|
|
||||||||
CUTTING EDGE |



* Immunotherapy Center,
Department of Medicine, and
Department of Pediatrics, Medical College of Georgia, Augusta GA 30912
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Recently, we described a minor population of murine splenic DCs expressing CD19 that responded to CTLA4-Ig-mediated ligation of CD80/86 (B7) molecules by expressing the intracellular enzyme indoleamine 2,3-dioxygenase (IDO) (5). IDO catalyzes the first and rate limiting step of oxidative tryptophan catabolism, and functional IDO expression is linked mechanistically to suppression of T cell-mediated immunity in multiple systems (6). Following B7 ligation, splenic DCs acquired potent IDO-dependent regulatory functions that prevented proliferation of alloantigen-specific T cells in vitro and in vivo (7, 8). This response was highly selective as IDO up-regulation occurred exclusively in minor DC populations expressing B220, CD8
, and CD19 following B7 ligation. However, acquired T cell regulatory functions of CD19+ DCs were potent and dominant because the underlying T cell stimulatory functions of the majority of splenic (IDO) DCs were not evident until they were separated from IDO+ DCs.
In the current study, we evaluated the effects of CpG-ODN-mediated ligation of TLR9 on the T cell stimulatory functions of splenic DCs. We found that systemic administration of CpG-ODNs induced selective IFN-
-dependent activation of STAT-1 and IDO up-regulation in splenic CD19+ DCs, which acquired potent IDO-dependent T cell regulatory functions as a consequence.
| Materials and Methods |
|---|
|
|
|---|
All mice were bred in a specific pathogen-free facility at MCG. BM3 TCR-transgenic mice, IDO-deficient (IDO-knockout (KO)), and IFN-type I receptor (IFNAR)-deficient (IFNAR-KO) mice were described previously (5, 7, 9). All procedures involving mice were reviewed and approved by the local Institutional Animal Care and Use Committee.
Abs and immunohistochemistry
Details of Abs and protocols used to detect IDO, CD11c, CD19, IFN-
, IFN-
, and phospho-STAT-1 (P-STAT-1) by immunohistochemical, immunofluorescence, and cytospin staining were described previously (5, 8, 9). 120G8 mAb (10) was supplied by Schering-Plough with kind permission from Drs. G. Trinchieri (National Institute of Allergy and Infectious Diseases, National Institutes of Health) and C. Asselin-Paturel (Dardilly, France) and was biotinylated using EZ-Link NHS-LC-Biotin (no. 21336; Pierce).
CpG-ODNs
CpG-ODNs (CpG-B no.1826, TCCATGACGTTCCTGACGTT; control non-CpG-B no.2138, TCCATGAGCTTCCTGAGCTT) with fully phosporothioate backbones were purchased from Coley Pharmaceuticals. For in vivo treatment, mice were injected i.v. with relatively high doses of ODN (50 µg/mouse); in previous reports, doses up to 20 µg/mouse were used to induce IDO in lung (11). For in vitro treatment, DCs were incubated with CpG-ODNs at 12.5 µg/ml.
Preparation of DCs and MLRs
Procedures for isolating DCs and DC subsets from spleen and to evaluate their T cell stimulatory functions in vitro using responder T cells from BM3 TCR-transgenic mice were described previously (5, 8). In brief, freshly isolated spleens were injected with collagenase, and homogenous cell suspensions were prepared by disrupting tissues. Cells were stained with Abs and AutoMacs (CD11c+; >80% enriched), or preparative flow cytometric methods (>98% pure) were used to select specific DC populations. DCs were mixed with BM3 responder T cells and T cell proliferation assessed after 72 h in a thymidine incorporation assay.
Preparative and analytical flow cytometry
Preparative cell sorts were performed on cells stained with fluorochrome-conjugated mAbs (sources as detailed above) using a Mo-Flo 4 way flow cytometer (DakoCytomation) equipped with 488 nm argon (for FITC, PE, PE-CY5) and 647 nm krypton (for allophycocyanin) lasers. Cells were gated based on forward and side scatter properties and on marker combinations to select cells of interest. Analytical flow cytometry to detect intracellular P-STAT-1 was performed by staining splenocytes from CpG-ODN-treated mice with CD11c and CD19 mAbs before fixing cells and staining with rabbit anti-mouse P-STAT-1
(Tyr701) Ab using the manufacturers protocol.
Western blot analysis to detect P-STAT-1
Cell lysates from freshly isolated splenocytes were gel electrophoresed and stained to detect P-STAT-1
and
-actin using Ab manufacturers protocols, as described previously (12).
| Results and Discussion |
|---|
|
|
|---|
B6 mice were injected i.v. with relatively high doses (50 µg/mouse) of CpG-ODN (no. 1826; CpG-B) or non-CpG-ODN (no. 2138) with a near-identical DNA sequence containing no CpG motifs, and IDO expression was assessed 24 h later by immunohistochemical analysis of spleen. In CpG-ODN-treated mice, IDO+ cells were dispersed throughout splenic red pulp, but not in lymphoid follicles (Fig. 1A), and displayed a distinctive plasmacytoid-like morphology (data not shown). Similar patterns of IDO expression were observed in mice exposed to soluble CTLA4 (CTLA4-Ig), which ligates B7 molecules (5, 8). As in these previous studies, few IDO+ cells were present in spleen of untreated mice, and treatment with non-CpG-ODN did not increase the number of IDO+ cells (Fig. 1B). IDO up-regulation in spleen was not detected when mice were treated with lower amounts of CpG-ODNs injected i.v. (no. 1826,
40 µg) or when CpG-ODNs (no. 1826; 50 µg) were injected into the peritoneum (data not shown). Two-color immunofluorescence staining revealed that many IDO+ cells coexpressed CD19 (Fig. 1C). In contrast, CD19+ cells located in lymphoid follicles (i.e., B cells) did not coexpress IDO. No increases in numbers of IDO+ cells were observed in other lymphoid tissues from mice exposed to CpG-ODNs (data not shown).
|
IDO up-regulation in DCs following CpG-ODN administration appears paradoxical because CpG-ODNs have potent immunostimulatory properties (4), and induced IDO expression correlates with potent inhibition of T cell-mediated adaptive immunity in experimental models of tumor growth, tissue transplantation, autoimmune disease, and pregnancy (6, 13). One potential resolution of this paradox is that high doses of CpG-ODNs (
50 µg/mouse) administered i.v. were needed to up-regulate IDO in spleen. Recently, Raz and colleagues (11) reported that CpG-ODNs suppressed symptoms of asthma in an experimental mouse model due to induction of IDO. In this study, 20 µg/mouse of CpG-ODNs were injected i.v., which induced IDO in lung DCs and epithelial cells. However, this lower dosing regimen did not induce IDO activity in spleen. Our findings were consistent with these outcomes because 50 µg/mouse of CpG-ODN no. 1826 was the minimum dose required to up-regulate IDO in spleen. It is unclear why injection of 50 µg/mouse of CpG-ODN into the peritoneum did not induce IDO in spleen; presumably, this is due to different pharmacokinetics of CpG-ODNs administered directly into blood or into the peritoneum. Highly selective IDO induction in splenic CD19+ DC populations was also observed in our previous studies using CTLA4-Ig as a B7 ligand (5, 8).
CpG-ODNs induce CD19+ DCs to mediate IDO-dependent T cell suppression
To test whether CpG-ODN (i.v.) administration affected T cell stimulatory functions of splenic DCs, we purified specific DC populations from spleen of CpG-ODN-treated mice and assessed their ability to stimulate T cell proliferation in vitro, as described previously (5, 8). Splenic CD11c+ (AutoMacs enriched) DCs from B6 (wild-type) mice exposed to CpG-ODNs (no. 1826) did not stimulate T cell proliferation (Fig. 2A). However, addition of IDO inhibitor 1-methyl-D-tryptophan (1mT) (100 µM) or excess tryptophan (10x Trp, 250 µM final) to MLRs restored potent T cell stimulatory functions DCs from CpG-ODN-treated mice. In contrast, DCs from IDO-KO (B6) mice treated with CpG-ODNs stimulated robust T cell responses that were not enhanced by addition of 1mT or excess tryptophan.
|
1525% of total splenic CD11c+ DCs). However, as in previous studies with DCs from CTLA4-Ig-treated mice (5, 8), T cell regulatory functions of these minor DC populations predominated over the T cell stimulatory functions of the majority of splenic DCs (e.g., CD11chighCD19 DCs and pDCs), which manifested only when they were separated from DCs that mediated IDO-dependent T cell suppression (Fig. 2 and data not shown). Thus, IDO-dependent suppression was mediated exclusively by a discrete, minor population of splenic CD19+ DCs that could be distinguished from pDCs expressing 120G8 following systemic exposure to CpG-ODNs. In a recent study, Fallarino et al. (14) reported that splenic pDCs, defined as CD11c+B220+120G8+, suppressed T cell-mediated delayed-type hypersensitivity responses following CD200R ligation due to selective IDO induction in this DC subset. In the current study, systemic CpG-ODN exposure did not inhibit the robust T cell stimulatory functions of pDCs, defined as CD11clow120G8+. The distinct outcomes from the two studies might arise for several reasons, including use of different mouse strains, different ligands to induce IDO (which may act on distinct DC populations), and use of different methods to isolate DC populations and to assess their T cell stimulatory functions. Because IDO-dependent T cell suppressive functions of splenic CD19+ DCs were both potent and dominant (as well as exclusive) properties of these DCs, immunoregulatory outcomes could emerge when minor cohorts of CD19+ DCs are present among much larger cohorts of other DCs with T cell stimulatory functions.
IFN-
signaling is essential for STAT-1 activation and IDO up-regulation in CD19+ DCs
To examine the mechanism of IDO up-regulation following CpG-ODN treatment, we injected CpG-ODNs into mice with defective IFN type I receptors (IFNAR-KO) and control BALB/c mice and assessed IDO expression in spleen as before. As in B6 mice, CpG-ODNs (no. 1826) induced IDO expression in spleen of BALB/c mice (Fig. 3A). In contrast, CpG-ODNs did not induce IDO up-regulation in spleens of IFNAR-KO mice (Fig. 3B). IFN-
signaling was also essential for STAT-1 activation because P-STAT-1 was not induced in splenocytes from IFNAR-KO (B6 background) mice exposed to CpG-ODNs, while STAT-1 activation was detected in splenocytes from treated IFN-
R-KO (129/SvJ background) mice (Fig. 3C). This response was highly selective as P-STAT-1 was detected exclusively in CD19+ DCs following flow cytometric analyses (Fig. 3D).
|
50% of DCs and had translocated to nuclei of
30% of DCs (Fig. 3E). This response was not observed when CD11c+ DCs were incubated with non-CpG-ODNs at the same concentration (data not shown). Addition of anti-IFN-
mAb to cultures had no effect on STAT-1 activation induced by CpG-ODNs. However, STAT-1 activation was blocked completely when anti-IFN-
mAb was present. Collectively, these data revealed that IFN-
, but not IFN-
, signaling was essential for STAT-1 activation and IDO up-regulation in CD19+ DCs following CpG-ODN treatment.
The outcomes reported above implied that IFN-
production occurred before selective STAT-1 activation in CD19+ DCs after CpG-ODN treatment. Based on previous studies (15, 16, 17, 18), pDCs are a likely source of IFN-
after CpG-ODN treatment. Purified CD11chigh and CD11clow DCs secreted IFN-
rapidly after culture with CpG-ODNs (10 µg/ml, 5 h; data not shown). Because highly purified CD19+CD11chigh DCs up-regulated IDO after culture with CpG-ODNs (Fig. 1D), these DCs may also express sufficient IFN-
to induce STAT-1 activation and IDO up-regulation following TLR9 ligation (at least in vitro). Thus, IFN-
from pDCs may signal STAT-1 activation and subsequent IDO up-regulation in CD19+ DCs via a paracrine mechanism, although the possibility that CD19+ DCs also produce IFN-
following CpG-ODN treatment cannot be excluded completely. Recent reports show that a cationic lipid N-[1-(2,3 dioleoyloxy)propyl]-N,N,N-trimethylammonium methylsulfate enhanced TLR9-mediated IFN-
production by DCs (17, 18). Because DOTAP was not required to induce IDO after CpG-ODN treatment, relatively low amounts of IFN-
may be sufficient to signal IDO up-regulation by CD19+ DCs. These issues notwithstanding, the key point is that rapid IFN-
production by DCs in response to TLR-9 ligation, whether autocrine or paracrine, is a critical mechanistic event that causes selective IDO induction in CD19+ DCs.
Microbial DNA containing unmethylated CpG motifs stimulates immune cell maturation and IFN-
production in humans and mice (2, 4, 19). Classically, both events have been considered proinflammatory. However, it is not unusual in the immune system for proinflammatory stimuli to also elicit counterregulatory, anti-inflammatory responses that follow in short sequence. In mice, microbial infections, bacterial DNA containing CpG motifs, and synthetic CpG-ODNs induce a unique subset of splenic (B220+,CD11clow,120G8+) pDCs to produce IFN-
(10, 15, 16). In these (as in many other) previous studies, CD19 was used as an exclusion marker to remove B cells during purification of DC populations. Hence, to our knowledge, the effects of CpG-ODNs on CD19+ (CD11chigh120G8) DCs identified in the current study, which accounted for <20% of all splenic DCs, have not been described previously. CD19+ DCs were the principal DC population to activate STAT-1, up-regulate IDO, and acquire potent IDO-dependent T cell-suppressive functions following i.v. administration of relatively high doses of CpG-ODNs to B6 mice. These responses by CD19+ DCs were dependent on IFN-
signaling, suggesting that CD19+ DCs may be specialized to respond to CpG-ODN-mediated TLR9 ligation by producing IFN-
themselves or by responding to IFN-
produced by pDCs in response to TLR9 ligation. The different anatomic locations of IDO+CD19+ DCs in splenic red pulp and pDCs, which reside in T cell areas of secondary lymphoid tissues (10), testifies to the distinctive characteristics of these DC subsets, even though they share some morphologic (plasmacytoid) and phenotypic (B220+) characteristics. By ligating B7 molecules, CTLA4-Ig induced IFN-
-dependent STAT-1 activation and IDO up-regulation in a closely related (if not identical) population of splenic CD19+ DCs that coexpressed B220 and/or CD8
(5, 8). Thus, splenic CD19+ DCs are specialized to respond to IFN-
induced after TLR9 and B7 ligation by acquiring potent IDO-dependent T cell regulatory functions.
The potent immunostimulatory effects of CpG-ODNs have been well characterized, and CpG-ODNs are currently being evaluated clinically as vaccine adjuvants to enhance T cell-mediated antitumor immunity in cancer patients. However, CpG-ODNs also inhibited Th2-mediated inflammation in experimentally induced asthma (11). The inducible IDO-dependent T cell regulatory functions of splenic CD19+ DCs may explain some of the counterinflammatory effects of DNA and ODNs containing CpG motifs. However, the remarkable dichotomy of functional effects induced by CpG-ODNs emphasizes the critical need to identify underlying biological mechanisms that determine responses to CpG-ODNs as immunomodulatory reagents.
| Acknowledgments |
|---|
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported by National Institutes of Health Grants HD41187 and AI063402 (to A.L.M.) and CA103320 and CA096651 (to D.H.M.). ![]()
2 Address correspondence and reprint requests to Dr. Andrew L. Mellor, Director, Immunotherapy Center, Medical College of Georgia, 1120 15th Street, Augusta, GA 30912. E-mail address: amellor{at}mcg.edu ![]()
3 Abbreviations used in this paper: CpG-ODNs, oligonucleotides containing (no) unmethylated CpG motifs; DC, dendritic cell; IDO, indoleamine 2,3-dioxygenase; KO, knockout; 1mT, 1-methyl-D-tryptophan; P-STAT-1, phosphorylated STAT-1; pDC, plasmacytoid DC; DOTAP, N-[1-(2,3 dioleoyloxy)propyl]-N,N,N-trimethylammonium methylsulfate; IFNAR, interferon type I receptor. ![]()
Received for publication June 6, 2005. Accepted for publication September 2, 2005.
| References |
|---|
|
|
|---|
+ dendritic cells. Int. Immunol. 14:65.-68. This article has been cited by other articles:
![]() |
F. Fallarino, C. Volpi, T. Zelante, C. Vacca, M. Calvitti, M. C. Fioretti, P. Puccetti, L. Romani, and U. Grohmann IDO Mediates TLR9-Driven Protection from Experimental Autoimmune Diabetes J. Immunol., November 15, 2009; 183(10): 6303 - 6312. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Baban, P. R. Chandler, M. D. Sharma, J. Pihkala, P. A. Koni, D. H. Munn, and A. L. Mellor IDO Activates Regulatory T Cells and Blocks Their Conversion into Th17-Like T Cells J. Immunol., August 15, 2009; 183(4): 2475 - 2483. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. K. Sharma, K. G. Elpek, E. S. Yolcu, R.-H. Schabowsky, H. Zhao, L. Bandura-Morgan, and H. Shirwan Costimulation as a Platform for the Development of Vaccines: A Peptide-Based Vaccine Containing a Novel Form of 4-1BB Ligand Eradicates Established Tumors Cancer Res., May 15, 2009; 69(10): 4319 - 4326. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Zeng, S. Cai, Y. Yi, Y. He, Z. Wang, G. Jiang, X. Li, and J. Du Prevention of Spontaneous Tumor Development in a ret Transgenic Mouse Model by Ret Peptide Vaccination with Indoleamine 2,3-Dioxygenase Inhibitor 1-Methyl Tryptophan Cancer Res., May 1, 2009; 69(9): 3963 - 3970. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Muller, M. D. Sharma, P. R. Chandler, J. B. DuHadaway, M. E. Everhart, B. A. Johnson III, D. J. Kahler, J. Pihkala, A. P. Soler, D. H. Munn, et al. Chronic inflammation that facilitates tumor progression creates local immune suppression by inducing indoleamine 2,3 dioxygenase PNAS, November 4, 2008; 105(44): 17073 - 17078. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Chen, X. Liang, A. J. Peterson, D. H. Munn, and B. R. Blazar The Indoleamine 2,3-Dioxygenase Pathway Is Essential for Human Plasmacytoid Dendritic Cell-Induced Adaptive T Regulatory Cell Generation J. Immunol., October 15, 2008; 181(8): 5396 - 5404. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Bochtler, A. Kroger, R. Schirmbeck, and J. Reimann Type I IFN-Induced, NKT Cell-Mediated Negative Control of CD8 T Cell Priming by Dendritic Cells J. Immunol., August 1, 2008; 181(3): 1633 - 1643. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. G. Molenkamp, B. J.R. Sluijter, P. A.M. van Leeuwen, S. J.A.M. Santegoets, S. Meijer, P. G.J.T.B. Wijnands, J. B.A.G. Haanen, A. J.M. van den Eertwegh, R. J. Scheper, and T. D. de Gruijl Local Administration of PF-3512676 CpG-B Instigates Tumor-Specific CD8+ T-Cell Reactivity in Melanoma Patients Clin. Cancer Res., July 15, 2008; 14(14): 4532 - 4542. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Nierkens, M. H. den Brok, R. P.M. Sutmuller, O. M. Grauer, E. Bennink, M. E. Morgan, C. G. Figdor, T. J.M. Ruers, and G. J. Adema In vivo Colocalization of Antigen and CpG within Dendritic Cells Is Associated with the Efficacy of Cancer Immunotherapy Cancer Res., July 1, 2008; 68(13): 5390 - 5396. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Lampropoulou, K. Hoehlig, T. Roch, P. Neves, E. C. Gomez, C. H. Sweenie, Y. Hao, A. A. Freitas, U. Steinhoff, S. M. Anderton, et al. TLR-Activated B Cells Suppress T Cell-Mediated Autoimmunity J. Immunol., April 1, 2008; 180(7): 4763 - 4773. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. K. Jasperson, C. Bucher, A. Panoskaltsis-Mortari, P. A. Taylor, A. L. Mellor, D. H. Munn, and B. R. Blazar Indoleamine 2,3-dioxygenase is a critical regulator of acute graft-versus-host disease lethality Blood, March 15, 2008; 111(6): 3257 - 3265. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. John and P. J. Nelson Dendritic Cells in the Kidney J. Am. Soc. Nephrol., October 1, 2007; 18(10): 2628 - 2635. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. J. E. Raveney and D. J. Morgan Dynamic Control of Self-Specific CD8+ T Cell Responses via a Combination of Signals Mediated by Dendritic Cells J. Immunol., September 1, 2007; 179(5): 2870 - 2879. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-J. Wu, H. Sawaya, B. Binstadt, M. Brickelmaier, A. Blasius, L. Gorelik, U. Mahmood, R. Weissleder, J. Carulli, C. Benoist, et al. Inflammatory arthritis can be reined in by CpG-induced DC NK cell cross talk J. Exp. Med., August 6, 2007; 204(8): 1911 - 1922. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Watanabe, M. Fujimoto, N. Ishiura, Y. Kuwano, H. Nakashima, N. Yazawa, H. Okochi, S. Sato, T. F. Tedder, and K. Tamaki CD19 Expression in B Cells Is Important for Suppression of Contact Hypersensitivity Am. J. Pathol., August 1, 2007; 171(2): 560 - 570. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. C. Prendergast and E. M. Jaffee Cancer Immunologists and Cancer Biologists: Why We Didn't Talk Then but Need to Now Cancer Res., April 15, 2007; 67(8): 3500 - 3504. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Boasso, J.-P. Herbeuval, A. W. Hardy, S. A. Anderson, M. J. Dolan, D. Fuchs, and G. M. Shearer HIV inhibits CD4+ T-cell proliferation by inducing indoleamine 2,3-dioxygenase in plasmacytoid dendritic cells Blood, April 15, 2007; 109(8): 3351 - 3359. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Liu, H. Dai, N. Wan, T. Wang, S. Bertera, M. Trucco, and Z. Dai Suppression of Memory CD8 T Cell Generation and Function by Tryptophan Catabolism J. Immunol., April 1, 2007; 178(7): 4260 - 4266. [Abstract] [Full Text] [PDF] |
||||
![]() |
D.-Y. Hou, A. J. Muller, M. D. Sharma, J. DuHadaway, T. Banerjee, M. Johnson, A. L. Mellor, G. C. Prendergast, and D. H. Munn Inhibition of Indoleamine 2,3-Dioxygenase in Dendritic Cells by Stereoisomers of 1-Methyl-Tryptophan Correlates with Antitumor Responses Cancer Res., January 15, 2007; 67(2): 792 - 801. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. Murray, M. R. Siddiqui, M. Mendillo, J. Krahenbuhl, and G. Kaplan Mycobacterium leprae Inhibits Dendritic Cell Activation and Maturation J. Immunol., January 1, 2007; 178(1): 338 - 344. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. L. Seymour, V. Ganapathy, A. L. Mellor, and D. H. Munn A high-affinity, tryptophan-selective amino acid transport system in human macrophages J. Leukoc. Biol., December 1, 2006; 80(6): 1320 - 1327. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Romani, F. Bistoni, K. Perruccio, C. Montagnoli, R. Gaziano, S. Bozza, P. Bonifazi, G. Bistoni, G. Rasi, A. Velardi, et al. Thymosin {alpha}1 activates dendritic cell tryptophan catabolism and establishes a regulatory environment for balance of inflammation and tolerance Blood, October 1, 2006; 108(7): 2265 - 2274. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Sjolin, S. H. Robbins, G. Bessou, A. Hidmark, E. Tomasello, M. Johansson, H. Hall, F. Charifi, G. B. K. Hedestam, C. A. Biron, et al. DAP12 Signaling Regulates Plasmacytoid Dendritic Cell Homeostasis and Down-Modulates Their Function during Viral Infection. J. Immunol., September 1, 2006; 177(5): 2908 - 2916. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |