The Journal of Immunology, 2005, 175: 4834-4838.
Copyright © 2005 by The American Association of Immunologists
Cutting Edge: TLR4 Deficiency Confers Susceptibility to Lethal Oxidant Lung Injury1
Xuchen Zhang*,
Peiying Shan*,
Salman Qureshi
,
Robert Homer
,
Ruslan Medzhitov
,
Paul W. Noble* and
Patty J. Lee2,*
* Section of Pulmonary and Critical Care Medicine, Yale University School of Medicine, New Haven, CT 06520;
Centre for the Study of Host Resistance, McGill University, Montreal, Quebec, Canada;
Department of Pathology, Yale University School of Medicine, New Haven, CT 06520; and
Howard Hughes Medical Institute and Section of Immunobiology, Yale University School of Medicine, New Haven, CT 06510
 |
Abstract
|
|---|
TLRs have been studied extensively in pathogen-mediated host responses. We use a murine model of lethal oxidant-mediated injury to demonstrate for the first time that mammalian TLR4 is required for survival and lung integrity. Administering high levels of inspired oxygen, or hyperoxia, is commonly used as a life-sustaining measure in critically ill patients. However, prolonged exposures can lead to respiratory failure and death. TLR4-deficient mice exhibited increased mortality and lung injury during hyperoxia. The enhanced susceptibility of TLR4-deficient mice to hyperoxia was associated with an inability to up-regulate Bcl-2 and phospho-Akt. Restoration of Bcl-2 and phospho-Akt levels by the exogenous transfer of the antioxidant gene heme oxygenase-1 markedly attenuated hyperoxia-induced injury, apoptosis, and mortality in TLR4-deficient mice. Taken together, our results suggest a protective role of TLR4 in oxidant-mediated injury, providing novel mechanistic links among innate immunity, oxidant stress, and apoptosis.
 |
Introduction
|
|---|
Inhalation of high levels of oxygen (hyperoxia) is a necessary and life-saving component in the treatment of critically ill patients. However, prolonged hyperoxia leads to excessive oxidant stress via the accumulation of reactive oxygen species (ROS)3 that initiate epithelial and endothelial cell death, increased pulmonary capillary permeability, inflammation, lung destruction, and ultimately death (1). ROS have been linked to TLR4 activation and signaling (2). Functional TLR4 has recently been described in the lung (3), but its role in the lung is poorly understood. The lungs, unlike many other organs, are constantly exposed to both microbial agents as well as ambient oxygen and have therefore evolved an extensive system of innate immune and antioxidant defenses, previously thought to be distinct pathways. Our data suggest that TLR4 may mediate a common pathway for innate immune, antioxidant, and antiapoptotic responses.
Generally, TLR4 deficiency is thought to be protective against models of injury such as endotoxin, ischemia-reperfusion, and ozone (4, 5, 6). To the best of our knowledge, we demonstrate for the first time that TLR4 is essential for survival in vivo and in lung structural cells during lethal hyperoxic exposure. Furthermore, we use exogenous delivery of heme oxygenase (HO)-1 as both an antioxidant and antiapoptotic strategy to successfully rescue TLR4/ mice from oxidant-induced death. HO is the rate-limiting enzyme that degrades heme into bilirubin, free iron, and CO (7). Three isoforms of HO exist: HO-2 and -3 are constitutively expressed, whereas HO-1 is the inducible isoform and thought to function as an antioxidant (8). The ability of HO-1 to restore Bcl-2 and phospho-Akt protein expression as well as improve survival in TLR4/ mice highlights the role of TLR4 in maintaining antioxidant and antiapoptotic balance in the lung.
 |
Materials and Methods
|
|---|
Mice
TLR4/ (B6;129Tlr4tm1Aki) and the control mice (B6;129F2) have been described previously (9). The TLR4/ mice were originally provided by S. Akira (Osaka University, Osaka, Japan) (4). Mice were maintained and bred under specific pathogen-free conditions at the animal facility of Yale University School of Medicine. All of the protocols were reviewed and approved by the Animal Care and Use Committee at Yale University.
Murine hyperoxia exposure
Mice were exposed to 100% oxygen (O2) in a Plexiglas exposure chamber. Naive mice were kept at room air. For survival studies, animals were carefully monitored and the time of death noted. Lung injury was assessed 72 h after the initiation of hyperoxia by performing bronchoalveolar lavage (BAL) cell counts and protein analyses. Lung specimens were also processed for histology, RNA and protein extraction, apoptosis, and immunohistochemistry analyses.
Cell culture and hyperoxia exposures
Lung endothelial cells and type II alveolar epithelial cells were isolated from lungs of wild-type (WT) and TLR4/ mice with modification of the methods described previously (10). Hyperoxic conditions were achieved as described previously (11).
Apoptosis assays
TUNEL assay was performed, and TUNEL-positive cells were expressed as a percentage to total cells as described previously (11). Flow cytometry was performed on cells using a FACS to detect Annexin V-FITC labeling (BD Pharmingen) as described previously (12).
Western blot analysis
Protein levels of Bcl-2, Bad, Bax, caspase-3 (Santa Cruz Biotechnology), HO-1 (StressGen Biotechnologies), and phospho-Akt (Cell Signaling Technology) were analyzed by Western blot assays as described previously (13).
Intranasal administration of recombinant adenovirus-containing HO-1 cDNA
Mice were anesthetized with methoxyflurane, and then 5 x 108 PFU of adenoviral HO-1 (Ad-HO-1) (a gift from L. E. Otterbein, Harvard University, Boston, MA) or adenoviral
-galactosidase (Ad-LacZ) (BD Biosciences) were administered intranasally to each mouse in a volume of 50 µl as described previously (12).
Total RNA isolation and RT-PCR amplification
Total RNA from lung tissue was extracted as described previously (12). For mouse TLR4, sense: GCTTTCACCTCTGCCTTCAC; antisense: CGAGGCTTTTCCATCCAATA; and for mouse
-actin, sense: GTGGGCCGCTCTAGGCACCAA; antisense: CTCTTTGATGTCACGCACGATTTC. RT-PCR was performed using RT-PCR Master Mix (USB).
Statistics
Data are expressed as mean ± SE and analyzed by Students t test. Survival studies were evaluated using log-rank analysis (14), and statistical analysis was performed using GraphPad Prism 3.0 (GraphPad) software. Significant difference was accepted at p < 0.05.
 |
Results and Discussion
|
|---|
TLR4 is essential for survival during hyperoxia
To investigate whether TLR4 and its endogenous ligands are involved in hyperoxia-induced lung injury, we exposed WT mice to hyperoxia for 72 h, a time point previously determined to be most representative of maximal stress responses in the murine lung (15). We found that hyperoxia increased TLR4 mRNA expression in whole lung lysates (Fig. 1A). We also confirmed increased TLR4 protein expression by immunohistochemistry in a variety of lung cells (including lung epithelial and endothelial cells) after hyperoxia (data not shown). Hyperoxia also increased expression of the endogenous TLR4 ligands fibronectin and hyaluronan in both WT and TLR4-deficient mice (TLR4/) (data not shown). To determine whether there was a functional role in vivo for TLR4 induction during hyperoxia, we assessed survival rates of WT and TLR4/ mice in continuous hyperoxia. Given that TLR4 deficiency has been shown to be protective in other models of noninfectious injury (4, 5, 6), we expected TLR4/ mice would be less susceptible to the damaging effects of hyperoxia. To our surprise, TLR4/ mice showed significantly increased mortality during hyperoxia compared with WT mice (Fig. 1B). After 5 days of hyperoxia exposure, 55.6% of the WT mice (n = 18) remained alive, whereas none of the TLR4/ mice (n = 18) were alive. The range of survival for TLR4/ mice was 2.55 days, and the range for WT mice was 3.56.5 days. This indicated that a TLR4-dependent signaling pathway was critical for survival during hyperoxia. Consistent with the survival data, TLR4/ mice exposed to hyperoxia exhibited significantly greater inflammation, lung permeability, and oxidative DNA damage compared with WT mice (Fig. 1, CE). Of note, naive TLR4/ mice and naive WT mice have similar basal levels of BAL cell counts, protein, and DNA oxidation (data not shown).

View larger version (31K):
[in this window]
[in a new window]
|
FIGURE 1. TLR4 is essential for survival during hyperoxia. A, RT-PCR analysis for TLR4 mRNA expression in lung lysates from WT naive mice (lane 1) and mice exposed to 72-h O2 (lanes 24). B, Survival curves of WT (n = 18) and TLR4/ (n = 18) mice exposed to hyperoxia (p = 0.004, WT vs TLR4/). C, Lung inflammation was detected by BAL cell counts in naive mice, WT mice, and TLR4/ mice exposed to 72-h O2. D, Lung permeability was assessed by BAL protein. Data represent mean ± SE. *, p < 0.05 compared with naive mice; **, p < 0.05 compared with WT O2. E, DNA oxidation was detected by 8-hydroxy-2'-deoxyguanosine immunohistochemical staining in the lungs of naive, WT mice exposed to 72-h O2, and TLR4/ mice exposed to 72-h O2. Arrows indicate positive red staining (x400, original magnification). Results shown are representative of three to five independent experiments.
|
|
TLR4 is essential for appropriate antiapoptotic responses during hyperoxia in vivo and in vitro
Both animal and recent patient studies have established apoptosis, specifically lung endothelial and epithelial apoptosis, as an important part of the pathogenesis of acute lung injury (16, 17). We found that TLR4/ mice exhibited significantly greater lung TUNEL staining (Fig. 2A). Both epithelial and endothelial cells isolated from TLR4/ mice also showed significantly more apoptosis than cells from WT mice during hyperoxia (Fig. 2, B and C).

View larger version (12K):
[in this window]
[in a new window]
|
FIGURE 2. TLR4 is essential for lung endothelial and epithelial survival during hyperoxia. A, Lung sections were processed for TUNEL staining and quantitation expressed as percentage of total cells. Data are shown as mean ± SE. *, p < 0.05 compared with naive mice; **, p < 0.05 compared with WT 72-h O2. B, Apoptosis of lung endothelial cells isolated from WT and TLR4/ mice was measured by flow cytometry after 72-h O2. C, Apoptosis of lung alveolar type II cells isolated from WT and TLR4/ mice was measured by flow cytometry after 72-h O2. Graphical representation of the data is shown as mean ± SE. *, p < 0.05 compared with corresponding 72-h O2; **, p < 0.05 compared with WT 72-h O2. Results shown are representative of three to five independent experiments.
|
|
We postulated that a potential mechanism of increased lung apoptosis in TLR4/ mice might be differences in anti- and proapoptotic protein expression. Our Western blot results showed that hyperoxia increased expression of Bcl-2 in WT lungs (Fig. 3). However, TLR4/ mice were unable to significantly increase Bcl-2 protein in their lungs. The expression of Bad and Bax appeared relatively unchanged during hyperoxia in the WT and TLR4/ mice. The Akt pathway is also known to play an important role in modulating apoptosis and was recently linked to TLR4 in response to LPS (18, 19). We found that TLR4/ mice were unable to increase phospho-Akt expression in response to hyperoxia, unlike WT mice (Fig. 3). In addition, TLR4/ mice have exaggerated levels of activated caspase-3 expression in lungs, as assessed by Western blot analysis, during hyperoxia compared with WT mice (Fig. 3). These data indicated that the mechanism of increased lung apoptosis and injury in TLR4/ mice was the lack of key antiapoptotic responses, namely Bcl-2 and phospho-Akt induction, and increased proapoptotic processes such as caspase-3 activation. TLR4 signaling is generally thought to be proapoptotic, but this has previously been studied in the context of LPS, microbes, or immune cells (20, 21, 22). We show both in vivo and in epithelial and endothelial cells isolated from TLR4/ mice that TLR4 is necessary to maintain appropriate antiapoptotic responses during hyperoxia.

View larger version (49K):
[in this window]
[in a new window]
|
FIGURE 3. TLR4 modulates antiapoptotic protein and caspase-3 expression during hyperoxia. Western blot analysis for pro- and antiapoptotic protein expression in lung lysates from single animals: naive mice (lane 1), WT mice exposed to 72-h O2 (lanes 2 and 3), and TLR4/ mice exposed to 72-h O2 (lanes 4 and 5). Ab to -tubulin was used as loading control. Results shown are representative of three to five independent experiments.
|
|
Hyperoxia likely induces lung TLR4 signaling via increased endogenous ligands such as fibronectin and hyaluronan in vivo. Alternatively, ROS may directly "ligate" TLR4 by affecting redox-sensitive moieties of the receptor given that hyperoxia can also induce TLR4 in isolated lung cell culture systems (data not shown). Others have demonstrated the involvement of the endothelial and epithelial cell in TLR signaling (23, 24). Potential explanations as to why TLR4 deficiency is protective in certain settings yet not in others include the use of different mouse strains and injury models. It is clear that distinct TLR signaling pathways are used in response to different types of injury. For instance, unlike LPS or ischemia-reperfusion-induced TLR signaling in which NF-
B mediates TLR signal transduction (25), NF-
B does not appear to have a major role in hyperoxia-induced injury (26).
An antioxidant and antiapoptotic strategy with HO-1 overexpression rescues TLR4/ mice from lethal hyperoxia
HO-1 and its reaction products exert potent antioxidant and antiapoptotic properties in a variety of injury models (12, 27). We have demonstrated that HO-1 and its reaction product CO have the ability to induce the antiapoptotic proteins Bcl-2 and phospho-Akt (13, 28), both of which are lacking in the TLR4/ mice. Of note, TLR4/ mice have the ability to up-regulate HO-1 expression during hyperoxia. However, stress-induced HO-1 expression is likely a consequence of severe oxidant injury, and HO-1 levels as well as timing of induction in this context are inadequate to provide significant protection (12). High levels of HO-1 and its products are required before or at the onset of injury to have beneficial effects. Therefore, we administered intranasal rat HO-1 in an adenoviral vector (Ad-HO-1) to achieve HO-1 overexpression in mouse lungs before hyperoxia exposure. WT mice given Ad-HO-1 showed significantly increased survival during hyperoxia compared with WT mice given empty vector (Ad-LacZ) (Fig. 4A). Furthermore, TLR4/ mice given Ad-HO-1 also showed markedly increased survival compared with TLR4/ mice given Ad-LacZ, reaching a survival rate comparable to WT/Ad-LacZ mice (Fig. 4A). After 5 days of hyperoxia exposure, 50% of TLR4/ mice with Ad-HO-1 remained alive, whereas all of the TLR4/ mice with Ad-LacZ were dead. The range of survival for TLR4/ mice with Ad-HO-1 was 46 days, and for TLR4/ mice with Ad-LacZ the range of survival was 3.55 days. The improved survival with Ad-HO-1 correlated with attenuation of lung inflammation, permeability, and oxidative DNA damage in TLR4/ mice during hyperoxia (data not shown).

View larger version (25K):
[in this window]
[in a new window]
|
FIGURE 4. Ad-HO-1 gene transfer rescues TLR4/ mice from hyperoxia-induced mortality and apoptosis. TLR4/ mice were intranasally administered Ad-LacZ or rat Ad-HO-1 48 h before hyperoxia and then assessed for survival and lung injury. A, Survival curves for WT and TLR4/ administered Ad-HO-1 or Ad-LacZ before hyperoxia (p = 0.03, WT/Ad-LacZ vs WT/Ad-HO-1; p = 0.02, TLR4//Ad-LacZ vs TLR4//Ad-HO-1). B, Lung sections were processed for TUNEL staining, and quantitation was expressed as percentage of total cells. Data are shown as mean ± SE. *, p < 0.05 compared with naive mice; **, p < 0.05 compared with TLR4/ Ad-HO-1 72-h O2. C, Western blot analysis in lung lysates from naive WT (lane 1), WT mice exposed to 72-h O2 (lane 2), naive TLR4/ mice (lane 3), TLR4/ mice administered Ad-HO-1 before 72-h O2 (lane 4), and TLR4/ mice administered Ad-LacZ before 72-h O2 (lane 5). Results shown are representative of three to five independent experiments.
|
|
In addition, Ad-HO-1 rescued TLR4/ mice from hyperoxia-induced lung apoptosis (Fig. 4B). As expected, Ad-HO-1 led to appropriately increased levels of lung HO-1 protein expression in TLR4/ compared with TLR4/ mice given Ad-LacZ before hyperoxia (Fig. 4C). Interestingly, Ad-HO-1 restored levels of Bcl-2 and phospho-Akt protein expression in TLR4/ mice to that of WT mice when challenged with hyperoxia (Fig. 4C). This indicated that TLR4/ mice retain the ability to induce cytoprotective pathways. Taken together, these data demonstrate that TLR4 is essential for survival, possibly by maintaining appropriate levels of antiapoptotic responses such as Bcl-2 and phospho-Akt induction in the face of oxidant stress. Although links between TLR4 and Akt have been described (19), the precise pathway(s) whereby TLR4 modulates Akt and Bcl-2 during oxidant injury is unknown and will be an important focus of future studies. There is also a possibility that TLR4/ mice are deficient in multiple signaling pathways, which thus opens up new avenues of investigation.
Our current data point to a novel paradigm for TLR4 signaling in response to exogenous oxidants. TLR4, at least in the lung, appear to be not only important sensors of conserved microbial components but also exogenous oxidants and thereby modulators of downstream responses such as inflammation and apoptosis. This would make teleological sense for an organ that is the first-line defense against inhaled microbial Ags as well as numerous oxidative stressors in the environment. In addition, the mechanisms of TLR4 responses in the lung during oxidant stress are likely to be distinct from what has thus far been described in other systems. Ultimately, these studies bring forth a fundamental link between innate immunity pathways and exogenous, noninfectious injury signals. These new insights will allow broader approaches for the prevention and treatment of a variety of oxidant-mediated disease processes.
 |
Acknowledgments
|
|---|
We thank Suping Chen for her technical assistance, Juan Fan for mouse breeding, and Susan Ardito for her administrative assistance.
 |
Disclosures
|
|---|
The authors have no financial conflict of interest.
 |
Footnotes
|
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
1 P.J.L. was supported by National Institutes of Health Grant HL 071595 and American Heart Heritage Affiliate Grant 0355863T. 
2 Address correspondence and reprint requests Dr. Patty J. Lee, Section of Pulmonary and Critical Care Medicine, Yale University School of Medicine, P.O. Box 208057, New Haven, CT 06520. E-mail address: patty.lee{at}yale.edu 
3 Abbreviations used in this paper: ROS, reactive oxygen species; HO, heme oxygenase; O2, oxygen; BAL, bronchoalveolar lavage; WT, wild-type; Ad-HO-1, adenoviral HO-1; Ad-LacZ, adenoviral
-galactosidase. 
Received for publication May 4, 2005.
Accepted for publication August 11, 2005.
 |
References
|
|---|
- Buccellato, L. J., M. Tso, O. I. Akinci, N. S. Chandel, G. R. Budinger. 2004. Reactive oxygen species are required for hyperoxia-induced Bax activation and cell death in alveolar epithelial cells. J. Biol. Chem. 279:6753.-6760. [Abstract/Free Full Text]
- Asehnoune, K., D. Strassheim, S. Mitra, J. Y. Kim, E. Abraham. 2004. Involvement of reactive oxygen species in Toll-like receptor 4-dependent activation of NF-
B. J. Immunol. 172:2522.-2529. [Abstract/Free Full Text]
- Armstrong, L., A. R. Medford, K. M. Uppington, J. Robertson, I. R. Witherden, T. D. Tetley, A. B. Millar. 2004. Expression of functional toll-like receptor-2 and -4 on alveolar epithelial cells. Am. J. Respir. Cell Mol. Biol. 31:241.-245. [Abstract/Free Full Text]
- Hoshino, K., O. Takeuchi, T. Kawai, H. Sanjo, T. Ogawa, Y. Takeda, K. Takeda, S. Akira. 1999. Cutting edge: Toll-like receptor 4 (TLR4)-deficient mice are hyporesponsive to lipopolysaccharide: evidence for TLR4 as the Lps gene product. J. Immunol. 162:3749.-3752. [Abstract/Free Full Text]
- Ke, B., X. D. Shen, F. Gao, R. W. Busuttil, J. W. Kupiec-Weglinski. 2004. Interleukin 13 gene transfer in liver ischemia and reperfusion injury: role of Stat6 and TLR4 pathways in cytoprotection. Hum. Gene Ther. 15:691.-698. [Medline]
- Kleeberger, S. R., S. P. Reddy, L. Y. Zhang, H. Y. Cho, A. E. Jedlicka. 2001. Toll-like receptor 4 mediates ozone-induced murine lung hyperpermeability via inducible nitric oxide synthase. Am. J. Physiol. 280:L326.-L333.
- Lee, P. J., L. E. Otterbein, J. Sethi, M. Sasidhar, A. M. K. Choi. 2002. Heme oxygenase-1 in lung disease. N. Marczin, and S. Kharitonov, and M. Yacoub, and P. Barnes, eds. In Disease Markers in Exhaled Breath Vol. 170:117.-131. Marcel Dekker, New York.
- Maines, M. D.. 1988. Heme oxygenase: function, multiplicity, regulatory mechanisms, and clinical applications. FASEB J. 2:2557.-2568. [Abstract]
- Rakoff-Nahoum, S., J. Paglino, F. Eslami-Varzaneh, S. Edberg, R. Medzhitov. 2004. Recognition of commensal microflora by Toll-like receptors is required for intestinal homeostasis. Cell 118:229.-241. [Medline]
- Kuhlencordt, P. J., E. Rosel, R. E. Gerszten, M. Morales-Ruiz, D. Dombkowski, W. J. Atkinson, F. Han, F. Preffer, A. Rosenzweig, W. C. Sessa, et al 2004. Role of endothelial nitric oxide synthase in endothelial activation: insights from eNOS knockout endothelial cells. Am. J. Physiol. 286:C1195.-C1202.
- Zhang, X., P. Shan, M. Sasidhar, G. L. Chupp, R. A. Flavell, A. M. Choi, P. J. Lee. 2003. Reactive oxygen species and extracellular signal-regulated kinase 1/2 mitogen-activated protein kinase mediate hyperoxia-induced cell death in lung epithelium. Am. J. Respir. Cell Mol. Biol. 28:305.-315. [Abstract/Free Full Text]
- Zhang, X., P. Shan, D. Jiang, P. W. Noble, N. G. Abraham, A. Kappas, P. J. Lee. 2004. Small interfering RNA targeting heme oxygenase-1 enhances ischemia-reperfusion-induced lung apoptosis. J. Biol. Chem. 279:10677.-10684. [Abstract/Free Full Text]
- Zhang, X., P. Shan, J. Alam, R. J. Davis, R. A. Flavell, P. J. Lee. 2003. Carbon monoxide modulates Fas/Fas ligand, caspases, and Bcl-2 family proteins via the p38
mitogen-activated protein kinase pathway during ischemia-reperfusion lung injury. J. Biol. Chem. 278:22061.-22070. [Abstract/Free Full Text]
- Mantel, N.. 1966. Evaluation of survival data and two new rank order statistics arising in its consideration. Cancer Chemother. Rep. 50:163.-170. [Medline]
- Lee, P. J., J. Alam, S. L. Sylvester, N. Inamdar, L. Otterbein, A. M. K. Choi. 1996. Regulation of heme oxygenase-1 expression in vivo and in vitro in hyperoxic lung injury. Am. J. Respir. Cell Mol. Biol. 14:556.-568. [Abstract]
- Albertine, K. H., M. F. Soulier, Z. Wang, A. Ishizaka, S. Hashimoto, G. A. Zimmerman, M. A. Matthay, L. B. Ware. 2002. Fas and fas ligand are up-regulated in pulmonary edema fluid and lung tissue of patients with acute lung injury and the acute respiratory distress syndrome. Am. J. Pathol. 161:1783.-1796. [Abstract/Free Full Text]
- Mantell, L. L., S. Horowitz, J. M. Davis, J. A. Kazzaz. 1999. Hyperoxia-induced cell death in the lung: the correlation of apoptosis, necrosis, and inflammation. Ann. NY Acad. Sci. 887:171.-180. [Medline]
- Vara, J. A. Fresno, E. Casado, J. de Castro, P. Cejas, C. Belda-Iniesta, M. Gonzalez-Baron. 2004. PI3K/Akt signalling pathway and cancer. Cancer Treat. Rev. 30:193.-204. [Medline]
- Vivarelli, M. S., D. McDonald, M. Miller, N. Cusson, M. Kelliher, R. S. Geha. 2004. RIP links TLR4 to Akt and is essential for cell survival in response to LPS stimulation. J. Exp. Med. 200:399.-404. [Abstract/Free Full Text]
- Haase, R., C. J. Kirschning, A. Sing, P. Schrottner, K. Fukase, S. Kusumoto, H. Wagner, J. Heesemann, K. Ruckdeschel. 2003. A dominant role of Toll-like receptor 4 in the signaling of apoptosis in bacteria-faced macrophages. J. Immunol. 171:4294.-4303. [Abstract/Free Full Text]
- Hsu, L. C., J. M. Park, K. Zhang, J. L. Luo, S. Maeda, R. J. Kaufman, L. Eckmann, D. G. Guiney, M. Karin. 2004. The protein kinase PKR is required for macrophage apoptosis after activation of Toll-like receptor 4. Nature 428:341.-345. [Medline]
- Ruckdeschel, K., G. Pfaffinger, R. Haase, A. Sing, H. Weighardt, G. Hacker, B. Holzmann, J. Heesemann. 2004. Signaling of apoptosis through TLRs critically involves Toll/IL-1 receptor domain-containing adapter inducing IFN-
, but not MyD88, in bacteria-infected murine macrophages. J. Immunol. 173:3320.-3328. [Abstract/Free Full Text]
- Fan, J., R. S. Frey, A. B. Malik. 2003. TLR4 signaling induces TLR2 expression in endothelial cells via neutrophil NADPH oxidase. J. Clin. Invest. 112:1234.-1243. [Medline]
- Guillot, L., S. Medjane, K. Le-Barillec, V. Balloy, C. Danel, M. Chignard, M. Si-Tahar. 2004. Response of human pulmonary epithelial cells to lipopolysaccharide involves Toll-like receptor 4 (TLR4)-dependent signaling pathways: evidence for an intracellular compartmentalization of TLR4. J. Biol. Chem. 279:2712.-2718. [Abstract/Free Full Text]
- Li, C., T. Ha, J. Kelley, X. Gao, Y. Qiu, R. L. Kao, W. Browder, D. L. Williams. 2004. Modulating Toll-like receptor mediated signaling by (1
3)-
-D-glucan rapidly induces cardioprotection. Cardiovasc. Res. 61:538.-547. [Abstract/Free Full Text]
- Yang, G., A. Abate, A. G. George, Y. H. Weng, P. A. Dennery. 2004. Maturational differences in lung NF-
B activation and their role in tolerance to hyperoxia. J. Clin. Invest. 114:669.-678. [Medline]
- Otterbein, L. E., L. L. Mantell, A. M. K. Choi. 1999. Carbon monoxide provides protection against hyperoxic lung injury. Am. J. Physiol. 276:L688.-L694.
- Zhang, X., P. Shan, J. Alam, X.-Y. Fu, P. J. Lee. 2005. Carbon monoxide differentially modulates STAT1 and STAT3 and inhibits apoptosis via a phosphatidylinositol 3-kinase/Akt and p38 kinase-dependent STAT3 pathway during anoxia-reoxygenation injury. J. Biol. Chem. 280:8714.-8721. [Abstract/Free Full Text]
Related articles in The JI:
- Cutting Edge: TLR4 deficiency confers susceptibility to lethal oxidant lung injury.
- X. Zhang, P. Shan, S. Qureshi, R. Homer, R. Medzhitov, P. W. Noble, and P. J. Lee
The JI 2005 175: 8440.
[Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
G. Zanotti, M. Casiraghi, J. B. Abano, J. R. Tatreau, M. Sevala, H. Berlin, S. Smyth, W. K. Funkhouser, K. Burridge, S. H. Randell, et al.
Novel critical role of Toll-like receptor 4 in lung ischemia-reperfusion injury and edema
Am J Physiol Lung Cell Mol Physiol,
July 1, 2009;
297(1):
L52 - L63.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. K. Bauer and E. A. Rondini
REVIEW PAPER: The Role of Inflammation in Mouse Pulmonary Neoplasia
Vet. Pathol.,
May 1, 2009;
46(3):
369 - 390.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. J. Paul-Clark, S. K. McMaster, R. Sorrentino, S. Sriskandan, L. K. Bailey, L. Moreno, B. Ryffel, V. F. Quesniaux, and J. A. Mitchell
Toll-like Receptor 2 Is Essential for the Sensing of Oxidants during Inflammation
Am. J. Respir. Crit. Care Med.,
February 15, 2009;
179(4):
299 - 306.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Chao
Toll-like receptor signaling: a critical modulator of cell survival and ischemic injury in the heart
Am J Physiol Heart Circ Physiol,
January 1, 2009;
296(1):
H1 - H12.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. A. Murray, D. A. Knight, L. McAlonan, R. Argentieri, A. Joshi, F. Shaheen, M. Cunningham, L. Alexopolou, R. A. Flavell, R. T. Sarisky, et al.
Deleterious Role of TLR3 during Hyperoxia-induced Acute Lung Injury
Am. J. Respir. Crit. Care Med.,
December 15, 2008;
178(12):
1227 - 1237.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M-Y. Li, J. Yip, M. K. Y. Hsin, T. S. K. Mok, Y. Wu, M. J. Underwood, and G. G. Chen
Haem oxygenase-1 plays a central role in NNK-mediated lung carcinogenesis
Eur. Respir. J.,
October 1, 2008;
32(4):
911 - 923.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. M. Lavoie, C. Pham, and K. L. Jang
Heritability of Bronchopulmonary Dysplasia, Defined According to the Consensus Statement of the National Institutes of Health
Pediatrics,
September 1, 2008;
122(3):
479 - 485.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. R. Medler, D. N. Petrusca, P. J. Lee, W. C. Hubbard, E. V. Berdyshev, J. Skirball, K. Kamocki, E. Schuchman, R. M. Tuder, and I. Petrache
Apoptotic Sphingolipid Signaling by Ceramides in Lung Endothelial Cells
Am. J. Respir. Cell Mol. Biol.,
June 1, 2008;
38(6):
639 - 646.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. W. Hollingsworth, S. Maruoka, Z. Li, E. N. Potts, D. M. Brass, S. Garantziotis, A. Fong, W. M. Foster, and D. A. Schwartz
Ambient Ozone Primes Pulmonary Innate Immunity in Mice
J. Immunol.,
October 1, 2007;
179(7):
4367 - 4375.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. R. Prows, A. P. Hafertepen, A. V. Winterberg, W. J. Gibbons Jr., C. Liu, and T. G. Nick
Genetic analysis of hyperoxic acute lung injury survival in reciprocal intercross mice
Physiol Genomics,
August 20, 2007;
30(3):
271 - 281.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. R. Prows, A. P. Hafertepen, W. J. Gibbons Jr., A. V. Winterberg, and T. G. Nick
A genetic mouse model to investigate hyperoxic acute lung injury survival
Physiol Genomics,
August 20, 2007;
30(3):
262 - 270.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. M. Siner, G. Jiang, Z. I. Cohen, P. Shan, X. Zhang, C. G. Lee, J. A. Elias, and P. J. Lee
VEGF-induced heme oxygenase-1 confers cytoprotection from lethal hyperoxia in vivo
FASEB J,
May 1, 2007;
21(7):
1422 - 1432.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. T. Qureshi, X. Zhang, E. Aberg, N. Bousette, A. Giaid, P. Shan, R. M. Medzhitov, and P. J. Lee
Inducible Activation of TLR4 Confers Resistance to Hyperoxia-Induced Pulmonary Apoptosis.
J. Immunol.,
April 15, 2006;
176(8):
4950 - 4958.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Zhang and P. J. Lee
Response to Comment on "Cutting Edge: TLR4 Deficiency Confers Susceptibility to Lethal Oxidant Lung Injury"
J. Immunol.,
April 1, 2006;
176(7):
3857 - 3857.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Kubo and K. Ishizawa
Comment on "Cutting Edge: TLR4 Deficiency Confers Susceptibility to Lethal Oxidant Lung Injury"
J. Immunol.,
April 1, 2006;
176(7):
3856 - 3857.
[Full Text]
[PDF]
|
 |
|