The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wüthrich, M.
Right arrow Articles by Klein, B. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wüthrich, M.
Right arrow Articles by Klein, B. S.
The Journal of Immunology, 2005, 175: 5288-5297.
Copyright © 2005 by The American Association of Immunologists

IL-12 Is Required for Induction but Not Maintenance of Protective, Memory Responses to Blastomyces dermatitidis: Implications for Vaccine Development in Immune-Deficient Hosts1

Marcel Wüthrich2,*, Tom Warner{dagger} and Bruce S. Klein*,{ddagger},§,¶

* Department of Pediatrics, {dagger} Department of Pathology and Laboratory Medicine, {ddagger} Department of Internal Medicine, § Department of Medical Microbiology and Immunology, and The Comprehensive Cancer Center, University of Wisconsin Medical School, University of Wisconsin Hospital and Clinics, Madison, WI 53792


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Cellular immunity mediated by T lymphocytes, in particular CD4+ and CD8+ type 1 (T1) cells, is the main defense against pathogenic fungi. IL-12 initiates T1 cell development and cell-mediated immunity, but it is unclear whether IL-12 contributes to the maintenance of an antifungal T1 response. In this study, we addressed the role of IL-12 for vaccine-induced memory T cell development against experimental pulmonary blastomycosis. CD4+ T cells absolutely required IL-12 to control a live genetically engineered attenuated strain of Blastomyces dermatitidis given s.c. as a vaccine, whereas CD8+ T cells were significantly less dependent on IL-12. Despite differential dependency of T cell subsets on IL-12 during vaccination, neither subset acquired memory immunity in the absence of IL-12. In contrast, adoptive transfer of immune CD4 T cells from wild-type mice into IL-12–/– mice showed that CD4+ T1 memory cells sustained a T1 cytokine profile and remained protective over a period of 6 mo posttransfer. Similarly, memory CD8 cells elicited in IL-12–/– mice with killed yeast and transient rIL-12 treatment (during vaccination) remained durable and protective after animals were rested for 3 mo. In conclusion, these studies demonstrate that once CD4 and CD8 cells have acquired a protective T1 phenotype they no longer require the presence of IL-12 to maintain antifungal protective memory.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Protective immunity to infections with dimorphic fungi such as Blastomyces dermatitidis requires type 1 (T1)3-dependent cell-mediated immunity (1, 2, 3, 4) and can be mediated by CD4+ (4) and CD8+ T cells (5). Resistance by both T cell subsets requires production of T1 cytokines, particularly IFN-{gamma} and TNF-{alpha}. IL-12 induces IFN-{gamma} production from T and NK cells (6, 7), promotes the differentiation of T1 cells from naive T cells (8, 9, 10, 11), and therefore regulates cell-mediated immunity against fungal and parasitic diseases.

IL-12 is required to control primary infections with Leishmania major and Toxoplasma gondii (12, 13). Without IL-12, resistant strains of mice infected with L. major fail to develop a T1 response and control infection (13). Similarly, IL-12-deficient mice infected with T. gondii succumb during the first 2 wk of infection (12). In contrast, wild-type mice and IL-12–/– mice treated with IL-12 for the first few weeks of infection develop T1 responses and resolve Leishmania and Toxoplasma infection (12, 13).

However, once a T1 response is established, the role of IL-12 in its maintenance is less clear. Soon after discovery of IL-12 (7, 14), its role in sustaining T1 responses and protective immunity was thought to be minimal (15, 16, 17, 18). Studies used neutralizing mAbs to address the role of IL-12 in chronic resistance to Leishmania (15) and Toxoplasma (16) or immunity to reinfection with Listeria (17) and Histoplasma (19). IL-12 neutralization failed to reverse established resistance or vaccine immunity. The conclusion was that after initial Ag priming and exposure to IL-12, T1-differentiated lymphocytes exert their functions independent of IL-12. Recent studies have challenged the idea that IL-12 is only required for initiation of T1 immunity (12, 13, 20, 21). They have pointed out the technical limitations of cytokine neutralization. In the earlier studies, anti-IL-12 mAb had been given as one injection upon secondary infection, and residual IL-12 may have sustained T1 responses. In addition, CD8+ T cells have been shown to play a role in secondary infection in those models. CD8+ T cells may not depend on IFN-{gamma} production for effector function, and when they do, they can rely on IL-12 less than CD4+ T cells (22).

Use of IL-12 knockout (KO) mice has circumvented limitations of cytokine neutralization and changed views on the role of IL-12 in sustaining T cell memory. L. major-infected IL-12 p40–/– mice transiently treated with rIL-12 for the first few weeks of infection controlled primary infection and developed an Ag-specific T1 response (13). However, on rechallenge, these mice lost protective immunity and exhibited a type 2 (T2) response. IL-12–/– mice transiently treated with rIL-12 also eventually developed progressive lesions at the primary site of infection in the absence of rechallenge. These observations were not unique to L. major. IL-12–/– mice infected with T. gondii and treated with rIL-12 developed T1-dependent resistance, which was lost after rIL-12 was stopped (12). Reactivation was due to a loss of T-dependent IFN-{gamma} production, rather than increase in T2 cytokine expression. Thus, in more stringent models, continuous IL-12 was required to maintain antiparasite memory immunity.

A growing proportion of patients who develop invasive fungal infections are vulnerable due to immune deficiencies, including impaired IL-12 production (23, 24). We have genetically engineered a strain of B. dermatitidis that serves as an effective attenuated vaccine, including in hosts with diverse immune deficits extending to T1 cytokine and CD4 T cells (4, 5). Because of the critical role of IL-12 in microbial immunity, the discrepant findings on its role in maintenance of T cell memory and the model of vaccine immunity we have developed, we explored the role of IL-12 during three crucial stages of vaccine resistance to fungi: control of the attenuated vaccine and the induction and maintenance phases of vaccine immunity. We report that IL-12 is essential for the induction of vaccine-induced CD4+ and CD8+ T cell effector functions; however, in contrast, T cell memory and maintenance of T1 phenotypes was not dependent on continues IL-12 signaling. Moreover, the initial control of the vaccine by CD4+ T cells was strictly IL-12 dependent, whereas CD8+ T cells were less dependent on IL-12. Hence, in contrast to T1 cell memory against L. major and T. gondii, IL-12 is only necessary for the initiation but not the maintenance of cellular immunity to the systemic fungal pathogen B. dermatitidis.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 Disclosures
 References
 
Fungi

Strains used were the ATCC 26199 wild-type strain of B. dermatitidis (25) and the isogenic, attenuated mutant lacking BAD1, designated strain no. 55 (26). Isolates of B. dermatitidis were maintained as yeast on Middlebrook 7H10 agar with oleic acid-albumin complex (Sigma-Aldrich) at 39°C.

Mouse strains

Inbred strains of mice, including C57BL/6 (B6), the T lymphocyte-specific Thy 1.1 allele carrying congenic B6 strain B6.PL-Thy1a/Cy (stock no. 000406) (27), B6.129-IL-12btm1Jm (stock no. 002693) (28), were obtained from The Jackson Laboratory. Male mice were 7–8 wk of age at the time of these experiments and housed and cared for according to guidelines of the University of Wisconsin Animal Care Committee, who approved all aspects of this work.

In vivo cell depletion

CD4+ and CD8+ T cells were depleted by mAb treatment as described previously (4, 5). Mice received 100 µg of anti-CD4 (mAb GK1.5 rat IgG2b) or anti-CD8 (mAb 2.43 rat IgG2b) i.v. 1 day before vaccination/infection and weekly afterward. Cell depletion was analyzed by FACS and showed >95% depletion of desired subsets in the peripheral blood and lung (data not shown).

