|
|
||||||||
3' Enhancer Activity1
Department of Animal Biology, University of Pennsylvania School of Veterinary Medicine, Philadelphia, PA 19104
| Abstract |
|---|
|
|
|---|
gene expression and chromatin structure change during B cell development. At the pre-B cell stage, the locus is relatively hypoacetylated on histone H3, whereas it is hyperacetylated at the plasma cell stage. We find in this study that the histone deacetylase inhibitor, trichostatin A (TSA) stimulated 3' enhancer activity through the PU.1 binding site. TSA also stimulated PU.1 transactivation potential. PU.1 activity was increased by the coactivator acetyltransferase protein, p300, and p300 physically interacted with PU.1 residues 730. PU.1 served as a substrate for p300 and was acetylated on lysine residues 170, 171, 206, and 208. Mutation of PU.1 lysines 170 and 171 did not affect PU.1 DNA binding, but did lower the ability of PU.1 to activate transcription in association with p300. Lysine 170 was acetylated in pre-B cells and plasmacytoma cells, but TSA treatment did not stimulate PU.1 acetylation at this residue arguing that a second mechanism can stimulate 3' enhancer activity. Using chromatin immunoprecipitation assays we found that TSA caused preferential acetylation of histone H3 at the 3' enhancer. The relevance of these studies for PU.1 function in transcription and hemopoietic development is discussed. | Introduction |
|---|
|
|
|---|
The Ig
locus is controlled by two stage-specific enhancers, the intron enhancer, and the 3' enhancer (3). Both enhancers are inactive at the pro-B and pre-B cell stages, but are functional at the B cell and plasma cell stages (4, 5, 6). Both enhancers also contribute to the ability to rearrange the
locus in vivo (3, 7). Coincident with the development of enhancer activity and subsequent transcription, DNA at the locus changes from a heavily methylated, DNase I-resistant structure, to a hypomethylated, DNase I-sensitive structure (8, 9, 10, 11, 12, 13). The factors directly responsible for these changes are unknown, but presumably include the transcription factors that bind to the Ig
enhancers.
A number of studies explored chromatin accessibility at various developmental stages (3, 7, 10, 14). These studies revealed some site-specific changes in protein occupancy during development. For instance, hypersensitivity at certain sites in the 3' enhancer is increased in pre-B cells compared with pro-B cells (14), and these changes may contribute to control of
locus expression. However, simple protein accessibility to the
locus is not a sufficient mechanism for controlling transcription or recombination in pro-B cells, because in vivo footprinting studies showed proteins bound at the
enhancers before the onset of transcriptional or recombinational activity (14). Instead, increased activity of the 3' enhancer at later B cell stages must be controlled by the composition of proteins bound to the regulatory elements or to post-translational modifications of histones or regulatory proteins.
An important motif in the 3' enhancer is the PU.1/Pip (IFN regulatory factor-4) composite element. This motif is dependent upon transcription factor PU.1, which is necessary for the recruitment of Pip to DNA (15, 16, 17, 18). PU.1 is an erythroblast transformation-specific (ETS)4 domain transcription factor necessary for development of multiple hemopoietic lineages (19, 20, 21, 22, 23, 24, 25, 26, 27, 28). PU.1 homozygous mutants fail to develop lymphoid, myeloid, and granulocyte lineages and die in late gestation (27). Levels of PU.1 are implicated in regulating the lymphoid and myeloid cell fates (23), and PU.1 is down-regulated during erythrogenesis (26, 29, 30). Reduced levels of PU.1 also contribute to acute myeloid leukemia (31). PU.1 can physically interact with CREB binding protein (CBP) and elevated PU.1 expression can lead to changes in global histone acetylation levels in vivo (32, 33). PU.1 is also implicated in controlling chromatin structure at the Ig H chain enhancer (34). Therefore, PU.1 may influence both global histone acetylation patterns as well as local chromatin structure.
The factors that control
locus chromatin structure are presently unknown, although Pax5 has been suggested to play an important role (35). Previously we showed that H3 acetylation at the 3' enhancer is increased greatly in pre-B cells by treatment with the histone deacetylase inhibitor, trichostatin A (36). We find in this study that trichostatin A (TSA) treatment increased 3' enhancer activity, and this increase was largely through the PU.1/Pip composite element. The PU.1 transactivation potential was also increased in the presence of TSA or when cotransfected with the histone acetyltransferase (HAT) protein, p300. We find that PU.1 physically interacts with p300 and is a substrate for p300 acetylation with acetylation sites at lysines 170, 171, 206, and 208. We found that PU.1 is acetylated in vivo, and this acetylation may be important for PU.1 transactivation with p300. However, TSA treatment did not increase PU.1 lysine 170 acetylation, arguing that either other PU.1 lysines are targeted, or a second mechanism is needed for TSA induction of enhancer activity. Using chromatin immunoprecipitation methods we found that TSA causes preferential acetylation of histone H3 at the 3' enhancer. Our results provide evidence of two mechanisms for controlling 3' enhancer activity.
| Materials and Methods |
|---|
|
|
|---|
S194 cells (3.4 x 108) and 11 x 108 3-1 cells were fixed with 1.1% (v/v) formaldehyde, 100 mM NaCl, 0.5 mM EGTA, and 50 mM Tris-HCl (pH 8.0) in growth medium at 37°C for 10 min, then at 4°C for 50 min. Formaldehyde was quenched by adding 0.05 vol 2.5 M glycine. Fixed cells were washed with PBS, incubated for 15 min in 15 ml of 10 mM Tris-HCl (pH 8.0), 10 mM EDTA, 0.5 mM EGTA, and 0.25% (v/v) Triton X-100, followed by 15 min in 15 ml of 10 mM Tris-HCl (pH 8.0), 1 mM EDTA, 0.5 mM EGTA, and 200 mM NaCl, and finally sonicated in 1 ml of 10 mM Tris-HCl (pH 8.0), 1 mM EDTA, 0.5 mM EGTA, 1% (w/v) SDS plus 1 mM PMSF and a protease inhibitor mixture (1/100; P8340; Sigma-Aldrich). After sonication, cell debris was removed by centrifugation. Chromatin extracts were diluted to 6 OD 260 U/ml in IP buffer (140 mM NaCl, 1% (w/v) Triton X-100, 0.1% (w/v) sodium deoxycholate, 1 mM PMSF, 100 µg/ml yeast tRNA, and 100 µg/ml BSA); preincubated for 1 h at 4°C with 10 µl/ml 50% (v/v) protein A-agarose (Invitrogen Life Technologies); reconstituted in PBS, and washed several times in IP buffer. Aliquots (600 µl) were incubated with 24 µg of preimmune, anti-acetylH3, anti-acetyl H4 (Upstate Biotechnology), or p300 (Santa Cruz Biotechnology) Abs and incubated overnight at 4°C. Complexes were separated into bound and unbound complexes with protein A-agarose and cross-links were reversed by treatment at 65°C overnight. After treatment with RNase A and proteinase K, samples were extracted first with phenol/chloroform, then with chloroform, and precipitated with 2 vol of ethanol and 10 µg of glycogen (Roche). PCR was performed on 5-, 10-, and 20-ng DNA aliquots at 25 cycles of 94°C for 30 s, 55°C for 30 s, and 72°C for 30 s using primers specific for the Ig
3' enhancer, the intron enhancer, or the C
constant region (see Table I). Samples were dot-blotted to Hybond-N+ (Amersham Biosciences) and hybridized to a 1.1-kb EcoRI-SacI DNA fragment containing the 3' enhancer, a 473-bp AluI fragment containing the intron enhancer, or a 1.7-kb HindIII-BglII fragment containing the constant region.
|
Various full-length or mutant PU.1 plasmids were originally generated from a pBluescript KS+ PU.1 plasmid. PU.1 site-directed mutations were generated by overlap extension PCR (37) with primers containing the mutated sequences (Table I), followed by digestion with appropriate restriction enzymes. PCRs contained 30 ng of template DNA; 300 ng of each primer, 50 mM each of dATP, dCTP, dGTP, and dTTP; 10 mM Tris-HCl (pH 8.3); 50 mM KCl; 1.5 mM MgCl2; 0.001% (w/v) gelatin (PerkinElmer/Cetus); 2.5 U of AmpliTaq polymerase; and 2.5 U of Taq extender (Stratagene). The amplification cycle consisted of 35 cycles of 1 min at 95°C, 1 min at 50°C, and 2 min at 72°C, followed by one cycle of extension for 4 min at 72°C.
PCR products were either subcloned into KS+ pBluescript or directly cloned into pGEX-2T bacterial expression vector in-frame with the GST coding region. The pGEX plasmid PU.1
201272 was generated from pGEX-PU.1 by digestion with KpnI, followed by religation. The pGEX plasmids PU.1
223272 and
243272 were generated by PCR with 3' primers p222 and p242, respectively (Table I). Plasmids PU.1
730,
30100,
119160, and
245272 were described by Pongubala et al. (15);
201272 and
255272 were described by Perkel and Atchison (38).
Plasmid CMV-p300 was a gift from Dr. P. Liberman (Wistar Institute, Philadelphia, PA). CMV-PU.1 was described by Pongubala et al. (16). (Oligo2)4TKCAT, (Oligo5)4TKCAT, (Oligo7)4TKCAT, and GALTKCAT were described by Pongubala and Atchison (4).
In vitro acetylation assays
The HAT domain of p300 or p300/CBP-associated factor (P/CAF) fused to GST were expressed in Escherichia coli (BL21), bound to glutathione-Sepharose beads, and eluted with buffer containing 25 mM glutathione. Eluted proteins were further purified on PD-10 columns (Sephadex G-25M; Amersham Biosciences), and eluted with buffer containing 20 mM Tris-HCl (pH 8.0), 0.5 mM EDTA, 100 mM KCl, 20% glycerol, 0.5 mM DTT, and 1 mM PMSF. Before storage at 80°C proteins were concentrated by Centricon (YW30; Amicon). Substrate proteins (GST fusions or chicken erythrocyte histones; Sigma-Aldrich) were incubated with 0.25 µCi of [3H]acetyl-coenzyme A (Amersham Biosciences) and 0.2 µg of purified enzyme in 30 µl of acetylation buffer containing 50 mM sodium butyrate. Reaction mixtures were incubated at 30°C for 30 min, stopped by addition of Laemmli buffer, and resolved by electrophoresis on 10% SDS-polyacrylamide gels. Gels were stained with Coomassie Blue to verify protein quantity, then subjected to autoradiography to evaluate acetylation activity.
EMSAs
Nuclear extracts were prepared from S194 plasmacytoma cells essentially as previously described (39), and binding reactions were performed as previously described (15). Briefly, EMSA was performed with 0.1 ng of labeled DNA probe (10,000 cpm) in a 20-µl reaction mixture containing 2 µg poly(dI-dC), 10 mM Tris-HCl (pH 7.5), 50 mM NaCl, 1 mM EDTA, 1 mM DTT, 5% glycerol, and 8 µg of nuclear extract or protein made by in vitro translation. Proteins made by in vitro transcription and translation were prepared using a coupled transcription and translation kit (Promega) with T3 or T7 RNA polymerase. The PU.1-Pip-binding site from the
3' enhancer used as probe is CTTTGAGGAACTGAAAACAGAACCT (Oligo 5). Samples were electrophoresed on 4% polyacrylamide gels in 6.7 mM Tris-HCl (pH 7.5), 3.3 mM sodium acetate, and 1 mM EDTA.
Cell culture and transfections
NIH-3T3 cells were grown in DMEM supplemented with 10% FCS and transfected by the calcium phosphate coprecipitation method (40). Cells were harvested 48 h after transfection. Each transfection contained 1 µg of a
-galactosidase-expressing plasmid to normalize transfection efficiencies, 35 µg of reporter plasmid, and 35 µg of either empty expression vector (CMV) or CMV effectors. Transfection efficiencies were normalized using
-galactosidase activity, and CAT assays, followed by TLC, were performed as described by Gorman et al. (41). The percent CAT activity was calculated by scintillation counting of the acetylated product and substrate spots. In each case, transfections were performed three to five times. S194 and 3-1 cells were grown and transfected as previously described (4). TSA treatment was performed for 24 h at a concentration of 33 nM.
Preparation of GST fusion proteins
GST fusion proteins were prepared essentially as previously described (42). Ten-milliliter cultures of E. coli BL21 cells containing the appropriate plasmid were inoculated overnight. The following morning, cells were diluted 20 times and incubated for another 3 h. Cultures were then induced with 0.25 mM isopropyl
-D-thiogalactoside for 23 h at 30°C. Cells were spun down and subjected to a freeze-thaw cycle, followed by resuspension in 20 mM Tris-HCl (pH 8), 100 mM NaCl, 1 mM EDTA, 0.5% Nonidet P-40 (NETN) containing lysozyme, PMSF, leupeptin, and aprotinin. After incubation for 20 min on ice, cells received five 15-s sonication bursts. The suspension was centrifuged at 10,000 rpm in a Sorvall RTH-750 rotor for 10 min, and the remaining supernatant was incubated at 4°C with 0.5 ml of glutathione beads (50% slurry) for 2 h. The beads were spun down and washed three times with 5 ml of NETN before storage at 4°C.
GST chromatography
Reactions consisted of GST fusion protein or an equivalent amount of GST protein alone incubated with 515 µl of 35S-labeled protein prepared by in vitro transcription and translation in a 100-µl reaction containing NETN. Samples were rocked for 2 h at 4°C and washed at least five times with 450 µl of NETN. Samples were electrophoresed on 10% SDS-polyacrylamide gels for 1 h at 160 V, dried, and subjected to autoradiography.
Coimmunoprecipitation assays
NIH-3T3 cells were transfected with the appropriate plasmids and lysed in buffer containing 20 mM Tris (pH 7.5), 100 mM NaCl, 0.5% Nonidet P-40, 0.5 mM EDTA, and protease inhibitors. After removal of cell debris by centrifugation, lysates were immunoprecipitated with anti-FLAG M2 affinity agarose (Sigma-Aldrich) for 3 h at 4°C. Proteins bound to the affinity beads were washed extensively with lysis buffer, separated by SDS-PAGE, and then subjected to a Western blot procedure with anti-PU.1 and anti-p300 (Santa Cruz Biotechnology) Abs.
Generation of PU.1 acetyl lysine 170-specific antiserum
Rabbit antisera was prepared by Research Genetics against keyhole limpet hemocyanin-conjugated PU.1 peptide CGFTGSK-acetylK-KIRLY. The resulting antiserum was affinity purified, then cross-absorbed against the nonacetylated peptide. The specificity of the serum for acetylated PU.1 was tested by Western blot analysis with acetylated and unacetylated PU.1 (see Fig. 5C).
|
S194 cells were labeled for 90 min with [3H]acetate (16 Ci/mmol; ICN Biomedical) in the presence of 33 nM TSA. Cells were lysed in 2 ml of 350 mM NaCl, 50 mM Tris-HCl (pH 7.5), 0.5% IGEPAL (Rhone-Poulenc), 1 mM EDTA, 0.5 mM DTT, 10 mM sodium butyrate, 0.2 mM PMSF, and 1 µg/ml each of aprotinin, pepstatin, and leupeptin. The sample was centrifuged at 10,000 x g for 5 min and diluted to 150 mM NaCl with 1 mM EDTA, 0.5 mM DTT, 10 mM sodium butyrate, and protease inhibitors. Equal quantities of cell lysate were precipitated with either preimmune or anti-PU.1 Abs coupled to protein A-agarose. Precipitates were washed five times with 150 mM NaCl, 50 mM Tris-HCl (pH 7.5), 1 mM EDTA, 0.5 mM DTT, 10 mM sodium butyrate, and protease inhibitors. Samples were fractionated by SDS-PAGE, and the gel was treated with Autofluor (Amersham Biosciences), dried, and exposed to x-ray film.
| Results |
|---|
|
|
|---|
Previously, we showed that TSA could stimulate histone H3 acetylation at the Ig
3' enhancer (36). The 3' enhancer is implicated in numerous important functions, including transcription, somatic rearrangement, and somatic mutation (6, 43, 44, 45, 46, 47). To explore whether TSA treatment could augment 3' enhancer activity, we transfected the pre-B cell line 3-1 with a reporter plasmid containing the 3' enhancer 132-bp core segment driving the CAT gene (CORETKCAT) (4). This reporter construct shows weak activity in pre-B cells (4). After transfection, cells were treated with either 33 nM TSA or vehicle control. Interestingly, TSA treatment caused a dramatic 7-fold increase in enhancer activity (Fig. 1A, lanes 1 and 2). The 3' enhancer contains several segments that show enhancer activity when multimerized (4, 48). These segments bind to c-Fos and c-Jun, PU.1 and Pip, or E47 and Pip (4, 48, 49). To determine the TSA-responsive region of the 3' enhancer, we performed transfections with reporter plasmids containing multimers of these enhancer elements in the presence or the absence of TSA. Weak TSA induction (2- to 3-fold) was observed with the c-Fos/c-Jun and the E47/Pip reporters (Fig. 1, lanes 3, 4, 7, and 8). This induction level was similar to that of the empty TKCAT reporter (2-fold; lanes 9 and 10). However, the activity of the PU.1/Pip reporter was very dramatically increased by TSA treatment (10-fold; Fig. 1, lanes 5 and 6). Because the PU.1/Pip reporter, but not the E47/Pip reporter, was induced by TSA, we reasoned that PU.1 was the most likely target of TSA induction. To confirm this, we performed transfections in NIH-3T3 cells (which lack PU.1) with the PU.1/Pip reporter plasmid and a plasmid expressing PU.1 (CMV-PU.1). TSA treatment resulted in a very dramatic increase in PU.1 transcriptional activity (10- to 20-fold; Fig. 1B). Therefore, PU.1 transcriptional activity can be greatly stimulated by an agent that inhibits histone deacetylase activity. In summary, our results show that histone deacetylase inhibition stimulated 3' enhancer activity and increased PU.1 transactivation function. Because DNA binding by PU.1 is not affected by TSA treatment (36), a distinct mechanism is responsible for increased PU.1 transactivation by TSA.
|
A variety of coactivator proteins, including p300, CBP, general control nonderepressible, and P/CAF, have HAT activity. In light of our TSA results, described above, we tested the ability of these proteins to induce PU.1 transactivation potential. CMV-PU.1 was transfected with each coactivator, and transcriptional activity was assessed. PU.1 activity was stimulated by most coactivator proteins, but transactivation was stimulated the most by p300 (3-fold; Fig. 1C). P/CAF and CBP induced activity by
1.5- to 2-fold (Fig. 1C). General control nonderepressible expression had little effect on PU.1 transactivation.
To determine the PU.1 sequences necessary for p300 induction, we performed transfections with various PU.1 deletion mutants (Fig. 1D). Deletion of PU.1 sequences 730 completely abolished p300 stimulation of PU.1 transactivation (Fig. 1E, lanes 14; 1.1-fold compared with 3.2-fold by wild-type PU.1). Residues 730 comprise a small portion of the PU.1 transactivation domain (50). Stimulation by p300 was relatively unaffected by deletion of PU.1 sequences 33100 (Fig. 1, lanes 5 and 6; 2-fold) or sequences 119160 (Fig. 1, lanes 11 and 12; 3.8-fold). Residues 33100 constitute a major portion of the transactivation domain, and residues 119160 define the PU.1 PEST domain. Deletion of the entire transactivation domain (residues 2118) or the transactivation plus PEST domains (residues 2160) abolished all PU.1 transcriptional activity. These mutants were also not able to respond to p300 stimulation (lanes 710). Therefore, p300 induction of PU.1 transactivation requires PU.1 residues 730.
PU.1 transactivation domain can physically interact with p300
Coactivator proteins are usually recruited to DNA by transcription factors. Activation of PU.1 by p300 suggested that these proteins might physically interact. PU.1 was previously shown to bind to CBP (32), but p300 interaction has not been tested. We found that GST-PU.1 interaction with p300 was readily detectable, whereas p300 showed little affinity for GST alone (Fig. 2A, lanes 1 and 2). Deletion of PU.1 residues 730 greatly reduced PU.1-p300 interaction, whereas deletion of PU.1 residues 33100 had no effect (lanes 36). Therefore, physical interaction between PU.1 and p300 requires the same PU.1 segment needed for p300-dependent stimulation of transcription.
|
3' enhancer in B cells (36), we tested whether p300 was also recruited to the enhancer in vivo. ChIP experiments with anti-p300 Abs showed that p300 was indeed recruited to the 3' enhancer in vivo (Fig. 2C). PU.1 is a substrate for p300 acetylation
The physical interaction between PU.1 and p300 raised the possibility that PU.1 might be a substrate for p300 acetylation. To test this, we performed in vitro p300 acetylation assays with GST-PU.1 using a truncated p53 protein and histones as positive controls. As expected, histones and the p53 truncated fragment were acetylated by p300 (Fig. 3A, lanes 2 and 3). Interestingly, p300 also acetylated GST-PU.1 nearly as efficiently as p53 (lane 4). In contrast, P/CAF efficiently acetylated p53, but failed to recognize PU.1 as a substrate (lanes 57).
|
|
PU.1 is acetylated in vivo
Our acetylation studies above were performed with purified wild-type and mutant PU.1 proteins. To determine whether PU.1 is acetylated in vivo, we performed metabolic labeling studies with tritiated acetate in S194 cells. Cell lysates were prepared, and samples were incubated with either preimmune or anti-PU.1 Abs. The anti-PU.1 Ab precipitated a labeled protein with the electrophoretic mobility expected for PU.1 (
43 kDa; Fig. 5A), indicating that PU.1 can be acetylated in vivo.
Because PU.1 lysine 170 is a major acetylation site in vitro, we prepared antiserum specific for PU.1 acetylated on lysine 170 and used this antiserum to determine the acetylation status of PU.1 lysine 170 at the pre-B and plasma cell stages. Western blots of whole cell extracts from 3-1 and S194 cells were probed in parallel with PU.1 antisera and acetyl lysine 170-specific antisera. Interestingly, PU.1 was acetylated on lysine 170 at both developmental stages (Fig. 5B). The specificity of the Ab for acetylated PU.1 was shown by observing greater reactivity against p300 acetylated PU.1 than with unacetylated PU.1 protein (Fig. 5C).
Functional consequences of PU.1 acetylation
The major PU.1 acetylation sites that we identified in this study reside within the PU.1 DNA binding domain. Therefore, acetylation could potentially alter the ability of PU.1 to bind to DNA. We tested the DNA-binding ability of acetylated and unacetylated PU.1 by EMSA and found no discernable difference (although the fraction of acetylated PU.1 molecules was uncertain; data not shown). We also tested whether mutation of the PU.1 acetylation sites would alter DNA binding. PU.1 mutant proteins K170,171R and K206,208R were tested by EMSA for binding to the PU.1 site in the Ig
3' enhancer and for their ability to recruit Pip to its adjacent DNA binding site. Mutant K170,171R bound to DNA and recruited Pip as efficiently as wild-type PU.1 (Fig. 6A, lanes 14). In contrast, mutant K206,208R bound to DNA poorly and was inefficient at recruiting Pip to DNA (lanes 5 and 6).
|
TSA causes increased PU.1 transactivation (Fig. 1B) and increased 3' enhancer activity (Fig. 1A). If PU.1 acetylation was responsible for these inductions, one would expect TSA treatment to increase the acetylation of PU.1. However, we did not find evidence that TSA treatment caused elevated PU.1 acetylation on lysine 170. 3-1 pre-B and S194 plasmacytoma cells were left untreated or were treated with TSA, and whole cell lysates were subjected to Western blot analyses with anti-PU.1 and anti-acetyl lysine 170 PU.1 antisera. TSA treatment did not result in a substantial increase in PU.1 lysine 170 acetylation (Fig. 6C). It should be noted that acetylation of other PU.1 lysine residues could potentially be increased by TSA. However, our results are also consistent with the possibility that TSA induction of 3' enhancer activity involves a second acetylation mechanism.
TSA induces H3 acetylation preferentially at the 3' enhancer
We previously showed that TSA can induce histone H3 acetylation at the 3' enhancer (36). If this increase in H3 acetylation plays a role in 3' enhancer activity, one would expect H3 acetylation to be greater at the 3' enhancer than at other segments of the Ig
gene. To test this, ChIP experiments were performed on 3-1 cells either treated with TSA or left untreated, and acetylation of histones H3 and H4 was measured at the intron enhancer, constant region, or 3' enhancer. We found histone H4 acetylation was increased between 2- and 3-fold by TSA at all locations across the locus (Fig. 7, lanes 3, 4, 7, 8, 11, and 12). In contrast, TSA treatment caused a nonuniform induction of histone H3 acetylation. H3 acetylation increased
6-fold at the intron enhancer and
3-fold at the constant region (lanes 1, 2, 5, and 6). Most impressively, TSA caused a 15- to 20-fold induction of H3 acetylation at the 3' enhancer (lanes 9 and 10). Thus, TSA preferentially activates H3 acetylation at the 3' enhancer compared with other locations within the
locus, suggesting that this acetylation contributes to increased enhancer activity. Thus, protein acetylation can influence Ig
3' enhancer activity by two distinct mechanisms. First, acetylation can cause increased transactivation by PU.1. Second, acetylation of histone H3 correlates with increased enhancer activity.
|
| Discussion |
|---|
|
|
|---|
3' enhancer activity by two distinct mechanisms. First, the PU.1 transactivation function was increased by either inhibition of histone deacetylases via TSA treatment or cotransfection with acetyltransferase protein p300. PU.1 also served as a substrate for p300-dependent acetylation, and this acetylation was necessary for maximal PU.1 transactivation in association with p300. Thus, acetylation of PU.1 can increase PU.1 transactivation and, as a result, enhancer activity. However, because PU.1 acetylation on lysine 170 was unchanged in response to TSA, acetylation of this residue is not responsible for the increased PU.1 transactivation in response to TSA. Other PU.1 lysine residues could potentially be involved in this response. Second, elevated acetylation of histone H3 at the 3' enhancer in response to TSA treatment correlated with increased 3' enhancer activity. This suggests a chromatin structure mechanism for increased enhancer activity. Possibly, the TSA induction of enhancer activity is mediated by the chromatin structure changes we detected via H3 acetylation.
It is tempting to speculate that PU.1 is involved in the localized H3 acetylation we observed at the 3' enhancer after TSA treatment. We attempted to demonstrate this by transfecting PU.1 and p300 into NIH-3T3 cells and assessing H3 acetylation at the endogenous Ig
3' enhancer. However, we did not observe a convincing increase in H3 acetylation in response to PU.1 and p300 transfection (data not shown). This is consistent with other work showing that PU.1 does not increase nuclease accessibility at the Ig
locus in non-B lineage cells (51). Similarly, we found that stable expression of PU.1 in NIH-3T3 cells did not result in appreciable PU.1 binding at the endogenous Ig
locus, suggesting that PU.1 does not gain access to the locus in fibroblasts (data not shown). Our data suggest that the PU.1 and H3 acetylation mechanisms for increasing enhancer activity may be distinct. PU.1 knockdown studies in B cells may be required to address this issue.
Because PU.1 DNA binding in vivo is not appreciably changed by TSA treatment (36), PU.1 may respond to TSA treatment by differentially recruiting coactivators or corepressors to the enhancer. Consistent with this idea, PU.1 can recruit the corepressor protein, Grg4, to the IgH HS1,2 enhancer in conjunction with Pax-5 (52). We similarly previously showed that Pax5 can repress Ig
3' enhancer function in cooperation with PU.1 (53). In contrast, our results show that PU.1 can cooperate with p300 to activate transcription, and that p300 can increase the transactivation potential of PU.1. Thus, at some stages of B cell development, PU.1 might associate with corepressor proteins that are replaced by coactivator proteins at other stages or under other conditions. Interestingly, PU.1 can inhibit CBP HAT activity in vivo, leading to changes in global acetylation patterns (33). It will be interesting to determine whether acetylation of PU.1 by p300 changes this inhibitory phenotype.
Our studies showed that efficient p300 stimulation of PU.1 transcriptional activity required two distinct PU.1 segments. First, PU.1 residues 730 were needed for p300 stimulation, and p300 physically interacted with PU.1 via these residues. This segment comprises a portion of the PU.1 transactivation domain defined in transient expression assays (50). Interaction with PU.1 residues 730 was somewhat surprising because the p300-related protein CBP requires PU.1 sequences 74122 for physical interaction (32). Therefore, p300 and CBP appear to interact with PU.1 by distinct mechanisms. We previously showed that the PU.1 730 region is also the target of Pax5 (B cell-specific activator protein)-mediated repression of PU.1 transcriptional function (53). Cotransfection of p300 reversed the Pax5-mediated repression of PU.1 transactivation (53). Because Pax5 and PU.1 can recruit the corepressor Grg4 to DNA (52), competition between Grg4 and p300 for interaction with PU.1 could constitute a molecular switch between repression and activation. Additional studies will be needed to test this hypothesis.
The second PU.1 segment needed for maximal activity with p300 was lysine residues 170 and 171. It is likely that p300 is first recruited via PU.1 residues 730, and then p300 subsequently acetylates PU.1 on lysine residues 170, 171, 206, and 208. According to the crystal structure of the PU.1 Ets domain on DNA (54), lysine residues 170 and 171 should lie very near DNA just downstream of the PU.1 binding site. Similarly, lysines 206 and 208 lie near the sugar phosphate backbone. This would place the above-mentioned lysines in a position conducive to protein interactions with adjacently bound proteins. However, lysines 170 and 171 do not appear to influence the binding of Pip to its adjacent DNA binding site (Fig. 6A), and p300 stimulation of PU.1 transcription does not require Pip. Thus, p300 stimulation must target some function other than PU.1 recruitment of Pip DNA binding. It will be interesting to determine the roles of these acetylation sites on PU.1 repression in association with Grg4. The reduced binding observed with the K206,208R PU.1 mutant is intriguing. Acetylation of these residues could potentially be used to regulate DNA binding. This would represent a novel mechanism of regulating PU.1 function.
PU.1 is implicated in numerous developmental processes, including differentiation of B cells, T cells, macrophages, and erythroid cells (19, 20, 21, 22, 23, 25, 26, 27, 28, 29, 30, 55). The interplay between PU.1 and either GATA-1 or Pax5 (B cell-specific activator protein) has been proposed to regulate the development of either the erythroid or macrophage lineage, respectively (23, 29, 30, 53, 56). More recently, the effects of modified PU.1 expression levels have been described (23, 31). Low PU.1 expression levels in progenitor cells generally give rise to B cell development, whereas higher levels yield macrophage development (23). In addition, reducing PU.1 expression levels in vivo to 20% of wild-type levels leads to a high incidence of acute myeloid leukemia (31). Thus, changing PU.1 activity by either expression level or, perhaps, its function via protein interactions or post-translational modifications could have a very dramatic impact on biological processes. Exploring how the p300-dependent acetylation sites identified in this study relate to various PU.1 functions will be an important goal.
| Acknowledgments |
|---|
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported by National Institutes of Health Grant RO1GM42415 (to M.L.A.). ![]()
2 Current address: 145 King of Prussia Road, Wyeth-Ayrest Research Laboratories, Radnor, PA 19087. ![]()
3 Address correspondence and reprint requests to Dr. Michael Atchison, University of Pennsylvania School of Veterinary Medicine, 3800 Spruce Street, Philadelphia, PA 19104. E-mail address: atchison{at}vet.upenn.edu ![]()
4 Abbreviations used in this paper: ETS, erythroblast transformation specific; CBP, CREB binding protein; TSA, trichostatin A; HAT, histone acetyltransferase; ChIP, chromatin immunoprecipitation; P/CAF, p300/CBP-associated factor. ![]()
Received for publication January 19, 2005. Accepted for publication August 11, 2005.
| References |
|---|
|
|
|---|
locus involves both positive and negative sequence elements in the 3' enhancer that affect synergy with the intron enhancer. J. Biol. Chem. 274:3285.-3293.
3' enhancer: regulation by Id, a repressor of helix-loop-helix transcription factors. Mol. Cell. Biol. 11:1040.-1047.
B/Rel factors and blocks
gene transcription in pre-B lymphocytes. Genes Dev. 8:678.-687.
3'-enhancer triggers gene expression in early B lymphocytes but its activity is enhanced on B cell activation. Int. Immunol. 8:1561.-1568.
light chain intronic enhancer and 3' enhancer in
rearrangement and methylation. Nat. Immunol. 3:463.-468. [Medline]
gene activation: a potential control region within the gene. Nature 299:449.-451. [Medline]
3' enhancer. Mol. Cell. Biol. 16:3138.-3155. [Abstract]
gene locus. J. Biol. Chem. 261:3838.-3845.
light chain enhancers in primary pro- and pre-B cells: a model for
locus activation. Immunity 6:131.-143. [Medline]
3' enhancer activity. Mol. Cell. Biol. 12:368.-378.
24 enhancer. Mol. Cell. Biol. 13:6452.-6461.
sterile transcription during Ig
chain gene rearrangement. J. Immunol. 172:4858.-4865.
3' enhancer Is activated by gradients of chromatin accessibility and protein association. J. Immunol. 174:2834.-2842.
chain intron enhancer abolishes
chain gene rearrangement in cis but not
chain gene rearrangement in trans. EMBO J. 12:2329.-2336. [Medline]
3' enhancer influences the ratio of Ig
versus Ig
B lymphocytes. Immunity 5:241.-252. [Medline]
light chain intronic enhancer/matrix attachment region impairs but does not abolish V
J
rearrangement. Immunity 4:377.-385. [Medline]
-J
joining. Cell 83:1113.-1123. [Medline]
gene: critical role of the intron enhancer/matrix attachment region. Cell 77:239.-248. [Medline]
3' enhancer. J. Biol. Chem. 270:10304.-10413. This article has been cited by other articles:
![]() |
F. Wei, K. Zaprazna, J. Wang, and M. L. Atchison PU.1 Can Recruit BCL6 to DNA To Repress Gene Expression in Germinal Center B Cells Mol. Cell. Biol., September 1, 2009; 29(17): 4612 - 4622. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Dietschy, I. Shevelev, J. Pena-Diaz, D. Huhn, S. Kuenzle, R. Mak, M. F. Miah, D. Hess, M. Fey, M. O. Hottiger, et al. p300-mediated acetylation of the Rothmund-Thomson-syndrome gene product RECQL4 regulates its subcellular localization J. Cell Sci., April 15, 2009; 122(8): 1258 - 1267. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Asano, J. Czuwara, and M. Trojanowska Transforming Growth Factor- Regulates DNA Binding Activity of Transcription Factor Fli1 by p300/CREB-binding Protein-associated Factor-dependent Acetylation J. Biol. Chem., November 30, 2007; 282(48): 34672 - 34683. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Hodawadekar, F. Wei, D. Yu, A. Thomas-Tikhonenko, and M. L. Atchison Epigenetic Histone Modifications Do Not Control Ig{kappa} Locus Contraction and Intranuclear Localization in Cells with Dual B Cell-Macrophage Potential J. Immunol., November 1, 2006; 177(9): 6165 - 6171. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |