| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
* National Institute of Immunology, New Delhi, India;
International Centre for Genetic Engineering and Biotechnology, New Delhi, India; and
National Centre for Biological Sciences, Bangalore, India
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionDisclosuresReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDisclosuresReferences |
|---|
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDisclosuresReferences |
|---|
The F2-nef and D1-nef genes from Indian HIV-1 subtype C primary isolates have been described earlier (18). These and other nef mutant genes described below were subcloned into the bicistronic mammalian expression vector pIRES2-eGFP (BD Clontech), or expressed as nef-eGFP fusion genes by ligating the nef gene inserts into the plasmid peGFP-N3 (BD Clontech), or were expressed in the pMT3 expression vector (BD Clontech) after tagging with the influenza virus hemagglutinin epitope (HAp). The primers used for HAp tagging were: forward, CTGCAGATGTACCCATACGATGTTCCAGATTACGCT; reverse, CGGAATTCAGCAGTCTTTGTAGAACTC.
Truncation mutants of nef were made by PCR amplification of the 
100 and 125 fragments from the cloned F2-nef gene. The primers used were: WT F2-nef CGGGATCCAATGGGTGGCAAGTGGTCAA (outer forward), CGGAATTCAGCAGTCTTTGTAGAACTC (outer reverse), CGGAATTCATGGGTGGCAAGTGGTCAAAAT (inner forward), CGGGTACCTCAGCAGTCTTTGTAGAACTCCG (inner reverse); 100 F2-nef CGGGATCCAATGGGTGGCAAGTGGTCAA (forward), GCGGATCCAATTTACCCTTCCAGTCCCCC (reverse); 125 F2nef CGGGATCCAATGGGTGGCAAGTGGTCAA (forward), GCGGATCCAATTTACCCTTCCAGTCCCCC (reverse).
The PCR-amplified fragments were subsequently cloned into the pIRES2-eGFP or peGFP-N3 vectors (BD Clontech). The G2A mutant of F2-nef was made by PCR amplification using the primers: forward, CGGAATTCATGGCTGCGAAGTGGTCAAAATGCAGC; reverse, CGGAATTCAGCAGTCTTTGTAGAACTC.
Other site-directed, single amino acid mutants were generated using the In Vitro Mutagenesis kit (Stratagene). All constructs were verified by DNA sequencing. The panel of HAp-tagged NL4-3 nef mutants (7) was gifted by Dr. W. C. Greene (University of California, San Francisco, CA).
OVA plasmid
A 1.9-kb BamHI/HindIII fragment containing the c-myc-p-LCMVp-OVA-coding sequence described earlier (19) was cloned into the BglII-HindIII site of the expression vector pMD312 to generate a construct expressing a GFP-c-myc-p-LCMVp-OVA fusion protein.
Animals
C57BL/6 and OT-I mice were obtained from The Jackson Laboratory. The OT-II mice were gifted by A. Rudensky (University of Washington, Seattle, WA). Mice were bred and maintained in the animal facilities of the National Institute of Immunology (New Delhi, India). All animal experiments were done under the approval of the Institutional Animal Ethics Committee.
Anti-Nef Abs
Full-length His-tagged F2-Nef protein expressed in Escherichia coli was purified, and anti-Nef polyclonal Abs were raised in New Zealand White rabbits using this purified rF2-Nef protein. The IgG fraction was purified from immune sera on protein A-Sepharose (Amersham).
T cell activation assays
Activation of T cell hybridoma cells (13.8 and B3Z) was estimated by colorimetric measurement (A570 nm) of enzymatic activity expressed from an IL-2 promoter-driven 
-galactosidase (-gal) reporter gene. The activation-induced proliferation of primary TCR-transgenic OT-I or OT-II cells was measured by [3H]thymidine incorporation. BMC-2 cells were used as APCs 8 h after transfection at 106 cells/ml (for 13.8 or OT-II T cells), or in titrating numbers (for B3Z and OT-I T cells). Responder T cells were used at 106 cells/ml, and activation was estimated after coincubation with transfected APCs for 24 h. Azide-free anti-CD80 and anti-CD86 mAbs (eBioscience) were used for functional blockade at 10 µg/ml each.
Cells and transfection
BMC-2 cells were maintained in Click’s medium, with FCS, 2-ME, L-glutamine, and antibiotics. U937 cells were maintained in RPMI 1640 medium, with FCS, antibiotics, and LPS (0.5 µg/ml) for maintenance of high MHC and CD80/CD86 levels. Primary human macrophages were grown from PBMC by culturing them with rM-CSF (100 U/ml; Sigma-Aldrich) for 3 days, and live cells were used for infection in the continuing presence of the growth factor. Primary macrophages and DCs were grown from mouse bone marrow by culturing nonadherent mouse bone marrow cells with either M-CSF (30% L929 fibroblast-conditioned medium as M-CSF source) or rGM-CSF (PeproTech), respectively, for 9 days, with periodic growth factor replenishment. Tightly adherent cells were excluded from the GM-CSF-containing cultures on day 7, and live cells were used for transfection on day 9. Transfections were done using Fugene6 (Roche) or Effectene (Qiagen), according to the manufacturers’ protocols, with 12 µg of plasmid DNA for 2 x 106 cells.
Flow cytometry
Cells were stained with primary and secondary reagents on ice for 30 min, as appropriate. For intracellular staining, cells were permeabilized with 0.03% saponin. Stained cells were analyzed on a BD-LSR (BD Biosciences) flow cytometer. Data were analyzed using FlowJo software (Treestar).
Antibodies
The human-specific mAbs used were W6/32 for MHCI and OKT-9 for transferrin receptor (TfR) (used as culture supernatants), and biotinylated anti-CD80 and anti-CD86 (eBiosciences). The mouse-specific mAbs used as culture supernantants were: Y-3 for MHCI (H-2Kb and H-2Db) and 3/23 for CD40. Other mouse-specific mAbs used were: anti-CD54 PE, anti-CD80 biotin, anti-CD86 biotin, and anti-CD11b biotin (BD Pharmingen). The secondary reagents used included goat anti-mouse IgG (Fc) PE and donkey anti-rat IgG (Fc) PE (Jackson ImmunoResearch Laboratories), and streptavidin-PE or streptavidin-CyChrome (BD Pharmingen). For studies with HAp-tagged genes, transfected cells were stained for surface molecules and then permeabilized for intracellular HAp staining using an anti-HAp mAb (Cell Signaling Technology). Similarly, gene products with the myc-p-tag were detected in permeabilized cells with an anti-myc-p mAb (Cell Signaling Technology).
Confocal microscopy
For confocal microscopy, cells were grown on coverslip-bottomed dishes, transfected, and fixed in situ with 3% paraformaldehyde, followed by saponin (0.1%) permeabilization and blocking with 1% BSA. Staining was done on coverslips with primary and secondary reagents, as appropriate. Confocal images were acquired on a Bio-Rad MRC-1024 confocal microscope (Bio-Rad) with factory-set dichroics and a Krypton-Argon laser, using LaserSharp software (Bio-Rad), or using a Zeiss LSM 510 Meta confocal system equipped with Argon, HeNe, and HeCd lasers (Zeiss). Images were processed in MetaMorph (Universal Imaging) and Adobe Photoshop (Adobe Systems) softwares. Image quantitation was done as described (20), using Metamorph software.
Viruses and infection
HIV-1 viral stocks were generated by electroporation of HeLa cells with the infectious molecular clones pNL4-3, pNL4-3 FS Nef (gifted by H. Gottlinger, University of Massachusetts Medical School, Worcester, MA), or pNL4-3 ADA or pNL4-3 ADANef (gifted by M. Stevenson, University of Massachusetts Medical School, Worcester, MA). Virus stocks were harvested 72 h later and filter sterilized. U937 cells were serum starved for 1 h before infection. For each infection, 1 x 106 cells were infected with 100,000–200,000 cpm of reverse-transcriptase counts of virus. After a 4-h adsorption, cells were washed and incubated for 72 h before being stained for surface CD80, CD86, or MHCI, and intracellular p24 gag protein.
Immunoprecipitation and Western blot analyses
Transfected cell lysates were immunoprecipitated with either anti-Nef, anti-CD80, or anti-CD86 Abs and Western blotted for the indicated molecules after 12% SDS-PAGE of 50 µg of protein/lane and transfer. The secondary reagents were goat anti-rabbit IgG HRP (Cell Signaling Technology) or donkey anti-rat IgG HRP (Jackson ImmunoResearch Laboratories). Blots were developed with the diaminobenzidine reagent (Bio-Rad).
Yeast two-hybrid analysis
The F2-nef and CD80/CD86 genes were fused to the DNA binding or activation domains, respectively, of the yeast Gal4 protein gene. For this, the F2-nef gene was transferred as an EcoRI-BamHI fragment to pGADT7 (BD Clontech), which expresses inserted genes as fusion proteins together with the yeast Gal4 protein activation domain. The CD80 and CD86 genes were PCR amplified from plasmids pBJCD80 and pBJCD86, containing the human CD80 and CD86 genes, respectively, using the primers: CD80, GAATTCACCATGGGCCACACACGGAGGCAG (forward), CTGCAGTTATACAGGGCGTACACTTTCC (reverse); CD86, GGATCCACCATGGGACTGAGTACAATTCTCTTTGTG (forward), GTCGACAATTTAAAACATGTATCACTTTTGTCGCAT GAA (reverse).
These were cloned as EcoRI-PstI and BamHI-SalI fragments, respectively, into pGBKT7 (BD Clontech), which expresses inserted genes as fusion proteins to the yeast Gal4 protein DNA binding domain. The clones were checked by restriction digestion, DNA sequencing, and protein expression using an in vitro coupled transcription-translation system (TNT; Promega). These plasmids were cotransformed into Saccharomyces cerevisiae strain AH109 (MATa trp1-901 his3 leu2-3, 112 ura3-52 ade2 gal4 gal80URA3::GAL-lacZ LYS2::GAL-HIS3) containing the HIS3 and lacZ reporter genes under the control of GAL4 binding sites. The host strain containing plasmids pAS2-SNF1 and pACT2-SNF4 was used as a positive control (21). Various negative controls that included single or dual transformants were also run in the same assay. The transformed AH109 yeast cells were plated on either complete yeast extract/peptone/dextrose medium or synthetic dextrose in the absence of either leucine or tryptophan, or both. Protein interaction was tested by growth on synthetic dextrose plates without leucine, tryptophan, and histidine, and the specificity of the interaction was tested as growth on these plates containing 20 mM 3-amino-1, 2, 3-triazole. The -gal filter-lift and liquid assays were conducted, as described elsewhere (22).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDisclosuresReferences |
|---|
A WT nef gene (F2-nef) cloned from an Indian clinical isolate (18) was used for transfection studies. In human monocytic U937 cells expressing F2-Nef, the levels of cell surface CD80 and CD86 were reduced 5- to 10-fold at 48 h posttransfection, along with reduction in the surface levels of MHCI (Fig. 1A). No significant change in the surface levels of the TfR could be detected (Fig. 1A). There was no reduction in the total cellular levels of any of these molecules, as measured by staining postpermeabilization (Fig. 1A). The F2-Nef effects were based on comparison with an enhanced GFP (eGFP) control, under conditions of comparable transfection efficiencies of the two plasmids.
|
Nef expression led to a similar 5- to 6-fold reduction of surface CD80 and CD86 in the murine monocytic BMC-2 cell line (Fig. 2A). Surface levels of two other macrophage proteins, CD11b and CD54, were unaffected (Fig. 2A). There was no reduction in the total cellular levels of any of these molecules (Fig. 2A). F2-Nef had similar effects on primary nontransformed mouse bone marrow DCs and macrophages (Fig. 2B) as well. As earlier, the F2-Nef effects were based on comparison with an eGFP control, under conditions of comparable transfection efficiencies of the two plasmids.
|
To further characterize Nef-mediated down-modulation of CD80/CD86 and to identify its possible differences from MHCI down-regulation, we tested a series of Nef mutants. Because the F2-nef gene from an HIV-1 subtype C clinical isolate differs from the NL4-3 HIV-1 subtype B nef gene (Fig. 3A), we constructed a number of F2-Nef mutants in addition to the available panel of NL4-3-Nef mutants. Furthermore, we tested a variant D1-nef gene cloned from an independent HIV-1 isolate from the same patient as F2-nef, which has a natural deletion of residues 55–61 (numbered according to the NL4-3 Nef sequence (Fig. 3A)).
|
Like NL4-3 Nef, the G2A and M20A mutants of F2-Nef were unable to down-regulate surface MHCI, but were fully competent in down-regulating surface levels of CD80 and CD86 (Fig. 3C). We then used C-terminal F2-Nef deletion mutants terminated at residue 100 or 125 (Fig. 3A). F2-Nef truncated from residue 100 onward (F2-Nef-100) was unable to mediate any significant down-regulation of MHCI, CD80, or CD86 (Fig. 3C). However, a smaller C-terminal deletion from residue 125 onward (F2-Nef-125) allowed partial down-modulation of MHCI as well as of CD80 and CD86 (Fig. 3C). Other mutations in F2-Nef that include amino acid residues WL57–58, R77, D86, R106, I109, F121, P130, EE154–155, or LL164–165 did not affect the down-modulation of any of these target molecules by Nef (Table I). Data obtained with Nef mutants were similar in human U937 cells and mouse BMC-2 cells (Table I).
|
www.hiv.lanl.gov/content/hiv-db/ALIGN_CURRENT/ALIGN-INDEX.html
) for patterns of Nef sequence variation. We focused on the three regions identified by the data shown above. Among 822 Nef sequences, there are six showing alterations in the 62–65 EEEE and the (PXX)3 regions, critical for intracellular relocation of MHCI, but not CD80/CD86. Five of these six alterations are in clinical isolates from progressive HIV-mediated disease, while one is from a long-term nonprogressing case. However, only two sequences show alterations, both as deletions, in the 100–125 region critical for down-regulation of all three molecules. At least one of these is from a long-term nonprogressing case. Down-modulation of CD80/CD86 is crucial for Nef-mediated inhibition of naive T cell activation
Using a mouse cell system, we next tested whether the reduction in cell surface CD80/CD86 levels by Nef is functionally significant for the activation of naive T cells. For this, we cotransfected plasmids carrying F2-Nef and myc-p-tagged OVA into BMC-2 cells to ascertain that a majority of OVA-myc-p-expressing transfected cells also expressed Nef (Fig. 4, A and B). These cotransfected BMC-2 cells were then used as stimulator APCs for either a T cell hybridoma, B3Z, or for primary splenic cells from TCR-transgenic mice (OT-I). Both B3Z and OT-I CD8 T cells express the same TCR specific for an OVA peptide on MHCI (H-2Kb). A mixture of anti-CD80 and anti-CD86 mAbs blocks the activation of OT-I cells, but not of B3Z cells, showing their differential dependence on costimulation (Fig. 4C). The presence of either F2-Nef or its mutants did not affect the activation of B3Z cells (Fig. 4D). However, the response of OT-I cells was reduced not only by F2-Nef, but also by D1-Nef, which is unable to affect MHCI levels (Fig. 4E). As a control, the G2A-Nef mutant that is incapable of down-regulating MHCI, CD80, or CD86 did not affect this response (Fig. 4E). Similarly, stimulation of an OVA-specific MHCII-restricted T cell hybridoma (13.8) by such transfected BMC-2 APCs was unaffected by Nef (Fig. 4F). However, Nef expression reduced the response induced by these APCs from naive T cells of OT-II mice transgenic for an OVA-specific MHCII-restricted TCR (Fig. 4G). Under these conditions, the OT-II cell proliferative responses require costimulation, while the 13.8 T cell hybridoma does not need any costimulation (data not shown).
|
The lower surface levels, but unchanged total cellular levels of CD80 and CD86 coincident with Nef expression suggested that Nef redistributes these proteins. We therefore examined whether Nef colocalized subcellularly with these proteins in U937 and BMC-2 cells by confocal microscopy, using expression vectors containing the F2-nef, G2A-nef, D1-nef, and nef100 genes fused in-frame to the eGFP gene. Transfection with an eGFP-expressing vector was used as a control. All three proteins, MHCI, CD80, and CD86, were predominantly redistributed intracellularly and colocalized with F2-Nef-eGFP, but not with control eGFP, G2A-Nef-eGFP, or Nef100-eGFP. The Nef100-eGFP protein showed a pattern of intracellular distribution similar to F2-Nef (Fig. 5A). The D1-Nef protein colocalized intracellularly with CD80 and CD86, but not with MHCI (Fig. 5A). Three-color confocal analysis of these cells showed that Nef, MHCI, and CD80/CD86 colocalized together at the same intracellular site in Nef-expressing BMC-2 or U937 cells (Fig. 5, B and D). A quantitative analysis of the imaging data showed a 
5-fold loss of MHCI, CD80, and CD86 target molecules from the cell surface due to Nef (Fig. 5, C and E). This is comparable to the loss observed on flow cytometric analyses (Figs. 1 and 2).
|
100), which was unable to mediate any significant down-regulation of MHCI, CD80, or CD86 (Fig. 3C). Although the polyclonal anti-Nef Ab used for immunoprecipitation and Western blotting could efficiently detect the smaller band of F2-Nef-100, there was no coprecipitation seen between F2-Nef100 and either CD80 or CD86 (Fig. 6C).
|
-gal reporter constructs under control of a Gal4-responsive promoter. Only cotransformation with the F2-Nef/CD80 and F2-Nef/CD86 pairs led to growth of AH109 cells on medium lacking histidine (Fig. 6D). These cells showed substantial induction of -gal activity over the background for negative controls (Fig. 6E), confirming direct binding of Nef to CD80 and to CD86. |
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDisclosuresReferences |
|---|
Our data now show that Nef also down-regulates the surface expression of CD80 and CD86, major costimulatory molecules on APCs that are crucial for T cell priming. These effects are seen in macrophage lines of both mouse and human origin, as well as in primary cultures of human murine macrophages and DCs, indicating these to be global effects. Human PBL-derived macrophages infected with HIV-1 also show similar effects, establishing that these are relevant consequences of infection rather than being seen only with high Nef levels achieved with transfection. A previous report suggesting that Nef expression in APCs does not affect expression of other cell surface molecules such as MHCI or CD80/CD86 used an adenoviral vector that itself modifies the expression of CD80/CD86, making it impossible to draw any conclusions about the effect of Nef on CD80/CD86 levels (27). Nef is also found as a secreted protein, and extracellular rNef can trigger DCs, leading to modest up-regulation of surface CD80 and CD86 (28), underlining the pleiotropy of the effects of Nef on APCs. Together, the role of Nef appears to incorporate both APC-mediated bystander T cell activation and immune evasion to ensure that, while the virus has a supply of activated T cells in peripheral lymphoid organs to spread to, the virus-specific T cells among these recruited populations are not allowed to receive Ag-specific priming triggers.
The down-modulation of CD80 and CD86 by Nef is specific, because no changes could be detected in the surface levels of other molecules such as TfR, CD11b, CD54, or CD40. Furthermore, the total cellular levels of MHCI, CD80, and CD86 in Nef-expressing cells are not altered, indicating that the effects of Nef on the cell surface levels of these molecules are due to altered trafficking. Although the nef gene used in most of our experiments shown in this study is from a clinical isolate of HIV-1 subtype C, redistribution of CD80 and CD86 is also mediated by the NL4-3 Nef protein from HIV-1 subtype B. Significantly, we have identified a Nef variant (D1-Nef) from a clinical isolate of HIV-1 subtype C that has lost the ability to down-regulate MHCI, but can still down-regulate CD80 or CD86. This observation underlines the importance of Nef-mediated CD80 and CD86 modulation in vivo. An analysis of Nef sequence variation in the HIV sequence database is also consistent with this possibility. Sequence variation in regions important for MHCI down-modulation alone is somewhat more permissive than in a region critical for down-modulation of MHCI as well as CD80 and CD86, suggesting the likely importance of CD80/86 down-modulation in HIV pathology.
All relocation effects of Nef on MHCI, CD80, and CD86 are lost with a mutation that prevents Nef myristoylation (G2A (24)), indicating that membrane recruitment of the Nef protein is necessary for its effects on the trafficking of various target cell surface molecules. Serial deletions of the C terminus of the F2-Nef protein indicate that, while the 100- to 125-aa region is critical for reduction in MHCI, CD80, and CD86 levels, residues beyond 125 are also needed for optimal function of the Nef protein. Mutations at R77, D86, R106, I109, or LL164–165 do not affect the down-modulation of any target molecules by Nef, suggesting the potential functions hypothesized at these sites, such as binding of SH3 domains, PAK1/2 or AP1/2/3, are not likely to be involved in these trafficking functions of Nef.
Comparisons between F2-Nef and NL4-3-Nef raise some important issues regarding the role of specific domains of Nef in internalization. The EEEE sequence at residues 62–65 in NL4-3-Nef has been shown to be critical for MHCI down-regulation (24). In F2-Nef, which remains competent for MHCI relocation, the corresponding residues are EDEGE. However, their modification to DEDGE in D1-Nef prevents MHCI relocation, identifying important residues within this critical area. However, this modification does not affect CD80/86 down-modulation.
Further analysis of the effects of Nef mutants reveals distinct roles for different Nef residues in mediating the down-modulation of MHCI vs CD80 or CD86. Specifically, the E4A (PACS-1 recruitment domain) and the PPPAAA (an SH3 binding domain) mutants of NL4-3 Nef, as well as the D1 natural mutant of F2-Nef, which is also devoid of the PACS-1 recruiting domain, do not down-modulate MHCI, but efficiently reduce surface levels of CD80 and CD86, again emphasizing the separation between MHCI-directed vs CD80/CD86-directed effects of Nef. Although Nef appears to interact weakly and transiently with specific MHCI molecules (29), our data indicate that Nef binds strongly and directly to both human and mouse CD80 and CD86, suggesting a possible mechanism for recruitment of cellular signaling and trafficking pathways to achieve the cellular redistribution of CD80 and CD86. This is supported by the finding that a truncated version of Nef that cannot down-modulate CD80 or CD86 cannot bind to these molecules either.
Importantly, this function of Nef is involved in preventing the activation of naive T cells, providing evidence for the functional significance of our findings in the mechanism of HIV immune evasion. Although Nef down-modulates MHC molecules, this reduction is slow (data not shown). Thus, when T cell activation assays are conducted within 24 h of Nef transfection, presentation of APC endogenous Ag to both MHCII-restricted and MHCI-restricted T cell hybridomas is unaffected by the presence of Nef in these APCs. However, these same APCs are extremely poor activators of naive primary CD4 and CD8 T cells, consistent with Nef-mediated loss of costimulatory function as a major modulator of immune priming. This interpretation is further emphasized when the D1-Nef mutant, which has no effect on MHCI levels, is used in assays with naive CD8 T cells, reinforcing the importance of CD80/86 down-modulation effects of Nef. Together, these data suggest a significant role for Nef-mediated loss of costimulation in immune evasion during HIV infection.
|
Acknowledgments |
|---|
|
Disclosures |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDisclosuresReferences |
|---|
|
Footnotes |
|---|
1 S.R.D. is supported by a fellowship from the Council of Scientific and Industrial Research, Government of India, and A.H. by a fellowship from the University Grants Commission, Government of India. This work was supported in part by grants from the Department of Biotechnology and the Department of Science and Technology, Government of India (to A.G., S.R., and V.B.), the Indian Council of Medical Research, Government of India (to S.R. and V.B.), and the Wellcome Trust (to V.B. and S.J.). S.M. is supported by the Wellcome Trust (Grant 056727/Z/99) and intramural funding from the National Centre for Biological Sciences. The National Institute of Immunology and the International Centre for Genetic Engineering and Biotechnology are supported by the Department of Biotechnology, Government of India. 
2 A.C. and S.R.D. have contributed equally to this work.
3 Address correspondence and reprint requests to Dr. Shahid Jameel, International Centre for Genetic Engineering and Biotechnology, New Delhi 110067, India; E-mail address: shahid{at}icgeb.res.in or Dr. Satyajit Rath, National Institute of Immunology, New Delhi 110067, India; E-mail address: satyajit{at}nii.res.in
4 Abbreviations used in this paper: DC, dendritic cell; -gal, -galactosidase; eGFP, enhanced GFP; PACS-1, phosphofurin acidic cluster-sorting protein-1; SH3, Src homology 3; TfR, transferrin receptor; WT, wild type.
Received for publication December 22, 2004. Accepted for publication July 18, 2005.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDisclosuresReferences |
|---|
1-microglobulin and its precursor 1-microglobulin/bikunin precursor (AMBP) and expedites their export from the hepatocyte. J. Biol. Chem. 279:29308.-29319. This article has been cited by other articles:
|
|
 |
|
  A. Chaudhry, D. A. Verghese, S. R. Das, S. Jameel, A. George, V. Bal, S. Mayor, and S. Rath HIV-1 Nef Promotes Endocytosis of Cell Surface MHC Class II Molecules via a Constitutive Pathway J. Immunol., August 15, 2009; 183(4): 2415 - 2424. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Salek-Ardakani, R. Arens, R. Flynn, A. Sette, S. P. Schoenberger, and M. Croft Preferential Use of B7.2 and Not B7.1 in Priming of Vaccinia Virus-Specific CD8 T Cells J. Immunol., March 1, 2009; 182(5): 2909 - 2918. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Kumari, V. Borroni, A. Chaudhry, B. Chanda, R. Massol, S. Mayor, and F. J. Barrantes Nicotinic acetylcholine receptor is internalized via a Rac-dependent, dynamin-independent endocytic pathway J. Cell Biol., October 22, 2008; 181(7): 1179 - 1193. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Hussain, C. Wesley, M. Khalid, A. Chaudhry, and S. Jameel Human Immunodeficiency Virus Type 1 Vpu Protein Interacts with CD74 and Modulates Major Histocompatibility Complex Class II Presentation J. Virol., January 15, 2008; 82(2): 893 - 902. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Basu, S. Bhaumik, A. K. Haldar, K. Naskar, T. De, S. K. Dana, P. Walden, and S. Roy Hybrid Cell Vaccination Resolves Leishmania donovani Infection by Eliciting a Strong CD8+ Cytotoxic T-Lymphocyte Response with Concomitant Suppression of Interleukin-10 (IL-10) but Not IL-4 or IL-13 Infect. Immun., December 1, 2007; 75(12): 5956 - 5966. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. B. Borowski, A. C. Boesteanu, Y. M. Mueller, C. Carafides, D. J. Topham, J. D. Altman, S. R. Jennings, and P. D. Katsikis Memory CD8+ T Cells Require CD28 Costimulation J. Immunol., November 15, 2007; 179(10): 6494 - 6503. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Venzke, N. Michel, I. Allespach, O. T. Fackler, and O. T. Keppler Expression of Nef Downregulates CXCR4, the Major Coreceptor of Human Immunodeficiency Virus, from the Surfaces of Target Cells and Thereby Enhances Resistance to Superinfection J. Virol., November 15, 2006; 80(22): 11141 - 11152. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. G. Quaranta, B. Mattioli, L. Giordani, and M. Viora The immunoregulatory effects of HIV-1 Nef on dendritic cells and the pathogenesis of AIDS FASEB J, November 1, 2006; 20(13): 2198 - 2208. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Brown, H. Zhang, P. Lopez, C. A. Pardo, and S. Gartner In vitro modeling of the HIV-macrophage reservoir J. Leukoc. Biol., November 1, 2006; 80(5): 1127 - 1135. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Michel, K. Ganter, S. Venzke, J. Bitzegeio, O. T. Fackler, and O. T. Keppler The Nef Protein of Human Immunodeficiency Virus Is a Broad-Spectrum Modulator of Chemokine Receptor Cell Surface Levels That Acts Independently of Classical Motifs for Receptor Endocytosis and G{alpha}i Signaling Mol. Biol. Cell, August 1, 2006; 17(8): 3578 - 3590. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. F. Roeth and K. L. Collins Human Immunodeficiency Virus Type 1 Nef: Adapting to Intracellular Trafficking Pathways Microbiol. Mol. Biol. Rev., June 1, 2006; 70(2): 548 - 563. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