Real-time RT-PCR

Lung cells of individual mice (six to eight per group) were harvested 48–60 h postinfection with 2 x 103 26199 yeast, and total RNA was isolated using the RNeasy Mini kit (Qiagen) as described previously (5). A total of 0.5–1 µg of RNA in a final volume of 20 µl was reverse transcribed using random hexamers and the TaqMan RT-PCR kit (Applied Biosystems). Five microliters of a 1/10 dilution of cDNA were amplified in a final volume of 25 µl of PCR using SYBR Green Supermix (Bio-Rad). The following intron-spanning primers were used at a final concentration of 100 nM: IFN-{gamma} (forward, TGCATTCATGAGTATTGCCAAGT; reverse, CGCTTCCTGAGGCTGGATT) spans 2.3 kb intron; TNF-{alpha} (forward, TGGCCTCCCTCTCATCAGTT; reverse, TCCTCCACTTGGTGGTTTGC) spans 470 bp intron; GM-CSF (forward, GGGCGCCTTGAACATGAC; reverse, TTGTGTTTCACAGTCCGTTTCC) spans 869 bp intron; IL-4 (forward, GAGACTCTTTCGGGCTTTTCG; reverse, AGGCTTTCCAGGAAGTCTTTCA) spans 1244 bp intron; IL-5 (forward, GAGCTCTGTTGACAAGCAATGAGA; reverse, CAGTATGTCTAGCCCCTGAAAGATT) spans 1870 bp intron; IL-10 (forward, CTGAGGCGCTGTCATCGATT; reverse, TGGCCTTGTAGACACCTTGGT) spans 1620 bp intron, IL-13 (forward, GGAGCTGAGCAACATCACACA; reverse, CCAGGTCCACACTCCATACCA) spans 1279 bp intron; TGF-{beta}1 (forward, GGAGAGCCCTGGATACCAACT; reverse, TCCAACCCAGGTCCTTCCTA) spans 6831 bp intron; and 18S rRNA as an endogenous control gene (forward, CGCCGCTAGAGGTGAAATTCT; reverse, CGAACCTCCGACTTTCGTTCT). Amplification was done in an iCycler iQ real-time PCR detection system (Bio-Rad) and assayed under the same conditions for all targets: 5 min at 95°C, 40 cycles of 15 s at 95°C and 45 s at 60°C. Transcript quantity was calculated using the comparative CT method (29) and reported as n-fold difference relative to a calibrator cDNA (i.e., from unvaccinated mice). Data are an average of two independent experiments.

Intracellular cytokine staining

Lung cells from individual mice were harvested at day 4 postinfection with 2 x 103 26199 yeast. The isolated lung cells (0.5 x 106 cells/ml) were stimulated for 4 h with anti-CD3 (clone 145-2C11; 0.1 µg/ml) and anti-CD28 (clone 37.51; 1 µg/ml) in the presence of 2 µM monensin (Sigma-Aldrich) to halt egress of cytokines from the cells. After cells were washed and stained for surface CD4 and CD8 using anti-CD4 FITC, anti-CD8 CyChrome, and CD44-allophycocyanin mAbs (clones H129.19, 53-6.7, and IM7; BD Pharmingen), they were fixed in 2% paraformaldehyde at 4°C overnight and permeabilized the next day with 0.1% saponin in PBS containing 0.1% BSA and 0.1% sodium azide. Permeabilized cells were stained with PE-conjugated mAbs and isotype controls (BD Pharmingen) for IFN-{gamma} (clone XMG1.2), TNF-{alpha} (clone MP6-XT22), GM-CSF (clone MP1-22E9), IL-4 (11B11), and IL-10 (JES5-16E3) in 20% mouse serum for 30 min at 4°C, washed, and analyzed by FACS. Lymphocytes were gated on CD4 or CD8 and CD44-high, and cytokine expression in each gate was analyzed. The number of cytokine producing CD4+ and CD8+ T cells per lung was calculated by multiplying the percentage of cytokine producing cells by the number of CD4+ and CD8+ cells in the lung.

Cytokine protein measurements

Cell-culture supernatants were generated in 24-well plates in 1 ml containing 5 x 106 splenocytes and 5 µg/ml Con A or 12.5 µg/ml Blastomyces yeast cell wall/membrane Ag (3). Cell wall/membrane Ag contained <0.1 endotoxin unit/ml. Supernatants were collected after 96 h of coculture. IFN-{gamma}, GM-CSF, IL-4, IL-10, and TGF-{beta}1 (R&D Systems) were measured by ELISA according to manufacturer specifications (detection limits were 0.05, 0.02, 0.05, 0.04, and 0.05 ng/ml, respectively).

Vaccination, in vivo treatment with rIL-12, and experimental infection with B. dermatitidis

Mice were vaccinated as previously described (3) twice, 2 wk apart, each time receiving a s.c. injection of 104 no. 55 yeast at each of two sites, dorsally and at the base of the tail, unless otherwise stated. In some experiments, 106 killed yeast at each site of injection were used for vaccination to circumvent dissemination in IL-12–/– mice. As previously reported, vaccination with identical numbers of killed vs live yeast yielded a reduced vaccine induced resistance by killed yeast (3). Therefore, we used 100 times more killed yeast than live yeast for vaccination. This maneuver yielded similar levels of resistance in wild-type mice. To kill strain no. 55, yeast were mixed in 2 mg/ml Thimerosal (Sigma-Aldrich) in PBS and rotated for 3 h at room temperature and then overnight at 4°C. The efficiency of the treatment was verified by plating yeast on Brain heart infusion-agar and was consistently uniformly lethal.

Recombinant murine IL-12 (lot no. 6D23F3.4.6) was a gift of the Genetics Institute (Cambridge, MA). Mice received daily i.p. injections of 0.25 µg IL-12 in 0.25 ml of PBS containing 1% normal serum from B6 males, or got vehicle alone, as reported for the first week of vaccination (12, 30). After a week of treatment, some mice showed ruffled fur, weight loss and reduced activity indicating that rIL-12 treatment induced toxicity. Thus, thereafter we gave rIL-12 every other day.

Mice were infected intratracheally (i.t.) with 2 x 102 to 2 x 103 wild-type strain 26199 yeast as described previously (3). Infected mice were monitored for survival or analyzed 2 wk after infection for extent of lung infection, determined by plating of homogenized lung and enumeration of yeast colony-forming units on Brain heart infusion (Difco) agar. To distinguish wild-type strain 26199 yeast from vaccine strain no. 55 (containing a selectable marker) in tissue homogenates, samples were plated on brain heart infusion with and without 100 µg/ml hygromycin B (26).

Generation and adoptive transfer of immune T cells and analysis of their proliferation in vivo

To generate immune CD8+ or CD4+ T cells for adoptive transfer, mice were depleted of CD4+ T cells with mAb or not during vaccination to evoke CD8+ or CD4+ T cell immunity, respectively. These mice were immunized s.c. with strain no. 55 yeast as above but three times 2 wk apart. Two weeks after the final vaccination, mice received 200 µg of soluble yeast cytosol extract (3) emulsified in complete Freund’s adjuvant into their footpads and at the base of the tail. Twelve days later, draining lymph node cells and splenocytes were harvested, and CD8+ or CD4+ T cells were purified with {alpha}CD8– or {alpha}CD4-coated magnetic beads (BD Pharmingen). Cells were shown to be >95% pure on analysis by flow cytometry. T cell subsets isolated from Thy 1.1+ or Thy1.2+ mice were transferred i.v. into irradiated (5.5 Gy) Thy1.2+ IL-12-deficient and wild-type recipient mice. Irradiated mice were rested for up to 30 wk before infection. T cell proliferation of adoptively transferred and endogenous CD4+ and CD8+ T cells was studied by maintaining mice on BrdU (0.8 mg/ml; Sigma-Aldrich) for 4 wk. BrdU water was made and changed daily. Spleen and lymph node cells were stained with anti-Thy1.1-PE (clone OX-7), anti-CD44-APC, anti-CD4-CyC, anti-CD8-CyC and treated as per a BrdU Flow kit protocol (BD Pharmingen). Incorporated BrdU was stained with anti-BrdU-FITC and levels of cell-associated BrdU measured by flow cytometry.

Histological analysis

Lung tissue was fixed in 10% formalin and embedded in paraffin wax. Sections 5-µm thick were stained with H&E and Gomori’s methenamine silver. Skin lesions were scored for size necrosis, fibroblasts, collagen content, macrophages, polymorphonuclear leukocytes, lymphocytes, number of organisms, penetration of connective tissue capsule, and smaller satellite lesions. Areas of pneumonic consolidation were measured at a final projected magnification of 8.8 and expressed as a percentage of total lung areas in sections. The number of yeast was counted in 20 fields with a x60 objective, projected on a TV screen, and expressed as yeast/high power field.

Statistical analysis

Kaplan-Meier survival curves were generated (31). Survival times of infected mice alive by the end of the study were regarded as censored. Time data were analyzed by the log-rank statistic (Mantel-Haenszel test) (32), and p values were computed using Stat Xact-3 by CYTEL Software Corporation. The number of cytokine producing CD4+ and CD8+ T cells, relative changes in cytokine transcripts, and differences in number of colony-forming units were analyzed using the Wilcoxon-Rank test for nonparametric data (31). A value of p < 0.05 is considered statistically significant.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 Disclosures
 References
 
Differential dependence of CD4 cells and CD8 cells on IL-12 during control of the attenuated vaccine

To explore differential requirements of CD4 and CD8 cells for IL-12 in controlling live vaccine yeast at the injection site, we vaccinated IL-12 p40–/– (referred to as IL-12–/– below) and wild-type mice that were nondepleted, CD4 depleted (tests the role of CD4 cells) (3, 4), and CD4 and CD8 double-depleted (tests the additional contribution of CD8 cells) (5). In the presence of CD4 cells, nondepleted IL-12–/– mice failed to control the vaccine at the site of s.c. injection, and all died 50–70 days postvaccination (Fig. 1A). The draining lymph nodes harbored >105 live vaccine yeast, which also disseminated to the lungs (>106 CFU). At the time of death, vaccinated IL-12–/– mice had large, necrotic skin lesions, with caseous foci harboring abundant organisms seen invading small venous channels (Fig. 1C). The lesions were large (5.5–7.5 mm in diameter) and contained 250–300 yeasts/high power field, which reached the capsule, invaded it, and spread to satellite lesions. The lesions of wild-type mice were small (2–3 mm in diameter) and contained 10 times less yeast, which were localized near the fibrous capsule and did not penetrate it or spread to satellite lesions. Wild-type mice cleared live vaccine yeast from the injection site, showed no organ dissemination, and survived after vaccination. Depletion of both CD4 cells and CD8 cells from vaccinated wild-type mice led to large local lesions, dissemination to lungs and spleen, and eventual death in the mice, underscoring the role of T cells in vaccine control (data not shown).



View larger version (97K):
[in this window]
[in a new window]
  		FIGURE 1. Differential dependence of CD4+ and CD8+ T cells on IL-12 for control of an attenuated fungal vaccine. A and B, Survival of IL-12–/– and wild-type mice after immunization with live vaccine yeast strain. Groups of 12 mice were vaccinated s.c. and monitored for survival over 80 days; mice got 2 x 104 yeast/vaccination in the first experiment (A) and 105 yeast in the second one (B). A, Experiment 1: two groups of IL-12–/– mice received rIL-12 throughout the period of observation. *, p < 0.0001 vs all other groups. B, Experiment 2: IL-12–/– mice and wild-type mice were treated with anti-CD4 mAb alone, anti-CD4 and anti-CD8 mAb combined, or rat IgG as a control. *, p < 0.05 vs CD4-depleted IL-12–/– mice. C, Histology of skin at the site of vaccination in IL-12–/– and wild-type mice. Tissue was analyzed 4–5 wk postvaccination when IL-12–/– mice succumbed to the vaccine strain. Tissue was stained with H&E (top panels) or Gomori’s methenamine silver (bottom panels); images are x100 magnification. In IL-12–/– mice, the capsule was invaded by yeast (arrows) and detected in 10-fold greater numbers than in wild-type mice. Abbreviations: capsule (C); macrophage (M), and neutrophil (N).

 
Vaccinated IL-12–/– mice treated with rIL-12 during vaccination and afterward for 90 days had either cleared the vaccine yeast or produced small, palpable lumps under their skin at the injection site; they lacked dissemination of vaccine yeast to the lung, indicating that they controlled the vaccine at the site of injection. Because in intact mice, CD4 cells are chiefly responsible for vaccine immunity (3, 4, 5), the results imply that CD4 cells fail to become activated in the absence of IL-12 to control vaccine yeast and prevent dissemination. We explored the role of CD4 cells in IL12–/– mice below through mAb depletion.

Depletion of CD4 cells in IL-12–/– mice led to significantly better vaccine control and survival in comparison to nondepleted IL-12–/– mice (Fig. 1, A and B). In the first experiment (Fig. 1A), 10 of the 12 CD4-depleted mice were alive by 90 days postvaccination. In the two mice that succumbed (on days 68 and 82 postvaccination), the skin at the injection site initially became necrotic; 4 of the remaining 10 mice that lived had small numbers of vaccine yeast in their lungs (mean, 82 ± 12 CFU). Hence, half of the CD4-depleted IL-12–/– mice controlled the vaccine strain and half did not. In a second experiment (Fig. 1B), depletion of CD8 cells from CD4-depleted IL-12–/– mice sharply curtailed survival compared with those depleted of CD4 cells alone. Thus, CD8 cells contributed to the prolonged survival in the latter group of mice. CD4-depleted IL-12–/– mice continuously treated with rIL-12 and CD4-depleted wild-type mice had no or few palpable lumps under the skin at the injection site and all remained healthy. Thus, CD4 and CD8 T cells are differentially dependent on IL-12 for initial control of the vaccine strain at the site of injection. Whereas CD4 cells appear to require IL-12, CD8 cells are significantly less dependent on it. Without IL-12, CD4 cells fail to engage in vaccine control and impede CD8 function.

IL-12 is requisite for the induction of T1 cytokine-producing, lung CD4, and CD8 T cell responses

Because IL-12 initiates T1 cell differentiation, we explored whether vaccinated IL-12–/– mice failed to acquire T1 cells or instead switched to a T2 phenotype after vaccination. We used several approaches, including analysis of lung T cells ex vivo for cytokine transcript and intracellular protein expression, and splenocyte and lymph node cells in vitro for cytokine response to Ag stimulation. We measured lung cell cytokine transcript 60 h postinfection because IFN-{gamma} mRNA increases by 48–72 h after infection in association with vaccine resistance (5). In the present study, transcripts for IFN-{gamma} and IL-13 were elevated in vaccinated wild-type (CD4-depleted and nondepleted mice) vs unvaccinated mice, whereas none of the cytokines assayed (IFN-{gamma}, TNF-{alpha}, GM-CSF, IL-4, IL-5, IL-10, IL-13, and TGF-{beta}1) was significantly increased in vaccinated IL-12–/– mice (CD4-depleted and nondepleted) vs unvaccinated controls (Table I). This initial screen pointed to a failure of T1 differentiation, rather than T2 polarization.


View this table:
[in this window]
[in a new window]
  		Table I. N-fold changes in lung cytokine transcripts in vaccinated mice vs unvaccinated mice as measured by real-time PCRa

 
We next analyzed lung T cells. The number of lung CD4+ and CD8+ T cells that produced T1 cytokines IFN-{gamma}, TNF-{alpha}, and GM-CSF on day 4 postinfection (the peak period of influx (5)) rose sharply in vaccinated vs unvaccinated wild-type mice (Fig. 2A). In contrast, T1 cytokine-producing T cells were significantly reduced in vaccinated IL-12–/– vs wild-type mice. Vaccinated IL-12–/– mice showed no increase in lung T cells producing T2 cytokines, as compared with unvaccinated and vaccinated wild-type control mice. Lung CD4+ T cells showed a greater defect than CD8+ cells in acquiring a T1 phenotype when comparing vaccinated IL-12–/– vs wild-type mice (Fig. 2B). Thus, CD4+ cells were strictly dependent on IL-12 to acquire a T1 phenotype, whereas T1 CD8+ cells could be induced in the absence of IL-12.



View larger version (25K):
[in this window]
[in a new window]
  		FIGURE 2. Intracellular production of IFN-{gamma}, TNF-{alpha}, GM-CSF, IL-4, and IL-10 by lung T cells. Cells were assayed 4 days after B. dermatitidis infection in vaccinated and unvaccinated wild-type and IL-12–/– mice. A, Total number of T1 and T2 cytokine-producing lung T cells (CD4+ and CD8+ cells are combined). The results represent an average of four to five mice per group. *, p < 0.005 and **, p < 0.05 vs unvaccinated mice; {triangleup}, p < 0.05 vs corresponding vaccinated wild-type mice. B, Cytokine response by CD4+ and CD8+ cells is depicted by gating on individual T cell subsets. Data represent an average of four to five mice per group. *, p < 0.005 and **, p < 0.05 vs unvaccinated mice; {triangleup}, p < 0.05 vs corresponding vaccinated wild-type mice.

 
Analysis of splenocyte and lymph node cell responses to fungal Ag in vitro gave similar results. IFN-{gamma}, GM-CSF, and IL-10 levels were significantly increased in vaccinated wild-type mice vs unvaccinated controls, whereas neither these cytokines, nor IL-4 or TGF-{beta}1, was detected in vaccinated IL-12–/– mice (data not shown). In summary, results from three approaches suggest that CD4 T cells of vaccinated IL-12–/– mice failed to acquire a T1 phenotype and did not instead acquire a T2 phenotype. Some CD8 cells acquired a T1 cytokine phenotype on vaccination of CD4-depleted IL-12–/– mice, again pointing to differential dependency of CD4 and CD8 cells on IL-12.

IL-12 is requisite for induction of protective memory CD4 and CD8 T cell responses

To see whether IL-12 is needed to acquire functional resistance against B. dermatitidis, we challenged mice 2 wk after vaccination, when IL-12–/– mice appeared healthy and had no detectable vaccine strain yeast in their lungs. Vaccinated IL-12–/– mice failed to resist infection, whereas vaccinated IL-12–/– mice depleted of CD4 cells reduced lung CFU by 1 log (Fig. 3A). Nine of 10 vaccinated IL-12–/– mice (with CD4 cells) had >103 vaccine yeast that had disseminated to their lungs by 3 wk postinfection; only 2 of 10 CD4-depleted IL-12–/– mice had vaccine yeast disseminated to their lungs and the numbers were small (87 and 75 CFU). In contrast, in wild-type mice, vaccine-induced CD4 and CD8 cells reduced lung CFU by 3–4 logs vs unvaccinated controls, and vaccinated mice had no dissemination of vaccine yeast to their lungs. Thus, both CD4 and CD8 T cells require IL-12 during induction of vaccine immunity to acquire optimal functional resistance for a recall response. However, in CD4-depleted IL-12–/–, vaccine-induced CD8 cells again showed less dependence on IL-12 by reducing lung CFU 10-fold.



View larger version (13K):
[in this window]
[in a new window]
  		FIGURE 3. The role of IL-12 during induction of protective CD4 and CD8 T cell responses. A, Vaccine induced resistance by live yeast. Mice were vaccinated s.c. twice with 104 live yeast at each site. To induce protective CD8 T cells, IL-12–/– and wild-type mice were depleted by anti-CD4 mAb throughout the experiment. Two weeks after vaccination, mice were infected with 2 x 103 wild-type yeast and analyzed for lung CFU 14–16 days later. Data are geometric mean CFU ± SEM; n = 8–12 mice/group. *, p < 0.0002 vs unvaccinated controls. B, Vaccine-induced resistance by killed yeast. Mice were vaccinated as in A with either 104 live or 106 killed yeast at each site. Mice were infected with 2 x 103 wild-type yeast and analyzed for lung CFU 14–16 days later. Data are geometric mean CFU ± SEM; n = 8–10 mice/group. *, p < 0.001 vs unvaccinated controls. C, rIL-12 administration restores resistance by CD4 and CD8 cells in IL-12–/– mice. Mice were vaccinated as in A with live yeast. The groups of treated IL-12–/– mice received daily i.p. injections of 0.25 µg of rIL-12 during the first 7 days of vaccination and then every other day for the remainder of the vaccination period. Mice were challenged with 2 x 103 wild-type yeast i.t. and no longer treated with rIL-12. Data are the geometric mean CFU ± SEM; n = 8–13 mice/group. *, p < 0.0001 vs unvaccinated controls. **, p < 0.0001 vs unvaccinated controls and corresponding vaccinated IL-12–/– mice that were not treated with rIL-12.

 
Because CD4 cells and, to a limited extent, CD8 cells fail to control live vaccine yeast at the site of injection when IL-12 is absent, we wondered if unchecked replication of yeast interferes with immunity and if vaccination with killed yeast would engender vaccine resistance. In wild-type mice, vaccination with live yeast or 100-fold more killed yeast reduced lung CFU after infection by >6 logs vs unvaccinated controls. Thus, vaccine-induced resistance by killed yeast could be made as efficient as with live yeast (Fig. 3B). In IL-12–/– mice, vaccination with killed yeast reduced lung CFU after challenge by 16- and 19-fold in nondepleted mice and CD4-depleted mice, respectively, as compared with unvaccinated IL-12–/– mice (Fig. 3B). Thus, even in the absence of dissemination of live vaccine yeast in IL-12–/– mice, both CD4 and CD8 cells acquire only relatively marginal levels of vaccine resistance, underscoring that endogenous IL-12 is requisite for optimal induction vaccine immunity.

Exogenous rIL-12 restores induction of vaccine immunity

We explored whether administration of rIL-12 during induction of vaccine immunity restores resistance in IL-12–/– mice. Exogenous rIL-12 reduced lung CFU after infection by >4 logs in vaccinated IL-12–/– mice that received IL-12 vs those that did not (Fig. 3C). Even though IL-12-treated mice showed a significant reduction in lung CFU and prevented vaccine yeast from disseminating to the lungs, rIL-12 did not fully restore resistance to the level of vaccinated wild-type mice. IL-12 treatment of CD4-depleted IL-12–/– mice similarly increased their resistance and prevented dissemination of vaccine yeast to the lungs when compared with untreated mice. However, the level of resistance was again lower than that of CD4-depleted wild-type mice (Fig. 3A). Thus, vaccine-induced resistance mediated by either CD4 cells or CD8 cells in IL-12–/– mice can be largely restored by rIL-12 administration, indicating that IL-12 has a critical role during the induction of protective CD4 and CD8 cell responses.

IL-12 is dispensable for the maintenance of protective memory CD4 and CD8 T cells

The foregoing studies did not address the role of IL-12 during the maintenance phase once protective memory is established. To investigate whether continuous IL-12 signaling is required to maintain functional memory of CD4 and CD8 T cells, we used adoptive transfer of immune CD4 and CD8 cells into IL-12–/– mice. CD4 and CD8 T cells harvested from vaccinated wild-type mice were transferred into sublethally irradiated IL-12 – mice (and wild-type controls), and the mice were rested for 6 mo before challenge with wild-type yeast. This approach allows induction of protective T cells without any persisting yeast during the resting phase that could confound results in IL-12–/– mice unable to control live vaccine.

For this adoptive transfer model to be valid, we had to establish that transferred cells proliferate and retain their T1 phenotype in the absence of endogenous IL-12. We monitored the expansion and homeostatic proliferation of transferred Thy 1.1+ cells by BrdU staining to assess whether IL-12 served as a homeostatic survival factor for transferred cells (21). Over the course of 5–28 wk posttransfer, we recorded the percentages of transferred (Thy1.1+) CD4 and CD8 cells and of primed (CD44+) Thy1.1+ T cells and, for the latter group, the cells that proliferated (determined by BrdU incorporation). In lymph nodes and spleens, the numbers of transferred, memory CD4 and CD8 T cells proliferating were comparable in IL-12–/– and wild-type recipients (Table II). Thus, the absence of IL-12 did not impair expansion and survival of transferred cells in IL-12–/– recipients.


View this table:
[in this window]
[in a new window]
  		Table II. Evidence that expansion and homeostatic proliferation of adoptively transferred immune T cells does not depend on IL-12a

 
We also investigated whether adoptively transferred T cells retained their T1 phenotype in an IL-12-deficient environment for 6 mo by measuring intracellular cytokine production by lung T cells 4 days postinfection (5). Wild-type and IL-12–/– mice that received immune CD4 cells had significantly greater numbers of IFN-{gamma}, TNF-{alpha}, and GM-CSF producing lung CD4 T cells, compared with control animals that did not receive T cells (Fig. 4A). The number of T1 cytokine-expressing CD4 cells was higher in IL-12–/– recipients than in wild-type mice, but the difference was not significant. Cytokine-producing T cells in the lung were chiefly restricted to the CD44+ transferred T cell population, as identified by the Thy1.1 marker (data not shown). By real-time PCR of lung cells 48 h after infection, IFN-{gamma} transcript was 9- to 10-fold higher in IL-12–/– and wild-type mice that had received immune CD4 cells vs no cells (p < 0.01). Thus, transferred CD4 cells maintained a T1 phenotype over a period of 6 mo without IL-12.



View larger version (22K):
[in this window]
[in a new window]
  		FIGURE 4. IL-12 is not required to maintain protective T1 CD4 memory cells. Approximately 1.2 x 107 and 1.3 x 107 B. dermatitidis immune CD4 cells and CD8 cells, respectively, were adoptively transferred into sublethally irradiated IL-12–/– and wild-type recipients who were then rested for 6 mo. A, Intracellular production of IFN-{gamma}, TNF-{alpha}, and GM-CSF by lung T cells. Data represent the number of T1 cytokine-producing memory (CD44+) CD4 and CD8 T cells 4 days after B. dermatitidis infection in IL-12–/– and wild-type mice that received transferred cells or not. Cytokine production resided chiefly in the CD44+ T cell populations. Data represent an average of 6–12 mice/group that were analyzed individually. *, p < 0.01 vs controls with no cell transfer; **, p < 0.05 vs controls with no cell transfer. B, Memory CD4 T cells do not require IL-12 to maintain resistance. One day before infection, mice received anti-CD4 or anti-CD8 mAb i.v. as indicated to deplete any residual of the opposing subset of T cells transferred. Mice were infected with 5 x 102 wild-type yeast i.t. and lung CFU analyzed three weeks later. *, p < 0.003 vs controls with no cell transfer; **, p < 0.04 vs controls with no cell transfer.

 
IL-12–/– mice that had received immune CD8 cells also demonstrated increased numbers of T1 cytokine-producing CD8 cells in their lungs at day 4 postinfection, whereas wild-type recipients did not (Fig. 4A). Cytokine-producing CD8 cells were increased in the lungs of IL-12–/– and wild-type mice that had received immune CD4 cells, although the increases were not statistically significant. Small numbers of "contaminating" CD8 cells could have been transferred along with enriched CD4 cells. Homeostasis-driven proliferation may have expanded these "contaminating" CD8 cells. Importantly, 1 day before mice were challenged to assess their resistance phenotype, these "contaminating" T cells were depleted to undetectable levels by flow cytometry (data not shown).

Because adoptively transferred cells survived and retained a T1 cytokine phenotype in the absence of endogenous IL-12, we explored the resistance phenotype of recipient mice. At 3 wk postinfection, IL-12–/– and wild-type mice that had received immune CD4 cells showed lung CFU values > 4 logs lower than values in control mice that had not received cells (Fig. 4B). These results suggest that once CD4 cells acquire a protective T1 phenotype they no longer require continuous IL-12 signaling to maintain their memory and mediate resistance. On the other hand, IL-12–/– and wild-type mice that received immune CD8 cells, respectively, had only 4- or 21-fold lower lung CFU values, compared with controls that had not received cells. In view of the small reduction in lung CFU in wild-type recipients, we explored an additional approach to investigate the role of IL-12 in maintenance of memory CD8 cells.

Vaccination with killed yeast in IL-12–/– mice transiently treated with IL-12 eliminates the confounding effects of ongoing chronic fungal infection

To see whether protective CD8 cells require continuous IL-12 signaling to maintain a T1 phenotype and resistance, we vaccinated CD4-depleted IL-12–/– mice with killed yeast, treating them transiently with rIL-12 during the induction of vaccine immunity, and resting them afterward for 3 mo in the absence of IL-12. Vaccination with killed yeast induces robust CD8-mediated resistance in CD4-depleted wild-type mice (Fig. 3B), but it was unclear whether CD8 cells could maintain a polarized T1 response without continuous IL-12 signaling. At day 4 postinfection with wild-type yeast, the number of lung CD8 T cells producing IFN-{gamma}, TNF-{alpha}, and GM-CSF was significantly increased in IL-12–/– mice transiently treated with rIL-12 (and in wild-type mice), compared with unvaccinated controls, indicating that T1 CD8+ cells were maintained in the absence of continued IL-12 signaling (Fig. 5A). In parallel, we examined the resistance phenotype to pulmonary challenge in these mice. After infection, lung CFU were reduced 170-fold in the transiently treated IL-12–/– mice and 66-fold in the control group (Fig. 5B). These data argue that protective memory CD8 cells maintain both a T1 phenotype and resistance against experimental pulmonary blastomycosis, even in the absence of continuous IL-12 signaling.



View larger version (19K):
[in this window]
[in a new window]
  		FIGURE 5. IL-12 is not required to maintain protective T1 CD8 memory cells. IL-12–/– mice were immunized with killed vaccine strain yeast and given rIL-12 transiently only during the immunization. After a 3-mo rest, mice were infected i.t. with wild-type yeast. A, Intracellular production of IFN-{gamma}, TNF-{alpha}, and GM-CSF by lung CD8+ T cells. Data depict the number of T1 cytokine-producing memory (CD44+) CD8 T cells 4 days after B. dermatitidis infection. Cytokine production resided chiefly in CD44+ T cells. Data represent an average of four to six mice per group that were analyzed individually. *, p < 0.01 vs unvaccinated controls; **, p < 0.004 vs unvaccinated controls. B, Resistance mediated by memory CD8 cells in the absence of continuous IL-12 signaling. After mice were infected with 2 x 103 wild-type yeast, lung CFU was analyzed 3 wk later. *, p < 0.0002 vs unvaccinated controls.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
Disclosures
 References
 
Acquisition of long-term memory is a fundamental feature of T cell-mediated immunity and a cornerstone of vaccine development. Herein, we describe the role of IL-12 in promoting long-term memory CD4 and CD8 T cell immunity, which is instrumental in acquired host resistance to experimental pulmonary blastomycosis (3, 4, 5). We investigated the role of IL-12 during three crucial phases of vaccine-induced memory development: the initial phase of vaccine control, the induction phase of T1 immunity, and the maintenance phase.

IL-12 is critical in priming T1 responses that are centrally involved in T cell-mediated protection against many pathogens, including parasites (16, 33, 34, 35) and fungi (36, 37). For CD4 cells, IL-12 remains the most important cytokine in directing primary T1 responses, whereas CD8 cells rely less on IL-12 than do CD4 cells (22). In line with this concept, we found that CD4 cells were unable to control live vaccine yeast administered s.c. when IL-12 was absent, and the mice succumbed to dissemination. In contrast, in the absence of IL-12, CD8 cells were better at controlling growth and dissemination of s.c. administered yeast; however, some of these mice eventually showed signs of dissemination. The role of CD8 cells in vaccine control was only evident once CD4 cells were depleted from IL-12 KO mice. Mechanisms behind CD4 cell "interference" of vaccine control in the skin in the absence of IL-12 were not apparent in cytokine analyses within the lung of infected mice and are actively under study. Although continuous, systemic rIL-12 halted replication of yeast in the skin of IL-12–/– mice, it did not completely clear them. It is possible that systemic delivery did not reach the local concentrations of IL-12 necessary to sterilize the skin. Thus, even though CD4 and CD8 T cells initially showed a differential requirement for IL-12, both T cell subsets required IL-12 to completely eliminate yeast at the site of vaccine replication.

The induction of a protective T1 phenotype and the acquisition of vaccine-induced resistance to reinfection with wild-type yeast was IL-12-dependent for both CD4 and CD8 cells. In IL-12–/– mice, both CD4 and CD8 cells acquired only marginal vaccine resistance (by live or killed yeast) when compared with wild-type mice. Transiently administered rIL-12 significantly boosted resistance mediated by CD4 and CD8 cells but not to the levels seen in wild-type controls. Infections with the intracellular parasites L. major and T. gondii also require IL-12 to induce protective CD4+ T1 responses (12, 13), whereas some viral infections induce CD4+ cell IFN-{gamma} resistance in an IL-12-independent manner (38, 39).

Our studies were done with IL-12 KO mice lacking the p40 chain of the heterodimeric p35/p40 protein. Because p40 is also shared with IL-23 (p19/p40), it remains possible that the requisite role of IL-12 for vaccine control and induction of the afferent stage could be due in part to IL-23. The fact that resistance in our study was largely restored with rIL-12 points to an unambiguous role for IL-12 at these stages. The fact that resistance could not be fully restored does leave open the possibility of an IL-23 contribution. Nevertheless, what is perhaps the most novel finding of our study is that long-term maintenance of memory immunity does not require IL-12 (or IL-23).

Unexpectedly, we found here that once B. dermatitidis-specific CD4 and CD8 T cells acquired a T1 phenotype and could mediate resistance, IL-12 was no longer needed to maintain their protective memory. For CD4 cells, we obtained conclusive results by adoptive transfer of immune T cells into irradiated naive IL-12-deficient mice that recovered for 6 mo. Transferred CD4 cells expanded and proliferated independently of IL-12, maintained a T1 cytokine profile on recall, and protected mice against challenge with wild-type yeast. For CD8 cells, adoptive transfer studies were inconclusive because transferred resistance was insufficient in both wild-type and IL-12–/– mice. Alternatively, vaccination with killed yeast yielded greater levels of resistance. Under those conditions, CD8 cells from IL-12–/– mice transiently exposed to rIL-12 during vaccination controlled lung infection as efficiently as CD8 cells from wild-type mice. These results suggest that continuous IL-12 signaling is dispensable in the maintenance of protective memory CD4 and CD8 cells.

Our finding was particularly surprising for CD4 memory and contrasts with observations about CD4 memory to parasites. Although there are numerous studies that describe the role of IL-12 for the induction of protective CD4+ T1 cells, studies investigating the role of IL-12 for maintenance of these T cell responses have been done principally with L. major and T. gondii (12, 13, 20, 21). In those studies, a range of experimental approaches was used, and IL-12 was obligate for maintenance of CD4 immunity. The loss of a T1 response and susceptibility to L. major in IL-12-deficient mice was not due to the action of IL-4 in promoting a nonprotective T2 cell population but rather due to elimination of T1 cells during an infection (20). In the absence of Ag stimulation, adoptively transferred T1 cells from healed wild-type mice were maintained in IL-12–/– mice. During infection, in the absence of IL-12, T1 cells were eliminated, and resistance was lost. To explain their findings, the authors invoked the existence of two memory T cell subsets (40, 41, 42): one subset has the characteristics of effector cells (effector memory cells), while the other acts as a reservoir of Ag-specific T cells that have not committed to a specific cytokine profile and are referred to as nonpolarized (Tnp or central memory cells). These authors and others have shown that central memory cells are capable of becoming either T1 or T2 cells, depending on the conditions they encounter during reactivation (43, 44, 45). Consequently, the authors proposed that IL-12 is required to promote the development of T1 effector memory cells from central memory cells. According to their hypothesis, during infection, effector memory cells are deleted by activation-induced cell death; memory T cells persist only when IL-12 is present to support differentiation from central memory to protective, effector memory cells. Alternatively, IL-12 could play a role in preventing T cell apoptosis (46, 47, 48). For example, in the absence of IL-12, T1 cells may be especially prone to cell death, which would lead to a greater need for central memory cells to differentiate into T1 effector cells, a pathway that would be blocked in the absence of IL-12.

Whatever the mechanisms of L. major infection-induced loss of T1 memory cells, it does not appear to apply to the role of IL-12 in sustaining protective memory T cells against B. dermatitidis infection, as shown here. Upon recall, memory T cells rested in the absence of IL-12 were not eliminated as in L. major studies; they evinced an effector memory T1 phenotype as early as 4 days postinfection and mediated levels of resistance that were comparable to memory cells rested in the presence of IL-12. Whether protective T1 memory CD4 cells consisted of effector memory cells that were not eliminated by activation-induced cell death during challenge or stemmed from central memory cells that differentiated into effector memory cells independently of IL-12 remains to be investigated. Because we obtained CD4 cells for transfer from lymphoid organs, many or most of the cells were likely central memory cells (49). The extended 6-mo survival of transferred cells in the absence of Ag exposure is consistent with the properties of central memory cells (50). The different IL-12 requirement in survival of parasite vs fungal memory cells could have to do with how the cells are initially established. Studies in influenza have shown that central memory cells are a heterogeneous population (51). Because TLRs are required for memory CD4 cell differentiation (52), the types or requirements of central memory cells against fungi might differ due to distinct pathogen products and inflammatory conditions. This issue notwithstanding, current concepts about the requisite role of IL-12 during development and maintenance of protective T cell memory should consider differential IL-12 requirements by CD4 and CD8 subsets during development of protective memory and the seeming dispensability of IL-12 during the maintenance phase of antifungal memory immunity. Our findings on memory immunity significantly extend those previously reported for Histoplasma capsulatum (19), which involved IL-12 neutralization of animals only upon reinfection so that the requirement for continuous IL-12 signaling in maintenance of memory would not have been evaluated. Our findings may have implications for the development of vaccines or immune-based therapies against invasive fungal infections in immunocompromised hosts.


   Acknowledgments
 
We thank the Genetics Institute (Cambridge, MA) for generously providing murine rIL-12. We thank Dr. Jens Eickhoff (Department of Biostatistics and Medical Informatics) for statistical assistance, and Hanna Filutowicz and Amber Frank (Department of Pediatrics) for their expert technical assistance.


   Disclosures
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
References
 
The authors have no financial conflict of interest.


   Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by U.S. Public Health Service Grants AI40996 and AI35681 and a Burroughs Wellcome Fund Scholar Award in Molecular Pathogenic Mycology (to B.S.K.). Back

2 Address correspondence and reprint requests to Dr. Marcel Wüthrich, University of Wisconsin Hospitals and Clinics, 600 Highland Avenue, K4/444, Madison, WI 53792. E-mail address: mwuethri{at}wisc.edu Back

3 Abbreviations used in this paper: T1, type 1; KO, knockout; T2, type 2; i.t., intratracheally. Back

Received for publication January 21, 2005. Accepted for publication August 9, 2005.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Cozad, G. C.. 1992. Experimental blastomycosis. Y. Al-Doorey, and A. F. DiSalvo, eds. Blastomycosis 221.-236. Plenum Publishing Corporation, New York.
  2. Cozad, G. C., C. T. Chang. 1980. Cell-mediated immunoprotection in blastomycosis. Infect. Immun. 28:398.-403. [Abstract/Free Full Text]
  3. Wüthrich, M., H. I. Filutowicz, B. S. Klein. 2000. Mutation of the WI-1 gene yields an attenuated Blastomyces dermatitidis strain that induces host resistance. J. Clin. Invest. 106:1381.-1389. [Medline]
  4. Wüthrich, M., H. I. Filutowicz, T. Warner, B. S. Klein. 2002. Requisite elements in vaccine immunity to Blastomyces dermatitidis: plasticity uncovers vaccine potential in immune-deficient hosts. J. Immunol. 169:6969.-6976. [Abstract/Free Full Text]
  5. Wüthrich, M., H. I. Filutowicz, T. Warner, G. S. Deepe, Jr, B. S. Klein. 2003. Vaccine immunity to pathogenic fungi overcomes the requirement for CD4 help in exogenous antigen presentation to CD8+ T cells: implications for vaccine development in immune-deficient hosts. J. Exp. Med. 197:1405.-1416. [Abstract/Free Full Text]
  6. Chan, S. H., B. Perussia, J. W. Gupta, M. Kobayashi, M. Pospisil, H. A. Young, S. F. Wolf, D. Young, S. C. Clark, G. Trinchieri. 1991. Induction of interferon {gamma} production by natural killer cell stimulatory factor: characterization of the responder cells and synergy with other inducers. J. Exp. Med. 173:869.-879. [Abstract/Free Full Text]
  7. Kobayashi, M., L. Fitz, M. Ryan, R. M. Hewick, S. C. Clark, S. Chan, R. Loudon, F. Sherman, B. Perussia, G. Trinchieri. 1989. Identification and purification of natural killer cell stimulatory factor (NKSF), a cytokine with multiple biologic effects on human lymphocytes. J. Exp. Med. 170:827.-845. [Abstract/Free Full Text]
  8. Hsieh, C. S., S. E. Macatonia, C. S. Tripp, S. F. Wolf, A. O’Garra, K. M. Murphy. 1993. Development of Th1 CD4+ T cells through IL-12 produced by Listeria-induced macrophages. Science 260:547.-549. [Abstract/Free Full Text]
  9. Manetti, R., F. Gerosa, M. G. Giudizi, R. Biagiotti, P. Parronchi, M. P. Piccinni, S. Sampognaro, E. Maggi, S. Romagnani, G. Trinchieri, et al 1994. Interleukin 12 induces stable priming for interferon {gamma} (IFN-{gamma}) production during differentiation of human T helper (Th) cells and transient IFN-{gamma} production in established Th2 cell clones. J. Exp. Med. 179:1273.-1283. [Abstract/Free Full Text]
  10. Wu, C. Y., C. Demeure, M. Kiniwa, M. Gately, G. Delespesse. 1993. IL-12 induces the production of IFN-{gamma} by neonatal human CD4 T cells. J. Immunol. 151:1938.-1949. [Abstract]
  11. Seder, R. A., R. Gazzinelli, A. Sher, W. E. Paul. 1993. Interleukin 12 acts directly on CD4+ T cells to enhance priming for interferon {gamma} production and diminishes interleukin 4 inhibition of such priming. Proc. Nat. Acad. Sci. USA 90:10188.-10192. [Abstract/Free Full Text]
  12. Yap, G., M. Pesin, A. Sher. 2000. Cutting edge: IL-12 is required for the maintenance of IFN-{gamma} production in T cells mediating chronic resistance to the intracellular pathogen, Toxoplasma gondii. J. Immunol. 165:628.-631. [Abstract/Free Full Text]
  13. Park, A. Y., B. D. Hondowicz, P. Scott. 2000. IL-12 is required to maintain a Th1 response during Leishmania major infection. J. Immunol. 165:896.-902. [Abstract/Free Full Text]
  14. Stern, A. S., F. J. Podlaski, J. D. Hulmes, Y. C. Pan, P. M. Quinn, A. G. Wolitzky, P. C. Familletti, D. L. Stremlo, T. Truitt, R. Chizzonite, et al 1990. Purification to homogeneity and partial characterization of cytotoxic lymphocyte maturation factor from human B-lymphoblastoid cells. Proc. Natl. Acad. Sci. USA 87:6808.-6812. [Abstract/Free Full Text]
  15. Constantinescu, C. S., B. D. Hondowicz, M. M. Elloso, M. Wysocka, G. Trinchieri, P. Scott. 1998. The role of IL-12 in the maintenance of an established Th1 immune response in experimental leishmaniasis. Eur. J. Immunol. 28:2227.-2233. [Medline]
  16. Gazzinelli, R. T., M. Wysocka, S. Hayashi, E. Y. Denkers, S. Hieny, P. Caspar, G. Trinchieri, A. Sher. 1994. Parasite-induced IL-12 stimulates early IFN-{gamma} synthesis and resistance during acute infection with Toxoplasma gondii. J. Immunol. 153:2533.-2543. [Abstract]
  17. Tripp, C. S., O. Kanagawa, E. R. Unanue. 1995. Secondary response to Listeria infection requires IFN-{gamma} but is partially independent of IL-12. J. Immunol. 155:3427.-3432. [Abstract]
  18. Seder, R. A., B. L. Kelsall, D. Jankovic. 1996. Differential roles for IL-12 in the maintenance of immune responses in infectious versus autoimmune disease. J. Immunol. 157:2745.-2748. [Abstract]
  19. Zhou, P., G. Miller, R. A. Seder. 1998. Factors involved in regulating primary and secondary immunity to infection with Histoplasma capsulatum: TNF-{alpha} plays a critical role in maintaining secondary immunity in the absence of IFN-{gamma}. J. Immunol. 160:1359.-1368. [Abstract/Free Full Text]
  20. Park, A. Y., B. Hondowicz, M. Kopf, P. Scott. 2002. The role of IL-12 in maintaining resistance to Leishmania major. J. Immunol. 168:5771.-5777. [Abstract/Free Full Text]
  21. Stobie, L., S. Gurunathan, C. Prussin, D. L. Sacks, N. Glaichenhaus, C. Y. Wu, R. A. Seder. 2000. The role of antigen and IL-12 in sustaining Th1 memory cells in vivo: IL-12 is required to maintain memory/effector Th1 cells sufficient to mediate protection to an infectious parasite challenge. Proc. Natl. Acad. Sci. USA 97:8427.-8432. [Abstract/Free Full Text]
  22. Carter, L. L., K. M. Murphy. 1999. Lineage-specific requirement for signal transducer and activator of transcription (Stat)4 in interferon {gamma} production from CD4+ versus CD8+ T cells. J. Exp. Med. 189:1355.-1360. [Abstract/Free Full Text]
  23. Harrison, T. S., S. M. Levitz. 1996. Role of IL-12 in peripheral blood mononuclear cell responses to fungi in persons with and without HIV infection. J. Immunol. 156:4492.-4497. [Abstract]
  24. Harrison, T. S., S. M. Levitz. 1997. Priming with IFN-{gamma} restores deficient IL-12 production by peripheral blood mononuclear cells from HIV-seropositive donors. J. Immunol. 158:459.-463. [Abstract]
  25. Harvey, R. P., E. S. Schmid, C. C. Carrington, D. A. Stevens. 1978. Mouse model of pulmonary blastomycosis: utility, simplicity, and quantitative parameters. Am. Rev. Respir. Dis. 117:695.-703. [Medline]
  26. Brandhorst, T. T., M. Wüthrich, T. Warner, B. Klein. 1999. Targeted gene disruption reveals an adhesin indispensable for pathogenicity of Blastomyces dermatitidis. J. Exp. Med. 189:1207.-1216. [Abstract/Free Full Text]
  27. Fabien, N., I. Bergerot, V. Maguer-Satta, J. Orgiazzi, C. Thivolet. 1995. Pancreatic lymph nodes are early targets of T cells during adoptive transfer of diabetes in NOD mice. J. Autoimmun. 8:323.-334. [Medline]
  28. Magram, J., S. E. Connaughton, R. R. Warrier, D. M. Carvajal, C. Y. Wu, J. Ferrante, C. Stewart, U. Sarmiento, D. A. Faherty, M. K. Gately. 1996. IL-12-deficient mice are defective in IFN-{gamma} production and type 1 cytokine responses. Immunity 4:471.-481. [Medline]
  29. Johnson, M. R., K. Wang, J. B. Smith, M. J. Heslin, R. B. Diasio. 2000. Quantitation of dihydropyrimidine dehydrogenase expression by real-time reverse transcription polymerase chain reaction. Anal. Biochem. 278:175.-184. [Medline]
  30. Altare, F., A. Durandy, D. Lammas, J. F. Emile, S. Lamhamedi, F. Le Deist, P. Drysdale, E. Jouanguy, R. Doffinger, F. Bernaudin, et al 1998. Impairment of mycobacterial immunity in human interleukin-12 receptor deficiency. Science 280:1432.-1435. [Abstract/Free Full Text]
  31. Fisher, L. D., G. van Belle. 1993. Biostatistics: A Methodology for the Health Sciences John Wiley & Sons, New York.
  32. Mantel, N., W. Haenszel. 1959. Statistical aspects of the analysis of data from retrospective studies of disease. J. Natl. Cancer Inst. 22:719.-748.
  33. Afonso, L. C., T. M. Scharton, L. Q. Vieira, M. Wysocka, G. Trinchieri, P. Scott. 1994. The adjuvant effect of interleukin-12 in a vaccine against Leishmania major. Science 263:235.-237. [Abstract/Free Full Text]
  34. Heinzel, F. P., D. S. Schoenhaut, R. M. Rerko, L. E. Rosser, M. K. Gately. 1993. Recombinant interleukin 12 cures mice infected with Leishmania major. J. Exp. Med. 177:1505.-1509. [Abstract/Free Full Text]
  35. Sypek, J. P., C. L. Chung, S. E. Mayor, J. M. Subramanyam, S. J. Goldman, D. S. Sieburth, S. F. Wolf, R. G. Schaub. 1993. Resolution of cutaneous leishmaniasis: interleukin 12 initiates a protective T helper type 1 immune response. J. Exp. Med. 177:1797.-1802. [Abstract/Free Full Text]
  36. Decken, K., G. Kohler, K. Palmer-Lehmann, A. Wunderlin, F. Mattner, J. Magram, M. K. Gately, G. Alber. 1998. Interleukin-12 is essential for a protective Th1 response in mice infected with Cryptococcus neoformans. Infect. Immun. 66:4994.-5000. [Abstract/Free Full Text]
  37. Zhou, P., M. C. Sieve, J. Bennett, K. J. Kwon-Chung, R. P. Tewari, R. T. Gazzinelli, A. Sher, R. A. Seder. 1995. IL-12 prevents mortality in mice infected with Histoplasma capsulatum through induction of IFN-{gamma}. J. Immunol. 155:785.-795. [Abstract]
  38. Oxenius, A., U. Karrer, R. M. Zinkernagel, H. Hengartner. 1999. IL-12 is not required for induction of type 1 cytokine responses in viral infections. J. Immunol. 162:965.-973. [Abstract/Free Full Text]
  39. Schijns, V. E., B. L. Haagmans, C. M. Wierda, B. Kruithof, I. A. Heijnen, G. Alber, M. C. Horzinek. 1998. Mice lacking IL-12 develop polarized Th1 cells during viral infection. J. Immunol. 160:3958.-3964. [Abstract/Free Full Text]
  40. Sallusto, F., D. Lenig, R. Forster, M. Lipp, A. Lanzavecchia. 1999. Two subsets of memory T lymphocytes with distinct homing potentials and effector functions. Nature 401:708.-712. [Medline]
  41. Reinhardt, R. L., A. Khoruts, R. Merica, T. Zell, M. K. Jenkins. 2001. Visualizing the generation of memory CD4 T cells in the whole body. Nature 410:101.-105. [Medline]
  42. Ahmadzadeh, M., S. F. Hussain, D. L. Farber. 2001. Heterogeneity of the memory CD4 T cell response: persisting effectors and resting memory T cells. J. Immunol. 166:926.-935. [Abstract/Free Full Text]
  43. Hondowicz, B. D., A. Y. Park, M. M. Elloso, P. Scott. 2000. Maintenance of IL-12-responsive CD4+ T cells during a Th2 response in Leishmania major-infected mice. Eur. J. Immunol. 30:2007.-2014. [Medline]
  44. Mocci, S., R. L. Coffman. 1995. Induction of a Th2 population from a polarized Leishmania-specific Th1 population by in vitro culture with IL-4. J. Immunol. 154:3779.-3787. [Abstract]
  45. Powrie, F., R. Correa-Oliveira, S. Mauze, R. L. Coffman. 1994. Regulatory interactions between CD45RBhigh and CD45RBlowCD4+ T cells are important for the balance between protective and pathogenic cell-mediated immunity. J. Exp. Med. 179:589.-600. [Abstract/Free Full Text]
  46. Estaquier, J., T. Idziorek, W. Zou, D. Emilie, C. M. Farber, J. M. Bourez, J. C. Ameisen. 1995. T helper type 1/T helper type 2 cytokines and T cell death: preventive effect of interleukin 12 on activation-induced and CD95 (FAS/APO-1)-mediated apoptosis of CD4+ T cells from human immunodeficiency virus-infected persons. J. Exp. Med. 182:1759.-1767. [Abstract/Free Full Text]
  47. Marth, T., M. Zeitz, B. R. Ludviksson, W. Strober, B. L. Kelsall. 1999. Extinction of IL-12 signaling promotes Fas-mediated apoptosis of antigen-specific T cells. J. Immunol. 162:7233.-7240. [Abstract/Free Full Text]
  48. Palmer, E. M., L. Farrokh-Siar, J. Maguire van Seventer, G. A. van Seventer. 2001. IL-12 decreases activation-induced cell death in human naive Th cells costimulated by intercellular adhesion molecule-1. I. IL-12 alters caspase processing and inhibits enzyme function. J. Immunol. 167:749.-758. [Abstract/Free Full Text]
  49. Sallusto, F., J. Geginat, A. Lanzavecchia. 2004. Central memory and effector memory T cell subsets: function, generation, and maintenance. Annu. Rev. Immunol. 22:745.-763. [Medline]
  50. Zaph, C., J. Uzonna, S. M. Beverley, P. Scott. 2004. Central memory T cells mediate long-term immunity to Leishmania major in the absence of persistent parasites. Nat. Med. 10:1104.-1110. [Medline]
  51. Roman, E., E. Miller, A. Harmsen, J. Wiley, U. H. Von Andrian, G. Huston, S. L. Swain. 2002. CD4 effector T cell subsets in the response to influenza: heterogeneity, migration, and function. J. Exp. Med. 196:957.-968. [Abstract/Free Full Text]
  52. Pasare, C., R. Medzhitov. 2004. Toll-dependent control mechanisms of CD4 T cell activation. Immunity 21:733.-741. [Medline]



This article has been cited by other articles:


Home page
 J. Immunol.Home page
C. E. Ruby, R. Montler, R. Zheng, S. Shu, and A. D. Weinberg
IL-12 Is Required for Anti-OX40-Mediated CD4 T Cell Survival
J. Immunol., February 15, 2008; 180(4): 2140 - 2148.
[Abstract] [Full Text] [PDF]

Home page
 Infect. Immun.Home page
M. Wuthrich, H. I. Filutowicz, H. L. Allen, G. S. Deepe, and B. S. Klein
V{beta}1+ J{beta}1.1+/V{alpha}2+ J{alpha}49+ CD4+ T Cells Mediate Resistance against Infection with Blastomyces dermatitidis
Infect. Immun., January 1, 2007; 75(1): 193 - 200.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
Q. Li, C. Eppolito, K. Odunsi, and P. A. Shrikant
IL-12-Programmed Long-Term CD8+ T Cell Responses Require STAT4
J. Immunol., December 1, 2006; 177(11): 7618 - 7625.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wüthrich, M.
Right arrow Articles by Klein, B. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wüthrich, M.
Right arrow Articles by Klein, B. S.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS