|
|
||||||||
1


* Department of Internal Medicine, University of Cincinnati College of Medicine, Cincinnati, OH 45267;
Childrens Research Institute, The Ohio State University College of Medicine and Public Health, Columbus, OH 43205; and
Department of Microbiology, University of Iowa and Veterans Affairs Medical Center, Iowa City, IA 52242
| Abstract |
|---|
|
|
|---|
is considered an essential stimulus that allows macrophages to acquire activity against intracellular pathogens in response to a second signal such as TNF-
. However, protection against important pathogens can take place in the absence of IFN-
through mechanisms that are still dependent on TNF-
. Engagement of CD40 modulates antimicrobial activity in macrophages. However, it is not known whether CD40 can replace IFN-
as priming signal for induction of this response. We show that CD40 primes mouse macrophages to acquire antimicrobial activity in response to TNF-
. The effect of CD40 was not caused by modulation of IL-10 and TGF-
production or TNFR expression and did not require IFN-
signaling. Induction of antimicrobial activity required cooperation between TNFR-associated factor 6-dependent CD40 signaling and TNFR2. These results support a paradigm where TNFR-associated factor 6 signaling downstream of CD40 alters the pattern of response of macrophages to TNF-
leading to induction of antimicrobial activity. | Introduction |
|---|
|
|
|---|
primes these cells followed by a second signal in the form of TNF-
or a microbial product that induces TNF-
production (1, 2). The essential role that IFN-
plays in the generation of classically activated macrophages likely explains in part why this cytokine is pivotal for control of intracellular pathogens. However, hosts with defects in IFN-
signaling exhibit mechanisms of control against many of these pathogens (3, 4, 5, 6, 7, 8, 9). Studies in IFN-
/ and IFN-
receptor/ (IFN-
R/) mice as well as in humans with congenital partial IFN-
R1 deficiency indicate that TNF-
takes a central role in host protection when IFN-
signaling is impaired (4, 5, 7, 9). Nevertheless, it is not well understood how TNF-
-dependent host protection is activated and regulated in conditions where IFN-
-signaling is deficient.
Using neutralizing mAbs against IFN-
and macrophages from IFN-
/ mice, we demonstrated that CD40-CD154 interaction, a pathway that mediates host protection against numerous intracellular pathogens (10, 11, 12, 13, 14, 15, 16), activates IFN-
-independent control of Toxoplasma gondii in human and mouse macrophages (17, 18). These studies revealed that CD40 signaling worked through autocrine production of TNF-
(17). Interestingly, TNF-
alone cannot induce anti-T. gondii activity in macrophages (19, 20, 21). These results suggest that the effect of CD40 stimulation is more complex than the mere stimulation of TNF-
secretion and raise the possibility that CD40 may modulate the response of macrophages to TNF-
.
CD40 is an important regulator of macrophage function (22). In the presence of IFN-
, CD40 signaling enhances NO production, anti-Leishmania and anti-T. gondii activity of macrophages (11, 12, 23, 24). In addition, CD40 stimulates TNF-
production by macrophages (22, 25). However, it is not known whether CD40 can replace IFN-
as the priming signal for induction of macrophage antimicrobial activity in response to TNF-
.
TNFR-associated factors (TRAFs)3 are adapter proteins critical for signaling downstream of CD40 (26, 27, 28). The intracytoplasmic tail of CD40 has two binding sites that directly recruit TRAF2 and TRAF3 and another site that directly recruits TRAF6 (29, 30, 31). The TRAF binding sites are major determinants of selectivity of the response triggered by CD40 because these sites can control nonoverlapping responses (32, 33, 34). Moreover, signaling cascades activated by CD40 and TNFR are not identical (27, 28), raising the possibility of cooperation between TNFR and CD40 for induction of effector responses in cells that express these molecules. For example, TRAF6 is directly recruited by CD40 but not TNFR (30). This recruitment is of functional relevance because TRAF6 is a major regulator of CD40 signaling. TRAF6 in B cells controls CD40-induced secretion of IL-6 and Ig, up-regulation of CD80, affinity maturation, and generation of long-lived plasma cells (32, 33). Of potential relevance to resistance against intracellular pathogens, TRAF6 regulates IL-12 production by dendritic cells stimulated through CD40 and TRAF6 is required for optimal dendritic cell maturation and activation in response to CD40 and TLR ligands (34, 35).
We report that CD40 alters the pattern of response to TNF-
allowing macrophages to acquire antimicrobial activity when stimulated with this cytokine. The TRAF6 binding site in the intracytoplasmic tail of CD40 is required for induction of antimicrobial activity in the presence of signaling through TNFR2. Thus, while the cooperation between IFN-
and TNF-
has been considered pivotal for induction of classically activated macrophages, these findings reveal heterogeneity in the mechanisms of induction of macrophages with antimicrobial activity against intracellular pathogens. Not only IFN-
but also TRAF6-dependent CD40 signaling can act as a priming signal for induction of this effector function in macrophages stimulated with TNF-
. These results may explain how IFN-
-deficient hosts activate TNF-
-dependent protection against important intracellular pathogens. In addition, this work identifies TRAF6 downstream of CD40 as an important regulator of antimicrobial activity of macrophages.
| Materials and Methods |
|---|
|
|
|---|
Specific pathogen-free female C57BL/6 and BALB/c mice were obtained from the National Cancer Institute (Frederick, MD). Female TNF-
/ (B6/129 background), TNFR1/, TNFR2/ (both on C57BL/6 background) mice and appropriate wild-type controls were purchased from The Jackson Laboratory. Female IFN-
R/ mice (BALB/c background) were obtained from The Childrens Research Institute (Columbus, OH). Animals were 68 wk old when used. Studies were approved by the University of Cincinnati Institutional Animal Care and Use Committee.
Retroviral vectors
cDNA for wild-type human CD40 (hCD40), hCD40
22 (a mutant that ablates binding to TRAF2 and TRAF3;
TRAF2, 3), hCD40EEAA (a mutant that prevents binding to TRAF6;
TRAF6), and hCD40
55 (a mutant that ablates binding to TRAF2, TRAF3, and TRAF6;
TRAF2, 3, 6) have been previously described (32, 36). CD40 cDNA were cloned into the murine stem cell virus-based bicistronic retroviral vector MIEG3 that encodes enhanced GFP (EGFP) (gift from Dr. D. Williams, Cincinnati Childrens Hospital, Cincinnati, OH) (37). XhoI site was added to CD40 constructs by PCR. Following sequence verification, fragments were cloned using StuI and XhoI sites within the polylinker region of the MIEG3 vector. Mutations were confirmed by sequencing. Ecotropic retroviral supernatants were generated by transfecting the Phoenix-gp cell line (gift from Dr. G. Nolan, Stanford University, Stanford, CA) with MIEG3-based retroviral vectors and plasmids encoding envelop and gag-pol using the calcium phosphate transfection kit (Invitrogen Life Technologies) as described (37).
Macrophages
Resident peritoneal macrophages were cultured on 8-chamber tissue culture glass slides (Falcon; BD Biosciences; 1 x 105 cells per chamber) in complete medium (CM) consisting of DMEM plus 10% FBS (HyClone). Bone-marrow derived macrophages were obtained by culturing bone marrow cells for 7 days in Teflon jars containing DMEM plus 30% L cell-conditioned medium, 10% FBS, and 5% horse serum (HyClone). Bone marrow-derived macrophages were also plated on 8-well chamber culture slides. Tissue culture reagents and parasite preparations lacked detectable levels of endotoxin (<0.015 EU/ml) using Limulus amebocyte lysate assay (Sigma-Aldrich). Macrophages were incubated for 24 h with either a stimulatory anti-CD40 (1C10) or control mAb (10 µg/ml) or recombinant mouse CD154 (3 µg/ml; Immunex). In certain experiments recombinant murine TNF-
(PeproTech) was added to macrophages as indicated. Neutralizing mAbs against TNFR1 (55R-170), TNFR2 (TR75-32), IL-10 (JES5-16E3; all from BD Biosciences), and TGF-
(1D11) were added to macrophage cultures when indicated at a final concentration of 10 µg/ml. 1D11 neutralizes all three isoforms of mammalian TGF-
(TGF-
1, TGF-
2, and TGF-
3) (38). Macrophages were incubated for 12 h with CpG (TCCATGACGTTCCTGACGTT; 4 µg/ml; Integrated DNA Technologies) to up-regulate TNFR.
To generate macrophages that express wild-type hCD40 or mutants of CD40, stem cells were obtained from C57BL/6 mice treated 2 days before with 5-fluoro-uracil (150 mg/kg i.p; Sigma-Aldrich). Stem cells were incubated for 2 days in IMDM/10% FBS with rat stem cell factor, human G-CSF, and human thrombopoietin (all at 100 ng/ml; PeproTech) followed by infection with retroviral supernatants in 6-well plates coated with Retronectin (Takara Bio). Infection was repeated after 24 h followed by addition of fresh cytokines. EGFP+ cells were sorted using FACSVantage (BD Biosciences) and cells were cultured for 7 days in IMDM/10% FBS containing mouse M-CSF (100 ng/ml; PeproTech) resulting in populations that were >85% positive for the macrophage marker F4/80. Macrophages were incubated with or without human CD154 for 48 h before infection with T. gondii.
RAW 267.4 cells were transfected with linearized pRSV.5 (neo) plasmid encoding wild-type hCD40, the extracellular domain of human CD40 with the intracellular domain of mouse CD40 (hmCD40) or with pRSV.5 alone using Lipofectamine and Plus reagent (Invitrogen Life Technologies) following manufacturers recommendations. Cells were selected in culture medium containing geneticin (800 µg/ml) and subsequently cloned under limiting dilution. Knockdown of TRAF6 was performed using phosphorothioate-modified oligodeoxyribonucleotides (ODN; Integrated DNA Technologies) targeting the 3'-untranslated region of mouse TRAF6. The antisense ODN had the following sequence: 5'-CCACAGGCCCTTCAAATG-3'. hCD40- or hmCD40-RAW cells were incubated with either sense or antisense ODN (25 µM) in the presence of Lipofectamine and Plus reagent. Cells were subsequently incubated for 48 h in CM with or without human CD154 followed by infection with T. gondii.
T. gondii infection and parasite growth
Monolayers of macrophages were washed before addition of T. gondii. Tachyzoites of the RH strain of T. gondii were used to infect monolayers at a ratio of 1.5 parasites per macrophage. Parasite replication was assessed by light microscopy (17, 18). Briefly, monolayers were washed 1 h after addition of T. gondii to remove extracellular parasites. Thereafter, monolayers were either fixed and stained with Diff-Quick (Dade Diagnostics) or monolayers were reincubated in fresh CM followed by fixation and staining 18 h after addition of T. gondii. The number of parasites per 100 macrophages in triplicate monolayers was determined by light microscopy by counting at least 200 macrophages per monolayer.
Flow cytometry
Macrophages were incubated with Fc block reagent (BD Biosciences) plus mouse IgG (10 µg/ml; Sigma-Aldrich) for 10 min at room temperature followed by addition of anti-TNFR1, anti-TNFR2, or isotype control mAbs (BD Biosciences). After a 30-min incubation on ice, cells were washed and reblocked followed by incubation with biotinylated mouse anti-hamster IgG (BD Biosciences). Cells were incubated for 30 min on ice followed by washing. Macrophages were incubated with streptavidin-PE (BD Biosciences) for 30 min. Cells were washed and fixed with 1% paraformaldehyde. Expression of TNFR was analyzed using a FACSCalibur (BD Biosciences). Macrophages infected with retroviral vectors were stained with anti-human CD40-PE (BD Biosciences), anti-F4/80-PE (Serotec), or control mAbs.
ELISA
Supernatants from monolayers of macrophages cultured in 96-well plates were collected 24 h postaddition of either anti-CD40 or isotype control mAbs and 18 h postinfection with T. gondii. Cell-free supernatants were used to measure concentrations of IL-10 (BD Biosciences) and TGF-
1 (Promega) by ELISA. TGF-
1 ELISA was performed using untreated and acid-treated supernatants to measure endogenously active and total TGF-
1, respectively. The lower limits of detection of the IL-10 and TGF-
1 ELISA were 20 pg/ml.
Immunoblot
Immunoblotting analysis was performed as previously described (18). Briefly, hCD40- or hmCD40-RAW cells incubated with Lipofectamine and Plus reagents with or without sense or antisense TRAF6 ODN were lysed after 48 h in buffer containing protease inhibitors. Lysates were separated by SDS-PAGE and transferred to a polyvinylidene difluoride membrane. Membranes were probed with either anti-TRAF2, anti-TRAF6 Ab, or anti-actin Ab (Santa Cruz Biotechnology) followed by incubation with HRP-conjugated secondary Abs (Santa Cruz Biotechnology). Bands were developed using ECL following manufacturer instructions (Pierce).
Statistical analysis
Statistical significance was assessed by Students t test and ANOVA using InStat version 3.0 (GraphPad).
| Results |
|---|
|
|
|---|

We previously demonstrated that CD154+ cells induce anti-T. gondii activity in macrophages in a CD40-CD154-dependent manner and this response can take place when CD40 is engaged after infection with the parasite (17, 18). The current studies were conducted using either stimulatory anti-CD40 mAb or recombinant CD154 because our goal was to determine whether isolated CD40 signaling modulates the response of macrophages to TNF-
and CD154+ T cells may express other factors that affect macrophage function. Resident peritoneal macrophages from TNF-
/ or wild-type mice were incubated with either stimulatory anti-CD40 or control mAbs in the presence or absence of TNF-
. In agreement with previous studies (19, 20, 21), addition of recombinant TNF-
alone (up to 50 ng/ml) did not induce anti-T. gondii activity in macrophages from either wild-type or TNF-
/ mice (Fig. 1 and data not shown). CD40 signaling induces macrophage anti-T. gondii activity through autocrine production of TNF-
(17). In keeping with these results, macrophages from wild-type but not from TNF-
/ mice acquired anti-T. gondii activity after CD40 stimulation. However, macrophages from TNF-
/ mice stimulated with the combination of stimulatory anti-CD40 mAb plus TNF-
exhibited a significant decrease in the infection rate at 18 h compared with 1 h postinfection (Fig. 1A, 43.8 ± 2.2% reduction; p = 0.002; n = 3) as well as a lower number of tachyzoites per 100 macrophages at 18 h postinfection (Fig. 1B; 47.0 ± 5.3% reduction; p = 0.001; n = 3). This decrease in parasite load was similar to that observed in CD40-stimulated macrophages from wild-type mice (p = 0.3; n = 3; Fig. 1). Induction of antimicrobial activity was not restricted to the use of a stimulatory anti-CD40 mAb because similar results were obtained when recombinant mouse CD154 engaged CD40 (data not shown). Because macrophages from TNF-
/ cannot respond through autocrine production of TNF-
, these data indicate that CD40 signaling modulates the response of macrophages to TNF-
and induces anti-T. gondii activity in response to this cytokine. In addition, these results show that both signals are essential and neither alone is sufficient to trigger antimicrobial activity.
|
, cytokines that impair TNF-
signaling (39, 40, 41, 42). Of relevance, TGF-
has been implicated in inhibition of both TNF-
production and TNFR expression in T. gondii-infected macrophages (40, 42). We determined whether CD40 affects TNF-
signaling in an IL-10 and/or TGF-
-dependent manner. Although T. gondii infection caused increased production of IL-10, CD40 stimulation did not affect IL-10 secretion in either uninfected or infected macrophages (p > 0.3; n = 3; data not shown). In the case of TGF-
, neither infection with T. gondii nor CD40 stimulation altered production of TGF-
(p = 0.7; n = 3; data not shown). Moreover, neutralizing mAbs against IL-10 and TGF-
had no effect on induction of anti-T. gondii activity in CD40-stimulated macrophages (data not shown). Taken together, CD40 modulates TNF-
-dependent antimicrobial activity independently of IL-10 and TGF-
. CD40 stimulation cooperates with TNFR2 to induce antimicrobial activity in macrophages
We determined which TNFR acts in conjunction with CD40 signaling to induce anti-T. gondii activity in macrophages. Although addition of a neutralizing anti-TNFR1 mAb to CD40-activated macrophages from B6 mice failed to affect induction of anti-T. gondii activity, addition of a neutralizing mAb against TNFR2 significantly inhibited antimicrobial activity (Fig. 2A; 64.2 ± 5.5% inhibition; p = 0.01; n = 3). Moreover, the combination of anti-TNFR1 plus anti-TNFR2 mAbs caused inhibition in anti-T. gondii activity that was similar to that of macrophages incubated with anti-TNFR2 mAb alone (p = 0.3). To further confirm that CD40 and TNFR2 cooperate to induce macrophage anti-T. gondii activity, we incubated macrophages from TNFR1/, TNFR2/ and wild-type mice with stimulatory or isotype control mAb. As shown in Fig. 2B, similar to macrophages from wild-type mice, CD40-stimulated macrophages from TNFR1/ mice significantly decreased parasite load (45.48 ± 1.9% inhibition; p < 0.001; n = 3). In contrast, macrophages from TNFR2/ were refractory to CD40 stimulation. Thus, CD40 signaling cooperates with signals triggered through TNFR2 to induce anti-T. gondii activity in macrophages.
|

In the next set of experiments, we determined whether signal through CD40 alters the response to a subsequent signal through TNFR. Given that increased expression of TNFR may enhance the response to TNF-
(43), we determined whether modulation of the response to TNF-
takes place in conditions where CD40-stimulated and control macrophages exhibit similar TNFR expression. Like peritoneal macrophages, bone marrow-derived macrophages acquire anti-T. gondii activity in response to CD40 stimulation in a manner that requires TNF-
production and TNFR expression (18). Thus, bone marrow-derived macrophages were used for these experiments. Macrophages from TNF-
/ mice exhibit similar TNFR1 and TNFR2 expression (mean fluorescence intensity) 24 h after incubation with anti-CD40 mAb (rat IgG: isotype control = 11.8 ± 1.2, TNFR1 = 13.6 ± 1.5, TNFR2 = 19.3 ± 0.8; anti-CD40 mAb: isotype control = 11.5 ± 1.3, TNFR1 = 13.6 ± 2.2, TNFR2 = 18.6 ± 2.2; n = 3; p > 0.6). In contrast, incubation with CpG for 12 h up-regulated TNFR2 expression (isotype control = 11.3 ± 0.6, TNFR1 = 13.4 ± 0.8, TNFR2 = 32.7 ± 2.0; n = 3; p = 0.005). These studies also avoided the potential effect of autocrine TNF-
production on TNFR expression because TNF-
down-regulates expression of its receptors (44). Next, macrophages from TNF-
/ mice were stimulated through CD40 alone (without TNF-
) for 24 h. Monolayers were washed followed by challenge with T. gondii, and TNF-
was added after removal of extracellular tachyzoites. Although macrophages stimulated with either CD40 or TNF-
alone did not control parasite load, CD40-primed macrophages exhibited a significant reduction in the load of tachyzoites in response to TNF-
(Fig. 3; 42.2 ± 2.4% reduction; p = 0.005; n = 3). This decrease was similar to that of CD40-stimulated macrophages from wild-type mice (p = 0.2; n = 3). Addition of recombinant TNF-
to wild-type macrophages did not affect anti-T. gondii activity (data not shown). Therefore, priming through CD40 signaling results in anti-T. gondii activity in macrophages stimulated with TNF-
. In addition, induction of antimicrobial activity occurred even when TNFR expression is unaltered.
|
Our results suggest that CD40 likely triggers a signaling cascade that is not activated by TNFR2. Recruitment of TRAF proteins to the cytoplasmic tail of CD40 is a crucial event in the intracellular signaling downstream of this receptor (45, 46, 47). Moreover, one distinguishing feature between CD40 and TNFR is that TRAF6 is directly recruited by CD40 but not TNFR (30). Thus, we hypothesized that the TRAF6 binding site of CD40 controls induction of antimicrobial activity of macrophages.
Mouse macrophages were infected with retroviral vectors that encode wild-type and mutant human CD40 (hCD40). These macrophages were used to determine which TRAF binding site in the intracytoplasmic tail of CD40 mediates induction of antimicrobial activity. These CD40 constructs have well-characterized deletions or point mutations at TRAF binding sites and have been proven to lack binding to TRAF2 and TRAF3 (
TRAF2, 3), TRAF6 (
TRAF6) or TRAF2, TRAF3 and TRAF6 (
TRAF2, 3, 6) (32, 36, 48). Infection of mouse macrophages with these vectors results in mouse cells that express hCD40. This strategy has been proven useful for dissecting the in vitro and in vivo role of TRAF binding sites in other mouse cells because hCD40 binds to mouse TRAFs triggering cellular and biochemical responses similar to those induced by mouse CD40 (32, 34, 49, 50).
Mouse stem cells were infected with MIEG3-based retroviral vectors followed by incubation with M-CSF to cause macrophage differentiation. In contrast to infection with MIEG3 alone, infection with retroviral vectors that encoded hCD40 resulted in macrophages that expressed this receptor (Fig. 4A). The percentages of hCD40+ macrophages and the levels of expression of hCD40 were similar in macrophages infected with retroviral vectors encoding either wild-type or
TRAF2, 3 and
TRAF6 mutants of CD40 (Fig. 4, B and C) (p > 0.5; n = 3). Macrophages infected with retroviral vector encoding
TRAF2, 3, 6 mutant had a higher expression of CD40 (p = 0.02; n = 3). Next, we incubated these bone marrow-derived macrophages in CM with or without hCD154. In contrast to macrophages infected with MIEG3 alone, those infected with MIEG3 encoding wild-type hCD40 significantly decreased parasite load in response to hCD154 (Fig. 4D; 54.5 ± 1.5% inhibition; p = 0.007; n = 3). Although a mutation that disrupts binding to TRAF2 and TRAF3 did not significantly affect induction of anti-T. gondii activity in response to hCD154, a mutation that impairs binding to TRAF6 or a mutation that disrupts binding to TRAF6 as well as TRAF2 and TRAF3 ablated antimicrobial activity induced by hCD154. In marked contrast, induction of anti-T. gondii activity in response to IFN-
/LPS was similar in all groups including macrophages infected with MIEG3 alone (p = 0.8; n = 3). Thus, the TRAF6 binding site in the cytoplasmic tail of CD40 is essential for induction of anti-T. gondii activity in macrophages stimulated through CD40.
|
/LPS stimulation (p = 0.6). Similar results were obtained with RAW 264.7 cells expressing a chimera consisting of the extracellular domain of hCD40 and the intracytoplasmic domain of mouse CD40 (data not shown). Next, hCD40-RAW 264.7 cells were transfected with TRAF6 antisense or sense ODN. Antisense ODN inhibited TRAF6 expression as assessed by immunoblot (Fig. 5C). In contrast, antisense ODN did not affect expression of TRAF2, another major mediator of CD40 signaling. Compared with hCD40-RAW 264.7 cells transfected with TRAF6 sense ODN, transfection with TRAF6 antisense ODN markedly inhibited (86.4 ± 7.3% inhibition; p = 0.007; n = 3) induction of T. gondii activity in response to hCD154 (Fig. 5C). Similar results were obtained with RAW 246.7 cells expressing the human/mouse CD40 chimera (data not shown). These results confirm the pivotal role of TRAF6 for induction of anti-T. gondii activity in CD40-activated macrophages.
|
production triggered by TLR (51). Given that type I IFN also modulate the response of macrophages to TNF-
(52) and appear to enhance anti-T. gondii activity of macrophages (53), we determined whether CD40 ligation requires IFN-
signaling to induce antimicrobial activity. Macrophages from wild-type and IFN-
R/ mice exhibited similar reduction in parasite load when incubated with anti-CD40 mAb (p = 0.9; n = 3; Fig. 6). Thus, the CD40-TRAF6 pathway induces macrophage antimicrobial activity independently of IFN-
signaling.
|

In the next set of experiments we determined whether the TRAF6 binding site regulates cooperation between CD40 and TNF-
signaling for induction of anti-T. gondii activity. Macrophages from TNF-
/ mice infected with retroviral vectors were stimulated by hCD154 followed by challenge with T. gondii, and addition of TNF-
. Macrophages expressing wild-type hCD40 exhibited a significant reduction in the load of tachyzoites when primed with hCD154 followed by exposure to TNF-
(Fig. 7; 57.0 ± 2.0% reduction; p = 0.001; n = 3). Similar results were obtained with macrophages that express hCD40 with a mutation that disrupts binding to TRAF2 and TRAF3. In marked contrast, macrophages with the mutation that impairs binding to TRAF6 or the mutation that disrupts binding to TRAF6 as well as TRAF2 and TRAF3 were unable to acquire anti-T. gondii activity. Induction of anti-T. gondii activity in response to IFN-
followed by TNF-
was similar in all groups of macrophages (p = 0.5; n = 3). Taken together TRAF6 signaling downstream of CD40 primes macrophages to acquire anti-T. gondii activity in response to TNF-
.
|
| Discussion |
|---|
|
|
|---|
. These results reveal heterogeneity in mechanisms of regulation of macrophage antimicrobial activity against intracellular pathogens because not only IFN-
but also TRAF6-dependent CD40 signaling can alter the pattern of response to TNF-
resulting in macrophages with this effector function. TNF-
can take center stage in control of intracellular pathogens in IFN-
-deficient hosts. Thus, these findings may explain how TNF-
-dependent host protection is activated in these immunodeficiencies.
CD40 does not modulate TNF-
signaling by inhibiting production of IL-10 and TGF-
and it appears unlikely that this effect requires up-regulation of TNFR expression. In addition, CD40 does not require IFN-
signaling to induce macrophage antimicrobial activity. We examined whether differences in signaling cascades triggered by CD40 and TNFR explain cooperation between these receptors. We hypothesized that CD40 may be acting through its binding site for TRAF6 because this adapter protein is directly recruited by CD40 but not by TNFR (30). Using expression of CD40 molecules with mutations at TRAF binding sites and knock down of TRAF6 we show that TRAF6 is necessary for induction of macrophage antimicrobial activity induced by CD40. CD40 has at least two roles in modulation of macrophage antimicrobial activity: priming of macrophages so that they acquire antimicrobial activity in response to TNF-
and stimulation of autocrine production of TNF-
(17). Using macrophages from TNF-
/ mice, we show that the TRAF6 binding site in the intracytoplasmic tail of CD40 is required for synergy between TNF-
and CD40 signals for induction of macrophage antimicrobial activity. Of note, TRAF6 has recently been reported to be critical for production of TNF-
by macrophages stimulated through CD40 (54). Thus, TRAF6 controls the two arms by which CD40 modulates TNF-
-dependent macrophage antimicrobial activity.
Qualitative differences in signaling downstream of members of the TNFR superfamily likely explain other examples of cooperation between these receptors. TNFR2 signaling is required for optimal CD40-mediated IgM production (55). In addition, CD40 ligation enhances MCP-1 production by THP-1 cells stimulated with TNF-
(56). RANK signaling primes osteoclast precursors to exhibit robust osteoclastogenesis in response to TNF-
(57, 58). The molecular basis for cooperation between CD40 and TNFR2 may lay in the demonstration that these receptors can use different cascades to activate NF-
B and MAPK (59) and the evidence that other members of the TNFR superfamily such as RANK and TNFR synergize to activate NF-
B and MAPK (57).
The selective cooperation between CD40 and TNFR2 and not TNFR1 may be explained by the fact that TNF receptors differ in their transmembrane and cytoplasmic domains (60, 61). Of potential relevance, CD154 in its membrane form is the optimal trigger of CD40 signaling (62) and while soluble TNF-
activates TNFR2 (63), membrane TNF-
is a more efficient activator of this receptor (64). This suggests a scenario where cells expressing both ligands on their membranes would act as optimal trigger of synergistic activity between CD40 and TNFR2.
CD40-CD154 signaling (10, 11, 12, 13, 14, 15, 16) and TNF-
(4, 5, 7, 65, 66, 67, 68) are pivotal for in vivo control of numerous pathogens including T. gondii. Studies in animal models of infections with intracellular pathogens including T. gondii indicate that TNFR1 is required for host protection (67, 68, 69). In the case of T. gondii, TNFR1/2/ mice exhibited earlier mortality and higher parasite load than TNFR1/ mice (67). These results as well as a recent study in human immature dendritic cells indicate that TNFR2 contributes to control of T. gondii (70). Although the in vivo role of TNFR2 in control of T. gondii is secondary to that of TNFR1 in IFN-
-sufficient mice, cooperation between CD40 and TNFR2 may acquire especial importance in IFN-
-deficient hosts because TNF-
appears to take a central role in protection against important opportunistic pathogens in these situations (4, 5, 7, 9). Of note, we have recently demonstrated that CD40 signaling enhances in vivo control of T. gondii in IFN-
/ mice independently of T cells (C. S. Subauste and M. Wessendarp, submitted for publication).
Our studies provide an example of a two-signal model that leads to macrophage activation. Although it is possible that soluble factors in addition to TNF-
modulate induction of antimicrobial activity, it is unlikely that such factors alone trigger this effector response. Not all macrophages express CD40 (17, 18). The demonstration that only CD40+ macrophages acquire anti-T. gondii activity (17, 18) indicates that signal through this receptor is an indispensable component for generation of macrophages with this effector function.
Stimulation with IFN-
plus TNF-
generates classically activated macrophages, which in mice correlates closely with production of NO (1, 2). Induction of NOS2 mRNA during the cooperation between these cytokines involves signaling through TNFR1 (71). We demonstrated that the combination of CD40 plus TNF-
signaling induces anti-T. gondii activity in macrophages independently not only of IFN-
but also of NOS2 (17, 18). Thus, the effector mechanism controlled by the CD40-TNFR2 pathways may be distinct from those induced by IFN-
, which could be explained by the difference in function attributed to the TNFRs (60, 72).
In summary, we report that synergy between TRAF6-dependent CD40 signaling and TNFR2 results in the generation of a qualitatively different response in macrophages resulting in the induction of antimicrobial activity. These findings as well as the demonstration that TRAF6 regulates maturation of dendritic cells and IL-12 production by these cells (34, 35, 73) suggest that this adapter protein plays an important role in resistance against intracellular pathogens.
| Acknowledgments |
|---|
and IL-10 ELISA, and William Fanslow and Elaine Thomas providing recombinant human and mouse CD154. | Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported by National Institutes of Health Grant AI48406 (to C.S.S) and the American Heart Association, Ohio Valley Affiliate (to C.S.S). ![]()
2 Address correspondence and reprint requests to Dr. Carlos S. Subauste, Department of Internal Medicine, University of Cincinnati College of Medicine, P.O. Box 670560 Cincinnati, OH 45267-0560. E-mail address: carlos.subauste{at}uc.edu ![]()
3 Abbreviations used in this paper: TRAF, TNFR-associated factor; hCD40, human CD40; CM, complete medium; ODN, oligodeoxyribonucleotide. ![]()
Received for publication May 5, 2005. Accepted for publication August 10, 2005.
| References |
|---|
|
|
|---|
. Immunity 3:109.-117. [Medline]
treatment ameliorate disease by an intracellular pathogen in IFN-
receptor deficient mice. J. Immunol. 157:4746.-4750. [Abstract]
: effect of interleukin-12 in experimental visceral leishmaniasis in interferon-
gene-disrupted mice. J. Exp. Med. 185:1231.-1239.
plays a critical role in maintaining secondary immunity in the absence of IFN-
. J. Immunol. 160:1359.-1368.
in IFN-
-induced killing of Toxoplasma gondii and Salmonella typhimurium contributes to selective susceptibility of patients with partial IFN-
receptor 1 deficiency. J. Immunol. 169:3900.-3907.
through a TNF-
-dependent mechanism. J. Immunol. 171:6750.-6756.
and reactive nitrogen intermediates. Infect. Immun. 73:3115.-3123.
triggers antitoxoplasmal activity of IFN-
primed macrophages. J. Immunol. 147:2340.-2345. [Abstract]
-induced L-arginine-dependent toxoplasmastatic activity in murine peritoneal macrophages is mediated through endogenous tumor necrosis factor-
. J. Immunol. 148:568.-574. [Abstract]
B activation in B lymphocytes. J. Immunol. 159:4898.-4906. [Abstract]
: bioactivity neutralization and transforming growth factor
2 affinity purification. J. Immunol. 142:1536.-1541. [Abstract]
and downregulation of expression of tumor necrosis factor receptors. Infect. Immun. 61:4126.-4130.
suppresses interferon-
-induced toxoplasmastatic activity in murine macrophages by inhibition of tumour necrosis factor-
production. Parasite Immunol. 23:169.-175. [Medline]
B and CBF1. J. Biol. Chem. 277:17125.-17138.
induction through Toll-like receptors involves a direct interaction of IRF7 with MyD88 and TRAF6. Nat. Immunol. 5:1061.-1068. [Medline]
(TNF
) by interferons: implications for the pleiotropic activities of TNF
. J. Clin. Invest. 93:1661.-1669.
Interferon inhibits Toxoplasma gondii growth in human monocyte-derived macrophages. Infect. Immun. 57:3254.-3256.
induces osteoclastogenesis by direct stimulation of macrophages exposed to permissive levels of RANK ligand. J. Clin. Invest. 106:1481.-1488. [Medline]
(TNF) stimulates RANKL-induced osteoclastogenesis via coupling of TNF type 1 receptor and RANK signaling pathways. J. Biol. Chem. 276:563.-568.
is required in the protective immune response against Mycobacterium tuberculosis in mice. Immunity 2:561.-572. [Medline]
receptor 2. J. Immunol. 173:3366.-3374. This article has been cited by other articles:
![]() |
Y. Zhao, D. Wilson, S. Matthews, and G. S. Yap Rapid Elimination of Toxoplasma gondii by Gamma Interferon-Primed Mouse Macrophages Is Independent of CD40 Signaling Infect. Immun., October 1, 2007; 75(10): 4799 - 4803. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Zirlik, U. Bavendiek, P. Libby, L. MacFarlane, N. Gerdes, J. Jagielska, S. Ernst, M. Aikawa, H. Nakano, E. Tsitsikov, et al. TRAF-1, -2, -3, -5, and -6 Are Induced in Atherosclerotic Plaques and Differentially Mediate Proinflammatory Functions of CD40L in Endothelial Cells Arterioscler Thromb Vasc Biol, May 1, 2007; 27(5): 1101 - 1107. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. S. Subauste and M. Wessendarp CD40 Restrains In Vivo Growth of Toxoplasma gondii Independently of Gamma Interferon Infect. Immun., March 1, 2006; 74(3): 1573 - 1579. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |