizing conditions, cells were stimulated with anti-TCR (0.5 µg/ml) and anti-CD28 (5 µg/ml) with the addition of IL-12 (1 ng/ml; R&D Systems) and anti-IL-4 (10 µg/ml, clone 11B11; BD Pharmingen) for 3 days. Th2 polarizing conditions consisted of anti-TCR (0.5 µg/ml) and anti-CD28 (5 µg/ml) with the addition of IL-4 (100 ng/ml; R&D Systems), anti-IL-12 (10 µg/ml, clone C17.8; BD Pharmingen), and anti-IFN-
(10 µg/ml, clone R4-6A2; BD Pharmingen) for 3 days. After 3 days in culture, cells were washed and restimulated overnight in 24-well plates at a density of 5 x 105 cells/well. Overnight restimulation consisted of anti-TCR and anti-CD28 at the same concentrations as the initial stimulation. The following day, culture supernatants were harvested for ELISAs, and Golgi Stop (BD Pharmingen) was added to the cells for 8 h before intracellular cytokine staining. ELISAs for IL-4 and IFN-
were performed as per the manufacturers recommendations (R&D Systems). Intracellular cytokine staining with the Cytofix/Cytoperm kit (BD Pharmingen) was performed according to the manufacturers recommendations. Cells were then analyzed by FACS.
Quantitative PCR
CD4 T cells were purified from spleen and lymph nodes by positive selection on MACS beads (Miltenyi Biotec) and stimulated for 2 days with anti-TCR (0.5 µg/ml plate bound) and anti-CD28 (5 µg/ml plate bound). RNA was then isolated with TRIzol reagent (Invitrogen Life Technologies) and amplified by quantitative PCR. Reactions contained TaqMan One Step RT-PCR master mix (PE Applied Biosystems), 290 ng template RNA, 25 pmol of primers, and 0.2 pmol of TaqMan probe in a total volume of 50 µl. The following primers and probes were used to detect GATA-binding protein 3: forward CTACCGGGTTCGGATGTAAGTC, reverse GTTCACACACTCCCTGCCTTCT, probe 6FAM-AGGCCCAAGGCACGATCCAGC-TAMRA. The following primers and probes were used to detect T-bet: forward ACCAGAACGCAGAGATCACTCA, reverse CAAAGTTCTCCCGGAATCCTT, probe 6FAM-CTGAAAATCGACAACAACCCCTTTGCC-TAMRA. Primers and probes specific for murine GAPDH were purchased from PE Applied Biosystems. Thermal cycling conditions consisted of a 30 min incubation at 48°C, and an initial denaturation at 95°C for 10 min, followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. Reactions were performed in a spectrofluorometric thermal cycler (ABI PRISM 7700; PE Applied Biosystems). For each run, standard curves were generated with dilutions of total RNA to calculate relative copies of T-bet and GATA3 vs GAPDH.
Quantification of serum IgE
Serum was collected from unimmunized mice (612 wk old) and analyzed for IgE by ELISA. Procedures were performed according to the manufacturers recommendations (BD Biosciences).
Macrophage functions
Mice were injected i.p. with thioglycolate 5 days before sacrifice. Macrophages were then harvested by peritoneal lavage and cultured overnight at a density of 1 x 106 cells per well in 24-well plates (Corning). A total of 1 x 107 F18 E. coli was added to each well of macrophages for 1 h and then washed thoroughly. Macrophages were cultured for an additional hour in RPMI 1640 containing 100 µg/ml gentamicin. Cells were then lysed in 1% Triton X-100 in water or cultured for an additional 4 h in RPMI 1640 containing 10 µg/ml gentamicin before lysis. Dilutions of the lysate were then plated onto Laurie broth agar and incubated overnight. The next day, colonies were counted to determine CFUs per 1 x 106 macrophages. For cytokine analysis, peritoneal macrophages were harvested from mice that had not received thioglycolate treatment. Cells were cultured in 96-well plates (Corning) at a density of 6.5 x 105 cells per 200 µl per well for 3 days. Stimulation conditions consisted of LPS (200 ng/ml), CpG (10 µg/ml), or medium alone. After 3 days, culture supernatants were harvested and analyzed by ELISA for IL-6 or IL-12 according to manufacturers recommendations (R&D Systems).
NKT cells
Spleen and thymus tissue was harvested and minced into a single cell suspension. Cells were then stained with anti-TCR
and CD1d tetramers (1/100 dilution) loaded with
-galactosylceramide (
GalCer) or unloaded CD1d tetramers (20). Cells were then analyzed by FACS.
LCMV infections
LCMV experiments were performed similarly to those previously described (10, 12). Plaque-purified clones of the Armstrong strain of LCMV (LCMVarm) were propagated in BHK-21 cells (American Type Culture Collection), and tested for biological activity in vitro and in vivo. A second passage stock of subclone SC3 (LCMVarm-sc3) was used for all LCMVarm experiments. For acute infections, mice received 1 x 105 PFU LCMVarm in a volume of 0.5 ml (suspended in RPMI 1640) by bilateral i.p. inoculation.
Plasma cell ELISPOT
Plasma cells were quantitated by a modification of the ELISPOT method previously reported (10, 21). Sonicated lysate from LCMV-infected BHK-21 cells was used as capture Ag for LCMV-specific ELISPOT. Ninety-six-well MAHA N4510 filter plates were used (Millipore). Goat anti-mouse IgG+M+A (Caltag Laboratories; 62.5 µl/10 ml) was used as capture Ab for total Ig ELISPOTs. LCMV Ag was UV inactivated (300 mJ in Stratalinker 1800; Stratagene) after overnight coating onto ELISPOT plate. Plates were blocked with DMEM plus 10% FCS. Cells of interest were added to the plate in 3x serial dilutions in DMEM plus 10% FCS and incubated at 37°C, 58% CO2, for 56 h. Biotinylated goat anti-mouse IgG
(Caltag Laboratories) followed by streptavidin-HRP (Vector Laboratories) was used for detection. 3-Amino-9-ethylcarbazole was used for spot development. Incubation buffers used PBS plus 0.05% Tween 20 plus 1% FCS, and wash buffers used PBS plus 0.05% Tween 20. ELISPOT plates were scanned by an ImmunoSpot Analyzer and machine counted using a standardized set of digital counting parameters we established in ImmunoSpot 3.2 (Cell Technology).
Intracellular cytokine staining, LCMV experiments
A total of 1 x 106 cells was cultured in the absence or presence of the indicated peptide and brefeldin A for 56 h at 37°C. H-2Db- or H-2Kb- restricted epitopes were used at 0.2 µg/ml, and I-Ab-restricted epitopes at 2 µg/ml. After staining for surface Ags, cells were fixed and permeabilized with 2% (w/v) paraformaldehyde and 0.1% saponin for 15 min, then stained for the intracellular cytokine of interest in the presence of 0.1% saponin and 2% NCS (GE Healthcare Life Sciences) for 30 min. Cells were washed and then fixed in 2% ultrapure formaldehyde (Polysciences).
Statistical analysis
Tests were performed using Prism 4.0 (GraphPad). Statistics were done using two-tailed, unpaired t test with 95% confidence bounds. Error bars are ±1 SEM. Arithmetic means were used for all analyses.
| Results |
|---|
|
|
|---|
To identify immunologic functions of Ly9, mice containing a targeted disruption of Ly9 exon 2 were generated by homologous recombination in embryonic stem cells (Fig. 1A). Western blotting and FACS analysis of thymocytes and splenocytes, respectively, confirmed that mice homozygous for the mutated allele did not express Ly-9 protein (Fig. 1, BD) yet were viable, fertile, and morphologically indistinguishable from wild-type littermates.
|
Both SLAM/ and SAP/ mice exhibit normal lymphoid development (11, 12). Similarly, Ly9/ mice contained normal numbers and percentages of T, B, and myeloid cells in the spleen as well as developing T cells in the thymus (Fig. 2A and our unpublished observations). Strikingly, Ly9/ splenocytes stimulated for 72 h with anti-CD3 (0.110 µg/ml soluble) proliferated significantly less (p << 0.05) than wild-type splenocytes (Fig. 2B). Furthermore, Ly9/ splenocytes produced significantly less IL-2 after in vitro stimulation with anti-CD3 for 24 or 48 h (p < 0.03) (Fig. 2C) This early T cell activation defect in Ly9/ mice distinguishes Ly9 from the other SLAM family members and suggests a potential role for Ly9 in T cell activation or costimulation.
Mild Th2 defect in Ly9/ T cells
Having shown that Ly9/ mice exhibit an early T cell activation defect, we sought to determine whether later-developing Th1 or Th2 responses were skewed. SLAM/ and SAP/ T cells are defective at producing Th2 cytokines and produce excessive quantities of Th1 cytokines (5, 11, 12). Similarly, we found that Ly9/ CD4 T cells produced less IL-4 compared with wild-type T cells in response to stimulation in vitro (Fig. 3). This defect was mild yet significant. In these experiments, purified CD4 T cells were stimulated in vitro with anti-TCR and anti-CD28 for 3 days. T cells were then restimulated overnight under identical conditions and evaluated for cytokine production by FACS or ELISA. Intracellular cytokine staining demonstrated that fewer Ly9/ CD4 T cells expressed IL-4 compared with wild-type cells (Fig. 3A). Further analysis showed that Ly9/ CD4 T cells displayed Th1 skewing as determined by intracellular staining for IFN-
(Fig. 3A). Interestingly, culturing Ly9/ CD4 T cells under Th1 or Th2 polarizing conditions induced normal production of IL-4 and IFN-
, respectively (Fig. 3, A and B). The implication is that Ly9/ T cells are mildly defective in producing Th2 cytokines, but they can respond appropriately to cytokine stimulation. Notably, IL-2 production was normal in Ly9/ T cells after 3 days of stimulation in vitro with anti-TCR and anti-CD28 (data not shown). Thus, CD28-mediated costimulation appeared to rescue the T cell activation defect described in Fig. 2.
ELISA-based quantification of cytokine production revealed that stimulation with low doses of anti-TCR (0.25 µg/ml plate bound) and anti-CD28 elicited reduced IL-4 production in Ly9/ T cells compared with wild-type cells (p < 0.015; Fig. 3B). At higher doses of anti-TCR (0.5 and 1 µg/ml plate bound) and anti-CD28, Ly9/ T cells exhibited a modest reduction in IL-4 production that did not reach statistical significance (Fig. 3B). In contrast, analysis of cytokine production by ELISA demonstrated comparable production of IFN-
in Ly9/ T cells and wild-type T cells (Fig. 3B).
In addition, quantitative RT-PCR was used to compare levels of the Th1-inducing transcription factor T-bet and the Th2-inducing transcription factor GATA3 in Ly9/ vs wild-type mice (Fig. 3C). Activated CD4 T cells from Ly9/ mice consistently produced fewer transcripts for GATA3 and more transcripts for T-bet, but the observed differences did not reach statistical significance (Fig. 3C).
The Th2 cytokine defect reported in SAP/ mice was also associated with reduced serum IgE (12). Based on the observation that Ly9/ T cells exhibit defects in IL-4 production, and IL-4 plays an important role in class switching to IgE, we measured levels of serum IgE in Ly9/ mice. We observed a slight reduction in serum IgE in unimmunized Ly9/ mice compared with wild-type mice, but this difference did not reach statistical significance (Fig. 3D). Taken together, Ly9/ mice appear to have very mild Th2 defects. Similarly, the magnitude of the Th2 defects previously reported in SLAM/ T cells and Ly108/ T cells are also very mild (19, 22). It is likely that several SLAM family receptors contribute to Th2 polarization and may compensate for Ly9 in its absence.
Normal macrophage functions in Ly9/ mice
In addition to the Th2 defect, the most notable phenotype in SLAM/ mice was a macrophage defect. Because macrophages do not express SAP, this finding identified a SAP-independent function for SLAM (19). SLAM and Ly9 share significant homology within their cytoplasmic tails, and we have shown that both receptors interact with several signaling intermediates in common besides SAP (D. B. Graham, M. P. Bell, C. J. Huntoon, and D. J. McKean, submitted for publication). Therefore, we pursued a function for Ly9 in macrophages. Ly9/ macrophages were capable of killing Gram-negative E. coli as efficiently as wild-type macrophages (Fig. 4A). In these experiments, thioglycolate-elicited peritoneal macrophages were cultured with live E. coli for 1 h, and free bacteria that had not been phagocytosed were subsequently washed away. Macrophages were then cultured for an additional 1 or 5 h, at which point, viable bacteria that had been internalized by the macrophages were cultured overnight on agar to quantify CFUs. At the 5-h time point, Ly9/ and wild-type macrophages contained 3.5-fold fewer CFUs than at the 1-h time point (Fig. 4A). During this 4 h culture, Ly9/ macrophages killed two-thirds of the bacteria they had phagocytosed during the first hour (Fig. 4A). Notably, Ly9/ macrophages phagocytosed bacteria as efficiently as wild-type macrophages, as indicated by large numbers of CFUs measured at the 1-h time point (Fig. 4A).
SLAM/ macrophages were also previously reported to produce excessive quantities of IL-6 and deficient levels of IL-12 after stimulation with LPS (19). In contrast, peritoneal macrophages from Ly9/ and wild-type mice produced comparable quantities of IL-6 and IL-12 after stimulation with LPS or CpG, respectively (Fig. 4B). Despite the fact that Ly9 is expressed on wild-type macrophages, its absence does not result in a phenotype resembling that of SLAM/ macrophages.
Normal development of NKT cells in Ly9/ mice
The most recent phenotype documented in SAP/ mice and in XLP patients is a lack of NKT cells (16, 17, 18). Evidence suggests that SAP and Fyn are required for the development of NKT cells but not traditional T cells or NK cells (16, 17, 18, 23). However, it is not known which receptors may regulate this SAP-dependent Fyn activation. Ly9 and several other SLAM family receptors are prime candidates, as they become up-regulated on NKT cells during development. NKT cells from the spleen and thymus of Ly9/ and wild-type mice were stained with anti-TCR
and CD1d tetramers loaded with
GalCer. As a negative control, cells were stained with unloaded (empty) CD1d tetramers. Examination of Ly9/ mice revealed normal percentages of NKT cells in the thymus and spleen, suggesting that Ly9 alone is not required for NKT cell development (Fig. 5).
Normal responses to LCMV in Ly9/ mice
XLP patients and SAP/ mice exhibit profound defects in controlling viral infections (6), whereas SLAM/ mice have not been examined in this context. Interestingly, SAP/ mice mount an exaggerated early T cell response to an acute LCMV infection but fail to generate long term humoral immunity to the virus due to defective T cell help for B cells (6, 10, 11, 12). There are also reports of B cell defects in SAP/ mice (24, 25). We postulated that if Ly9 signals through SAP, immune responses to LCMV would result in similar outcomes in Ly9/ mice compared with SAP/ mice. However, responses to LCMV were not compromised in Ly9/ mice. SAP/ mice have previously been shown to produce few germinal centers after infection (10). In contrast, Ly9/ mice generated normal numbers of germinal center B cells (Fig. 6A). Additionally, Ly9/ mice produced normal numbers of total plasma cells and LCMV-specific plasma cells at day 8 postinfection (Fig. 6B). Furthermore, long-lived plasma cells were generated in Ly9/ mice and were present at 39 days after infection (Fig. 6C). Overall, Ly9/ mice showed no defects in B cell responses to LCMV at any time point examined.
In contrast to SAP/ mice, which mount an unusually strong acute T cell response to LCMV, Ly9/ mice did not exhibit T cell hyperproliferation (Fig. 7). At day 8, the peak of the acute response, the numbers of CD8 T splenic cells specific for dominant (gp33) and subdominant (gp276) LCMV MHC class I epitopes were comparable in Ly-9/ and wild-type littermates, nor was there any alteration in cytokine production (Fig. 7A). Numbers of gp33-specific CD8 T cells were also normal by MHC class I tetramer staining (data not shown). CD4 T cell responses were also examined after LCMV infection. Normal numbers of virus-specific CD4 T cells specific for dominant (gp61) and subdominant (np309) LCMV MHC class II epitopes were observed in splenocytes from Ly9/ mice at the peak of the T cell response (Fig. 7B). Moreover, the amount of IFN-
and TNF-
production by those CD4 T cell was comparable in Ly9/ mice and wild-type littermates (Fig. 7B). Because a clear defect in IL-2 production was observed by anti-CD3 stimulation of Ly9/ CD4 T cells in vitro (Fig. 2), we examined the ability of Ly9/ LCMV-specific CD4 T cells to produce IL-2 after stimulation with viral peptide (gp61). IL-2 production by Ly9/ LCMV-specific CD4 T cells was normal (Fig. 7C). However, LCMV infection is strongly immunogenic, and therefore, the Ly9-dependent defect in IL-2 production observed earlier (Fig. 2) is apparently overcome by other costimulatory pathways in the context of an LCMV infection (Fig. 7C). Finally, we examined the ability of Ly9/ mice to generate memory T cells, as memory is a key aspect of T cell biology (26). Numbers of LCMV-specific memory CD8 and CD4 T cells were normal in Ly9/ mice (Fig. 7, C and D). The fact that Ly9/ mice showed no defects in responding to LCMV indicates that Ly9 is not responsible, or not solely responsible, for initiating SAP signaling during viral infections.
| Discussion |
|---|
|
|
|---|
Although Ly9 and SLAM share structural features and interact with SAP, we found important differences in the phenotypes of SLAM/, SAP/, and Ly9/ mice. Ly9/ mice do not exhibit macrophage defects resembling those found in SLAM/ mice (19) but not in SAP/ mice. Furthermore, Ly9/ mice do not display any overt defects in NKT cell development and do not exhibit defective responses to LCMV, as was observed in SAP/ mice (10, 11, 12, 16, 17). During the acute phase of LCMV infection, SAP/ mice mount abnormally strong CD8 and CD4 T cell responses, whereas Ly9/ mice generate CD8 and CD4 T cell responses to LCMV that are comparable to wild-type mice (10, 11, 12). Ly9/ mice also differ from SAP/ mice in that they exhibit no defects in T cell-dependent B cell responses to LCMV, including germinal center formation and the production of long-lived plasma cells (10). These observations suggest that additional SLAM family receptors regulate diverse SAP functions. However, we cannot rule out the possibility that other SLAM family receptors compensate for Ly9 deficiency and obscure any obvious defects.
Unexpectedly, the phenotype of Ly9/ mice is distinct from that of SLAM/ and SAP/ mice. Our finding that Ly9/ T cells proliferate poorly and produce little IL-2 after in vitro stimulation with anti-CD3 suggests that Ly9 may play an important role in T cell activation. In contrast, a recent study proposed that Ly9 partially down-regulates human T cell responses (27). These studies examined TCR signaling events after stimulation of T cells with anti-CD3 and anti-Ly9. However, there is no evidence that the anti-Ly9 Abs used in that study are receptor agonists. Our analyses of murine Ly9/ T cells demonstrate that Ly9 may enhance T cell activation.
Presently, the relevant ligand for Ly9 in the context of T cell activation is unknown. It is possible that homotypic interactions between Ly9 on T cells and APCs promote T cell activation (Ref.28 and D. B. Graham, M. P. Bell, C. J. Huntoon, and D. J. McKean, submitted for publication). However, artificial APCs expressing Ly9 do not enhance IL-2 production in CD4 T cells, which argues against homotypic Ly9 interactions being involved in T cell activation (our unpublished observations). Alternatively, the ligand for Ly9 may not be itself but an uncharacterized molecule on APCs or other leukocytes. Ultimately, it is not clear whether Ly9 is a ligand or a receptor. Further investigation will be required to elucidate the mechanisms of Ly9 signaling in the context of T cell activation.
Although several mechanistic questions remain, in vitro assays with Ly9/ T cells indicate a novel role for Ly9 in regulating T cell proliferation, IL-2 production, and Th2 polarization. The Th2 defect observed in Ly9/ mice is common to SLAM/ and SAP/ mice; however, the T cell activation defect is unique to Ly9/ mice. Additionally, we found that Ly9 does not control several of the biological responses previously shown to be regulated by SLAM and SAP. Unlike SLAM/ mice, Ly9-deficiency does not lead to macrophage defects. Furthermore, Ly9/ mice differ from SAP/ mice in that they generate NKT cells and mount appropriate T and B cell responses to LCMV. Our findings reveal novel functions for Ly9 that distinguish it from the other SLAM family receptors.
| Acknowledgments |
|---|
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported by grants from the National Institutes of Health (AI44959 to D.J.M.; T32 AI07425 to D.B.G.) and by a Cancer Research Institute Investigator Award (to S.C.). ![]()
2 Current address: Department of Pathology and Immunology, Washington University, St Louis, MO. ![]()
3 Address correspondence and reprint requests to Dr. David J. McKean, Department of Immunology, First Street S.W., Mayo Clinic College of Medicine, Rochester, MN 55905. E-mail address: mckean.david{at}mayo.edu ![]()
4 Abbreviations used in this paper: SLAM, signaling lymphocyte activation molecule; SAP, SLAM-associated protein; ITSM, immune receptor tyrosine based switch motif;
GalCer,
-galactosylceramide; LCMV, lymphocytic choriomeningitis virus; LCMVarm, Armstrong strain of LCMV; XLP, X-linked lymphoproliferative. ![]()
Received for publication July 1, 2005. Accepted for publication October 20, 2005.
| References |
|---|
|
|
|---|
-mediated activation of NF-
B1. Immunity 21: 693-706. [Medline]This article has been cited by other articles:
![]() |
M. Felices and L. J. Berg The Tec Kinases Itk and Rlk Regulate NKT Cell Maturation, Cytokine Production, and Survival J. Immunol., March 1, 2008; 180(5): 3007 - 3018. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Yan, V. N. Malashkevich, A. Fedorov, E. Fedorov, E. Cao, J. W. Lary, J. L. Cole, S. G. Nathenson, and S. C. Almo Structure of CD84 provides insight into SLAM family function PNAS, June 19, 2007; 104(25): 10583 - 10588. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Radhakrishnan, K. R. Wiehagen, V. Pulko, V. Van Keulen, W. A. Faubion, K. L. Knutson, and L. R. Pease Induction of a Th1 Response from Th2-Polarized T Cells by Activated Dendritic Cells: Dependence on TCR:Peptide-MHC Interaction, ICAM-1, IL-12, and IFN-{gamma} J. Immunol., March 15, 2007; 178(6): 3583 - 3592. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. McCausland, I. Yusuf, H. Tran, N. Ono, Y. Yanagi, and S. Crotty SAP Regulation of Follicular Helper CD4 T Cell Development and Humoral Immunity Is Independent of SLAM and Fyn Kinase J. Immunol., January 15, 2007; 178(2): 817 - 828. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Crotty, M. M. McCausland, R. D. Aubert, E. J. Wherry, and R. Ahmed Hypogammaglobulinemia and exacerbated CD8 T-cell-mediated immunopathology in SAP-deficient mice with chronic LCMV infection mimics human XLP disease Blood, November 1, 2006; 108(9): 3085 - 3093. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |