|
|
||||||||


* University of Melbourne, Department of Microbiology and Immunology, Parkville, Victoria, Australia;
Division of Developmental Immunology, La Jolla Institute for Allergy and Immunology, San Diego, CA 92121; and
Cancer Immunology Program, Sir Donald and Lady Trescowthick Laboratories, Peter MacCallum Cancer Institute, St. Andrews Place, East Melbourne, Victoria, Australia
| Abstract |
|---|
|
|
|---|
-chain and produce high levels of cytokines. Traditionally, these cells were defined as NK1.1+ T cells, although only a few mouse strains express the NK1.1 molecule. A popular alternative marker for NKT cells has been DX5, an Ab that detects the CD49b integrin, expressed by most NK cells and a subset of T cells that resemble NKT cells. Interpretation of studies using DX5 as an NKT cell marker depends on how well DX5 defines NKT cells. Using a range of DX5 and other anti-CD49b Abs, we reveal major differences in reactivity depending on which Ab and which fluorochrome are used. The brightest, PE-conjugated reagents revealed that while most CD1d-dependent NKT cells expressed CD49b, they represented only a minority of CD49b+ T cells. Furthermore, CD49b+ T cell numbers were near normal in CD1d/ mice that are completely deficient for NKT cells. CD1d tetramer CD49b+ T cells differ from NKT cells by their activation and memory marker expression, tissue distribution, and CD4/CD8 coreceptor profile. Interestingly, both NKT cells and CD1d tetramer CD49b+ T cells produce cytokines, but the latter are clearly biased toward Th1-type cytokines, in contrast to NKT cells that produce both Th1 and Th2 cytokines. Finally, we demonstrate that expression of CD49b by NKT cells does not dramatically alter with age, contrasting with earlier reports proposing DX5 as a maturation marker for NKT cells. In summary, our data demonstrate that DX5/CD49b is a poor marker for identifying CD1d-dependent NKT cells. | Introduction |
|---|
|
|
|---|
and TNF, and Th2-type cytokines including IL-4 and IL-13 (1, 2, 3). NKT cells have been implicated in a broad range of diseases, ranging from enhancing immunity to infection and tumors, to suppression of autoimmune diseases (1, 2, 3). Despite many years of NKT cell research, controversy remains over how to define these cells (4). A major problem in defining NKT cells in mice has been the use of surrogate markers, such as the NK1.1 marker, coexpressed with the 
TCR. Although C57BL/6 mice express the NK1.1 allele detected by the Ab PK136, most other commonly used strains do not express this marker. Furthermore, even in NK1.1-expressing strains, not all NK1.1+ T cells are NKT cells (defined by CD1d dependence and invariant V
14-J
18 TCR expression), and not all CD1d-dependent NKT cells express NK1.1 (4). Also, when NKT cells are activated, they can transiently or in some instances permanently down-regulate NK1.1 (5, 6, 7, 8, 9). For these reasons, NK1.1 and TCR coexpression is no longer considered to be a reliable marker combination for specifically identifying NKT cells. Several studies have used other, nonstrain-restricted markers to define NKT cells in mice, and one of the most commonly used reagents is DX5, an Ab that reacts with the integrin CD49b (10). Like NK1.1, DX5 was originally characterized as a marker of NK cells that also reacted with a small subset of T cells (11). Because the T cells defined by DX5 were of a similar low frequency to NKT cells, showed at least partial overlap with NK1.1+ T cells, produced high levels of cytokines, and appeared to exhibit immunoregulatory capabilities, this marker has, and continues to be, used as a surrogate marker for NKT cells (11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22). The use of DX5 to define NKT cells was challenged when some groups published that CD1d-dependent NKT cells were either negative or very low for expression of this marker (23, 24, 25, 26, 27, 28). However, new evidence has emerged supporting the usefulness of DX5 as a means for defining NKT cells, demonstrating that CD1d-dependent NKT cells are labeled with DX5 if the more sensitive, PE-conjugated Ab is used (22, 29). Furthermore, DX5 staining has been used to define distinct NKT cell developmental stages, in which very immature and very mature NKT cells are proposed to be DX5/low, while those of intermediate maturity are DX5+ (29, 30). A recent study used DX5 as a means to identify and isolate NKT cells from thymus and spleen, and concluded that these two populations are phenotypically and functionally distinct (22). This approach will be problematic if DX5 identifies more than just NKT cells, particularly if the frequency of NKT cells within the DX5+ T cell population varies in spleen vs thymus, and even more so if more mature NKT cells down-regulate DX5 (29).
Because of ongoing controversy about whether DX5/CD49b identifies NKT cells, and whether it is a useful marker in this regard, we have revisited this problem of whether DX5/CD49b expression is an accurate way to define NKT cells, and have tested a range of mAbs with specificity for the Ag (CD49b integrin). Our data include phenotypic analysis of DX5/CD49b+ T cells in wild-type (WT)3 and NKT cell-deficient (CD1d/) mice, analysis of cytokine production, and regulation of this molecule during NKT cell maturation. As a result, we reiterate earlier concerns that DX5/CD49b and TCR coexpression is an unreliable NKT cell marker, which is likely to yield ambiguous data. Our data also revealed, however, that if CD1d-dependent NKT cells are excluded from the DX5/CD49b+ T cell population, the remaining cells are functionally distinct from the general T cell population, with very high Th1 cytokine-producing potential, and are worthy of further investigation in their own right.
| Materials and Methods |
|---|
|
|
|---|
C57BL/6, C57BL/6 CD1d/, and C57BL/6 J
18/ mice were housed in the Department of Microbiology and Immunology, University of Melbourne, Animal House. CD1d/ mice were originally provided by L. van Kaer (Vanderbilt University School of Medicine, Nashville, TN), and J
18/ mice were originally provided by M. Taniguchi (Chiba University, Tokyo, Japan), and each mutation has been backcrossed to C57BL/6 for at least 10 generations. Mice used for ontogeny experiments ranged from 5 to 90 days, with the day of birth referred to as day 1. All other mice used were 57 wk of age and were sex matched within each experiment. The University of Melbourne Animal Ethics Committee approved all mouse experiments.
Cell suspensions
Cell suspensions of thymus, spleen, and peripheral lymph nodes (PLNs) were prepared by gently grinding the organs between the frosted ends of glass microscope slides in PBS containing 2% FCS and 0.02% azide. Bone marrow cells were harvested from femurs by flushing with PBS-FCS-azide. Spleen cells were subsequently treated with red cell lysis buffer (Sigma-Aldrich). Hepatic leukocytes were isolated by cutting individual livers into small pieces and gently pressing through 200-gauge wire mesh. The cells were washed twice in ice-cold PBS with 2% FCS and 0.02% azide and spun through 33.8% Percoll (Amersham Biosciences) for 12 min at 693 x g. Recovered leukocytes were washed and treated with red cell lysis buffer (Sigma-Aldrich).
Culture medium
Culture medium contained RPMI 1640 (Invitrogen Life Technologies) supplemented with 10% FCS (JRH Biosciences), 100 U/ml penicillin (Invitrogen Life Technologies), 100 µg/ml streptomycin (Invitrogen Life Technologies), 2 mM glutamax (Invitrogen Life Technologies), 1 mM sodium pyruvate (Invitrogen Life Technologies), 5 x 105 M 2-ME (Sigma-Aldrich), 0.1 mM nonessential amino acids (Invitrogen Life Technologies), and 15 mM HEPES buffer (Invitrogen Life Technologies).
Abs and flow cytometry
The following reagents were used in multiparameter flow cytometric analysis: anti-: CD4 FITC or biotin (clone RM4-5), CD8 PerCP (clone 53-6.7), CD49b FITC (clone Ha1/29), CD49b PE (clone HM
2), CD49b/Pan-NK cells biotin, FITC or PE (clone DX5), CD62L FITC (clone MEL-14), IFN-
PE (clone XMG1.2, rat IgG1), IL-4 PE (clone 11B11, rat IgG1), NK1.1 biotin (clone PK136), rat IgG1 isotype control PE (clone R3-34), and
TCR allophycocyanin (clone H57-597). All mAb were purchased from BD Pharmingen. Biotinylated mAb were detected with streptavidin Alexa Fluor 488 (Molecular Probes). Mouse CD1d tetramer loaded with
-galactosylceramide was produced in house, as previously described (31), using recombinant baculovirus encoding his-tagged mouse CD1d and mouse
2 microglobulin, provided by Prof. M. Kronenbergs laboratory (La Jolla Institute for Allergy and Immunology, San Diego, CA). FcR block (anti-CD16/CD32, clone 2.4G2) was added to all surface-staining mixtures. One fluorescence detection channel was usually left available for the exclusion of autofluorescent cells. Flow cytometry was performed using a FACSCalibur or LSR-II (BD Biosciences) and analyzed using CellQuest software (BD Biosciences).
Intracellular cytokine staining
Following isolation from the thymus and spleen, lymphocytes (3 x 106 cells/well) were incubated at 37°C in the presence or absence of 10 ng/ml PMA (Sigma-Aldrich) and 4 µM ionomycin (Sigma-Aldrich) for 2 h. All cultures contained 10 µg/ml brefeldin A (Sigma-Aldrich) to prevent secretion of intracellular cytokines. Cultured lymphocytes were labeled with cell surface mAb and CD1d tetramer and washed with PBS before being fixed with 0.5% paraformaldehyde (BDH Chemicals) in PBS in the dark for 45 min at room temperature. Cells were washed in PBS and then incubated with intracellular cytokines in the presence of PBS containing 5% FCS and 0.05% saponin (Sigma-Aldrich) in the dark for 1 h at room temperature. Fixed and permeabilized cells were stained with PE-conjugated anti-IFN-
(clone XMG1.2), IL-4 (clone 11B11), or rat IgG1 as an isotype control (clone R3-34).
Cytokine analysis by sandwich ELISA
Cell subsets were sorted using either a MoFlo sorter (DakoCytomation) or a FACSaria (BD Biosciences) and stimulated in vitro with plate-bound anti-CD3 with or without anti-CD28. Culture supernatants were harvested at 2448 h and screened by sandwich ELISA. IL-2 was detected using a commercially available mouse IL-2 sandwich ELISA kit (BD Pharmingen). IL-4 and IFN-
were detected by a sandwich ELISA, as described previously (24). The substrate used for the detection of all cytokines was tetramethylbenzidine dihydrochloride (Sigma-Aldrich), and the reaction stopped using 2M H2SO4. ELISA readings were determined by OD scanning at 450 nm using a Labsystems Multiskan (Multisoft). Generally, the limit of detection for IL-2, IL-4, and IFN-
was 7 pg/ml, 0.7 U/ml, and 30 pg/ml, respectively. ELISA readings below the limits of detection were designated not detected.
Single cell RT-PCR analysis for cytokine production
Lymphocytes were isolated with a MoFlo sorter (DakoCytomation) fitted with a Cyclone single cell deposition unit. Cells were positively gated for CD49b and 
TCR expression, and either CD1d tetramer+ or tetramer cells were sorted directly into a 96-well PCR plate (Brinkman Instruments) containing 5 ml of cDNA reaction mix. The cDNA mix and reverse-transcription steps have been previously described (32). For the first round of RT-PCR, 2 ml of the cDNA was used to amplify larger (external) regions of either the V
14J
18 segment of NKT cell TCR (positive control for tetramer+ cells), or
-actin (positive control for tetramer cells) in a 25-µl amplification reaction. Another 2 µl was used to amplify cytokine (IFN-
, TNF-
, TGF-
, IL-4, IL-13, IL-10) cDNA. For the second round of PCR, 2 µl from the first PCR was used as a template to amplify a smaller (internal) region. The first and second rounds of PCR were performed with 0.33 U of Taq polymerase/1.5 mM MgCl2/0.2 mM dNTP (all from Invitrogen Life Technologies)/10 pmol each of sense and antisense primers. The primers used to amplify each region were: V
14J
18, V
14 EXT(S) TGGGAGATACTCAGCAACTCTGG, Caa(AS) TGGCGTTGGTCTCTT TGAAG, J
18 INT(S) ATAGAGGTTCAGCCTTAGG, C
INT(AS) ACACAGCAGGTTCTGGGTTC.
-actin: EXT(S) GACCCTCAAGTAC CCCATTG, EXT(AS) GTAATCTCCTTCTGCATCCTG, INT(S) GG GACGACATGGAGAAGATC, INT(AS) AGGTCTTTACGGATGTCAA CG. IFN-
: EXT(S) GGCTGTTTCTGGCTGTTACTG, EXT(AS) TTGTT ACTATAAATACTTCTTTGG, INT(S) TCTGGAGGAACTGGCAAAAG GATGG, INT(AS) CCCCACCCCGAATCAGCAGCGACTC. TNF-
: EX T(S) CGTGGAACTGGCAGAAGAGG, EXT(AS) GGGGCAGGGGCTCTTGACGGC, INT(S) CTTCCAGAACTCCAGGCGGTG, INT(AS) GCTGACGGTGTGGGTGAGGAG. TGF-
: EXT(S) GTGGCTTCTAGTGCTGACGC, EXT(AS) TCATGGATGGTGCCCAGGTC, INT(S) GGGACT CTCCACCTGCAAGA, INT(AS) CTTTGCTGTCACAAGAGCAG. IL-4: EXT(S) TCGTCACTGACGGCACAGA, EXT(AS) GTTCTTCTTCAAGCATGGAG, INT(S) CAGCTAGTTGTCATCCTGC, IN T(AS) GTGAGGACGTTTGGCACATC. IL-13: EXT(S) TCACTGGCTCTGGGCTTCAT, EXT(AS) GCAATATCCTCTGGGTCCTG, INT(S) GACTGCAGTCCTGGCTCTTG, INT(AS) GTCCTGTAGATGGCATTGCA. IL-10: EXT(S) GAGAGCTCCATCATGCCTGG, EXT(AS) CATCATG TATGCTTCTATGC, INT(S) CTATGCTGCCTGCTCTTACT, INT(AS) GCAGTTGATGAAGATGTCA.
The PCR conditions were 95°C for 5 min, followed by 40 cycles (external reaction) or 33 cycles (internal reaction) of 95°C for 30 s, 55°C for 45 s, and 72°C for 90 s, followed by 1 cycle of 95°C for 1 min, 55°C for 1 min, and 72°C for 7 min. PCR products were resolved on a 2% agarose gel. Samples that were not V
14J
18 positive or
-actin positive were excluded from further analysis. Bulk PMA/ionomycin-stimulated spleen cDNA was used as a positive control for all primer products.
| Results |
|---|
|
|
|---|
One reason that has been proposed to explain the controversy of whether CD1d-dependent NKT cells express CD49b is that a range of Abs conjugated to different fluorochromes is available that vary in their sensitivity and ability to detect this Ag on NKT cells (22, 29). Therefore, we optimally titrated a range of anti-CD49b reagents and tested their ability to label NKT cells, defined by CD1d tetramer binding, which is the most specific NKT cell marker available (Fig. 1). The only Abs to clearly stain NKT cells were the PE-conjugated reagents, with anti-CD49b PE giving the brightest and most complete labeling, while the FITC- and biotin-conjugated reagents showed much weaker staining of these cells, yet clearly labeled NK cells. Bimodal expression of CD49b can be seen on TCR-negative cells, presumably NK cells and particularly in liver, as has been previously reported (33). For each Ab tested, the absence of nonspecific background staining can be seen by the fact that 99% of thymocytes are negative for this reagent (Fig. 1). This supports previous published data (22, 29) and explains why some reports, including our own, suggested that NKT cells are DX5/low, because these reports typically used the FITC-conjugated reagent (23, 24, 25, 26, 27). PE-conjugated anti-CD49b demonstrated that virtually all NKT cells are CD49b+ (Fig. 1B). This was apparently due to increased sensitivity of the PE-conjugated reagents, because TCR cells, presumably NK cells, labeled more intensely with these reagents as well (Fig. 1A). However, these data do not mean that DX5/CD49b+ T cells are synonymous with NKT cells. Considering the high percentage of T cells that express CD49b (Fig. 1A), compared with the percentage of cells that typically label with CD1d tetramer (Fig. 1B), these data supported earlier studies suggesting that DX5/CD49b+ T cells include at least some non-NKT cells (23, 24, 25, 26, 28).
|
To directly investigate the extent to which DX5/CD49b+ T cells are CD1d dependent, we examined these cells using the PE-conjugated DX5 and CD49b reagents, shown to clearly label NKT cells in Fig. 1, in a range of different tissues from WT mice compared with CD1d/ mice (known to be NKT deficient) (Fig. 2A). These data showed that DX5/CD49b+ T cells were clearly present in CD1d/ mice, and in fact, when compared with WT mice, they were present at similar frequencies in spleen and bone marrow, were higher in lymph node, but lower in thymus and liver in the absence of CD1d. TCR J
18/ mice, which also specifically lack NKT cells, were also examined for DX5/CD49b+ T cells, with similar results to the CD1d/ mice (data not shown). As shown in Fig. 2B, when CD49b+ T cells in WT mice were stained with CD1d tetramer vs NK1.1, most CD49b+ T cells in spleen and bone marrow, and many in thymus and liver, were not labeled with CD1d tetramer. This suggests that many, and in some tissues most, DX5/CD49b+ T cells are not CD1d-dependent NKT cells. It was also noteworthy that of the CD49b+ T cells in WT mice, most did not label with NK1.1, while conversely, of the CD1d tetramer NK1.1+ T cells in WT mice, most (but not all) were CD49b+. Collectively, these results show that CD1d-dependent, V
14J
18 invariant NKT cells make up only a small subset of DX5/CD49b+ T cells in mice, and that furthermore, CD1d-independent T cells expressing NK cell markers such as NK1.1 and CD49b represent a heterogeneous population.
|
Analysis of CD49b+ T cells in WT and CD1d/ mice revealed that CD1d-independent CD49b+ T cells included CD4+, CD4CD8, and CD8+ subpopulations (Fig. 3), while, in contrast, CD1d tetramer+ cells included CD4+ and CD4CD8 subsets, but not CD8+ cells, as expected from previous studies (25). The CD1d tetramer population of CD49b+ T cells in WT mice had a similar CD4/CD8 profile to CD49b+ T cells in CD1d/ mice, suggesting that these cells were similar between the two types of mice, regardless of whether CD1d-dependent NKT cells are present or not. This also reiterates the point made above, that the CD1d-independent CD49b+ T cells are a heterogeneous population.
|
A previous study (22) reported that NK1.1+ or DX5+ T cells in spleen showed a distinct activation/memory phenotype from their counterparts in thymus, including a major population in spleen that expressed high levels of CD62L and CD44, yet low levels of CD69, whereas NK1.1+ or DX5+ T cells in thymus were mostly CD62LlowCD44high and CD69+. Although this led them to suggest that spleen and thymus NKT cells differ in their activation/memory status, an alternative possibility was that the CD62Lhigh, CD69 T cells in spleen were not NKT cells. We examined CD49b+ T cell populations from thymus, spleen, and liver, for expression of CD62L, CD69, CD25, and CD44, with the intention of comparing CD1d tetramer+ (NKT) and CD1d tetramer (non-NKT) subsets (Fig. 4). The results indicated that CD1d-dependent NKT cells in thymus, spleen, and liver were identical for expression of these activation/memory markers, and that the CD1d tetramer fraction of DX5+ T cells exclusively accounted for the previously reported variability. This is consistent with other studies suggesting that NKT cells are typically CD69+ and CD62Llow (23, 28). Interestingly, a subset of the CD1d tetramer population labeled with anti-CD25. This subset was also CD4+, and
6% of CD4+CD25+ T regulatory cells in spleen were found to be CD49b+ and NK1.1 (data not shown).
|
A hallmark of NKT cells is the potent and rapid production of both IL-4 and IFN-
. Other studies have reported that NK1.1+ or CD49b+ T cells in spleen produced lower levels of these cytokines than their counterparts in thymus (22, 24). Considering the low frequency of CD1d-dependent NKT cells within the splenic NK1.1/CD49b+ T cell population, it was possible that the different cytokine production simply reflected the lower frequency of NKT cells within this compartment. We therefore conducted intracellular cytokine staining, following in vitro stimulation with PMA and ionomycin, to compare IFN-
and IL-4 production by CD1d tetramer+ NKT cells with other T cell types, including CD49b+ CD1d tetramer T cells. These experiments were technically difficult due to the fact that, at least in our hands, anti-IL-4 PE is the only Ab to give clear intracellular IL-4 staining, yet anti-CD49b PE is the only Ab to clearly define T cell subsets, including both CD1d-dependent and CD1d-independent populations. Because at least some CD49b+ CD1d-independent T cells also express NK1.1, and most NK1.1+ CD1d-independent T cells express CD49b (Fig. 2B), we substituted NK1.1 with CD49b. Thus, we used anti-NK1.1 biotin/streptavidin Alexa-488 in combination with anti-IL-4 PE or anti-IFN-
PE and compared cytokine production by CD1d tetramer+ NK1.1+ T cells with CD1d tetramer NK1.1+ T cells. The results revealed that only CD1d tetramer+ fraction of CD49b+ T cells produced detectable levels of IL-4 following stimulation (Fig. 5A), while both populations of NK1.1+ cells made IFN-
, although this cytokine was produced by a higher frequency of NKT cells compared with the CD1d tetramer fraction under these stimulation conditions. This staining allowed a direct comparison of thymic and splenic CD1d-dependent NKT cells, which suggested that these populations make comparable levels of IL-4 and IFN-
, at least by intracellular cytokine staining following PMA/ionomycin stimulation. To verify the results from the intracellular cytokine staining, and to extend the analysis of CD49b+ CD1d tetramer cells beyond the NK1.1+ fraction, CD49b+ CD1d tetramer+ and CD49b+ CD1d tetramer cells were FACS sorted from spleen and stimulated in vitro on plate-bound anti-CD3 with or without anti-CD28 costimulation (Fig. 5B). These ELISA results supported the intracellular cytokine staining, showing that only CD1d tetramer+ fraction of CD49b+ T cells produces high levels of IL-4, while both populations produce IFN-
; although somewhat unexpectedly, the CD1d tetramer fraction produced higher levels of this cytokine. Both populations produced IL-2, and CD28 enhanced production of this cytokine.
|
At least two studies, including one from our own laboratory (22, 24), have suggested that spleen NKT cells make less cytokine than thymus NKT cells when stimulated by plate-bound anti-CD3, suggesting an important functional distinction between these two populations. Furthermore, spleen NK1.1+ or DX5+ T cells appeared to require CD28 costimulation for optimal cytokine production, while those from thymus seemed to function independently of CD28 (22). A problem with both reports (22, 24) was the use of surrogate markers DX5/CD49b or NK1.1 to define and isolate NKT cells from thymus and spleen, which might explain the difference in cytokine production and CD28 responsiveness, because, as shown above, many more DX5/CD49b/NK1.1+ T cells were CD1d independent in spleen compared with thymus (Fig. 2B). Therefore, CD1d tetramer+ NKT cells were specifically sorted from thymus and spleen, and their cytokine production in response to anti-CD3 with or without CD28 costimulation was tested by ELISA (Fig. 6). Conventional CD1d tetramer T cells were also sorted and tested as a control population to show that CD28 costimulation was giving the expected results. Our results in part verify earlier findings, showing that thymus NKT cells (in this study defined by CD1d tetramer) were a more potent source of IL-4 and IFN-
than spleen NKT cells when assayed by ELISA. However, spleen NKT cells were a richer source of IL-2 at 48 h (but not 24 h). The influence of CD28 on these subsets was dependent on the cytokine, and the time point, being tested. In agreement with the previous study (22), CD28 enhanced IL-4 and IFN-
production from spleen, but not thymus NKT cells at 48 h. However, at the 24-h time point, both thymus and spleen NKT cells showed enhanced production of IFN-
by anti-CD28 costimulation. Furthermore, CD28 dramatically boosted IL-2 production from both thymus and spleen NKT cells at the 48-h time point. Taken together, this supports and extends earlier studies, showing that thymus NKT cells are a more potent source of IL-4 and IFN-
than spleen NKT cells, following in vitro stimulation; however, spleen NKT cells can produce higher levels of IL-2 than thymus NKT cells under these conditions. This emphasizes the fact that NKT cells in different tissues may have distinct functional roles in the immune system. Furthermore, and in contrast to the conclusion from an earlier study, both thymus and spleen NKT cells can respond to CD28 costimulation, although the outcome differs between these two populations of CD1d-dependent NKT cells.
|
As an additional assay for the cytokine-producing potential of CD49b+ T cells, single cell RT-PCR analysis was used, comparing CD1d tetramer+ NKT and CD1d tetramer subsets. Single cells from each population (30 tetramer and 24 tetramer+) were stimulated with PMA and ionomycin, and then tested for cytokine mRNA, including: IL-4, IFN-
, IL-10, IL-13, TNF, and TGF-
(Fig. 7). This supported and extended the above results, showing that both populations of CD49b+ T cells produced message for IFN-
, and also TNF, at similar frequency. Only the NKT cells produced IL-4 mRNA, and IL-13 mRNA was also primarily associated with these cells. IL-10 mRNA was not detected in either subset, but was clearly detected in whole unfractionated spleen cells, while TGF-
was produced by a small proportion of cells in both CD49b+ T cell populations. Fig. 7C shows the number of individual cells that display a given pattern of cytokine mRNA, as indicated by the table.
|
An earlier study suggested that the most immature thymic NKT cells could be defined as DX5/low, became DX5+ as they matured, but then reverted to a DX5/low phenotype in older mice, such that by 10 wk of age, most NKT cells were DX5/low (29). We examined thymuses ranging in age from 5 days neonatal, which represents the earliest time point at which NKT cells have been detected (34), through to 13 wk when mice are fully mature. As we have previously shown, at the earliest time point stage, NKT cells are extremely rare, all are NK1.1, and almost all CD4+ (34). In accordance with published data, we found that most (but not all) very immature, NK1.1 NKT cells did not stain with DX5 PE, which was the same Ab as used in the previous study of NKT cell maturation (29). Staining levels increased as NKT cells matured and began to acquire NK1.1, but we were unable to verify the subsequent loss of this marker as mice reach full maturity, apart from a slight decrease in staining intensity (Fig. 8). In contrast with the results using the DX5 Ab, we were unable to detect a clear relationship between NKT cell maturation and anti-CD49b PE staining, such that the majority of NKT cells were CD49b+ regardless of age (Fig. 8). These data suggest that CD49b expression does not appear to be a robust marker of NKT cell maturation, and only some Abs might be able to distinguish between immature and mature NKT cells.
|
| Discussion |
|---|
|
|
|---|
-galactosylceramide to identify NKT cells, this combination will facilitate the study of CD1d-independent DX5+ T cells.
An interesting problem that this study has relevance to is whether NKT cells in different tissues are functionally distinct. Two studies in particular have suggested that thymus-derived NKT cells produce higher levels of cytokines (IL-4 and IFN-
) than spleen-derived NKT cells (22, 24). One of these (22) provided a possible explanation for this functional difference, suggesting that thymus NKT cells exhibited a more activated (CD69+CD62Llow) phenotype compared with spleen (more CD69lowCD62Lhigh cells) and did not appear to require CD28 costimulation to produce high levels of cytokines. However, because both of these studies relied on the use of surrogate markers NK1.1 and/or DX5 to identify and purify the NKT cells, a much larger fraction of cells isolated from spleen, compared with the thymus, was likely to be CD1d-independent T cells (Fig. 2), which is obviously an unfair comparison. Our results are important because they use the CD1d tetramer to definitively identify and purify the NKT cells, and confirm the conclusions from earlier studies, that NKT cells from thymus do appear to produce higher levels of IL-4 and IFN-
than their counterparts from spleen. Interestingly, and in contrast to the suggestion in the earlier study (22), this could not be explained by differences in their activation/memory phenotype, which was largely indistinguishable when comparing CD1d tetramer+ T cells between the two tissues (being CD69+CD62Llow in both cases). We can also elaborate on the differential responsiveness of thymus vs spleen NKT cells to CD28 costimulation. Despite the fact that Yang and colleagues (22) purified NKT cells based on NK1.1 or DX5 coexpression with TCR, we largely concur with their results, showing that thymic NKT cells produced high levels of IL-4 and IFN-
at 48 h after stimulation on anti-CD3-coated plates, regardless of the presence of anti-CD28. This is in contrast to spleen NKT cells that showed a significantly enhanced (yet still below that of thymic NKT cells) IL-4 and IFN-
response with CD28 costimulation. However, based on our additional data, the concept that thymic NKT cells respond fully without the need for costimulation (22) needs to be reassessed. Given that costimulation enhanced production of IFN-
and IL-2 at 24 h, and that thymic NKT cells showed a big increase in IL-2 production at 48 h when CD28 was included as part of the stimulus (Fig. 6), it is more accurate to say that thymic NKT cells are responsive to costimulation, but that the consequences of this stimulus are different from that for spleen NKT cells. A technical consideration was that the use of anti-
TCR (and CD1d tetramer) to positively enrich T and NKT cells might modify the response to CD3 cross-linking. However, we think that this is unlikely because anti-CD3 binds a clearly separate part of the TCR complex, and delivers a potent cross-linking stimulatory signal that should override any subtle effects due to the bound anti-
TCR or CD1d tetramer reagents.
An unresolved question flagged by our study relates to the identity and significance of the CD49b+ CD1d tetramer T cells. We have shown that these are also heterogeneous and include at least three subsets (CD4+, CD8+, and CD4CD8) that can also be divided into NK1.1+ and NK1.1 subsets. Some express CD62L, CD69, and CD25, and all express CD44. Based on three different cytokine assays, most appear to produce IFN-
, and bulk cultures of CD49b+ CD1d tetramer T cells yielded even higher levels of this cytokine than NKT cells. Most also produced TNF mRNA, but there is little, if any, IL-4, IL-10, and IL-13 mRNA production. This suggests that in contrast to NKT cells, the immunoregulatory functions of CD49b+ CD1d tetramer T cells might be less diverse, possibly directed primarily toward promoting, but not suppressing cell-mediated immune responses. Very few studies have specifically examined the in vivo function of DX5/CD49b+ CD1d-independent T cells. One previous report showed that CD1d-independent DX5+ T cells appear to be critical for Plasmodium berghei-induced hepatocyte damage (35), while another suggested that a population of CD1d-independent DX5+ T cells is activated in the presence of CD1d-dependent NKT cells in a mouse model of tumor therapy involving IL-12 and cyclophosphamide treatment (36). However, another study showed that
2-microglobulin-independent (and therefore CD1d-independent), DX5+NK1.1 T cells might also have immunosuppressive capabilities as they could suppress type 1 diabetes in a TCR transgenic NOD mouse model (26).
It is possible that the DX5/CD49b+ CD1d tetramer population includes other invariant T cells, such as mucosal associated invariant T cells that are known to express NK1.1, but are CD1d independent and MR1 dependent (37), but the CD49b phenotype of mucosal associated invariant T cells is unknown. CD49b+ T cells that do not bind
-galactosylceramide-loaded CD1d tetramer may also include other CD1d-restricted cells that do not express the invariant V
14J
18 TCR. These cells, sometimes referred to as type 2 NKT cells (4), are known to exist in normal mice, but their distribution, phenotype, and function remain elusive due to the absence of known markers that can identify them. If type 2 NKT cells are defined by DX5/CD49b expression, they are probably only a small subset because similar numbers of CD49b+ T cells were found in CD1d/ (which lack type 1 and type 2 NKT cells) and J
18/ mice (which lack only type 1 NKT cells) (data not shown) (4). Until reagents are available to more specifically define CD1d-restricted, noninvariant (type 2) NKT cells, we cannot formally determine the extent to which these are represented within the CD49b+ T cell population in WT mice. Given that CD49b+ CD1d tetramer T cells are a potent source of some cytokines, further studies into these cells, and the subsets thereof, are clearly important to understand how they fit into the immune system, and what possible functions they may perform. Moreover, the potent cytokine production by CD49b+ CD1d tetramer NKT cells implies that functional studies intending to investigate NKT cells, but using CD49b as a surrogate marker, will need to be carefully re-examined.
In summary, this study re-examines the utility of DX5/CD49b as a surrogate marker of NKT cells. Although we concur with other recent studies showing that NKT cells express this marker, we re-emphasize earlier concerns that this is not an effective way to define NKT cells in mice. In peripheral lymphoid tissues, most DX5/CD49b+ T cells are not labeled with CD1d tetramer and probably include other, poorly defined, T cell lineages that are capable of potent Th1 cytokine production, and are therefore likely to have very distinct activation requirements and immunoregulatory effects to NKT cells. To treat these various cell types as one population will undoubtedly lead to ambiguous results and should be avoided.
| Acknowledgments |
|---|
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This research was supported by grants from the National Health and Medical Research Council of Australia, the National Institutes of Health, the Association of International Cancer Research, and donations from Rothschild Australia. M.J.S. and D.I.G. are supported by National Health and Medical Research Council Research Fellowships. J.C. is supported by a Cancer Research Institute Pre-Doctoral Scholarship in Tumor Immunology, and R.K. was supported by an Australian Postgraduate Award. K.J.L.H. is supported by a National Health and Medical Research Council CJ Martin Fellowship, and K.Ke. is supported by a National Health and Medical Research Council Peter Doherty Fellowship. ![]()
2 Address correspondence and reprint requests to Dr. Dale I. Godfrey, University of Melbourne, Department of Microbiology and Immunology, Parkville, Victoria, 3010 Australia. E-mail address: godfrey{at}unimelb.edu.au ![]()
3 Abbreviations used in this paper: WT, wild type; PLN, peripheral lymph node. ![]()
Received for publication April 6, 2005. Accepted for publication July 15, 2005.
| References |
|---|
|
|
|---|
14 antigen receptor in NKT cells upon activation. Int. Immunol. 16:241.-247.
2 integrin, very late antigen-2). J. Immunol. 167:1141.-1144. 
T cell development and early thymocyte maturation in IL-7/ mice. J. Immunol. 157:2366.-2373. [Abstract]

intermediate CD4+ T cells exist in naive NK1.1 allelic positive and negative mice, with the capacity to rapidly secrete large amounts of IL-4 and IFN-
upon primary TCR stimulation. J. Immunol. 162:5156.-5163. 
+ or DX5+TCR
+ T cells in mice conditioned with fractionated lymphoid irradiation protects against graft-versus-host disease: "natural suppressor" cells. J. Immunol. 167:2087.-2096.
-galactosylceramide-induced antitumor immunity in metastatic liver tumor. J. Immune Based Ther. Vaccines 2:7.[Medline]

+ cells in
-associated protein 70 null mice with an accumulation of NK1.1+ CD3 NK-like cells in the thymus. Blood 97:1765.-1775. This article has been cited by other articles:
![]() |
M. Dose, B. P. Sleckman, J. Han, A. L. Bredemeyer, A. Bendelac, and F. Gounari Intrathymic proliferation wave essential for V{alpha}14+ natural killer T cell development depends on c-Myc PNAS, May 26, 2009; 106(21): 8641 - 8646. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Thirion and J.-P. Coutelier Production of protective gamma interferon by natural killer cells during early mouse hepatitis virus infection J. Gen. Virol., February 1, 2009; 90(2): 442 - 447. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Wingender and M. Kronenberg Role of NKT cells in the digestive system. IV. The role of canonical natural killer T cells in mucosal immunity and inflammation Am J Physiol Gastrointest Liver Physiol, January 1, 2008; 294(1): G1 - G8. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. L. Stephens, J. Andersson, and E. M. Shevach Distinct Subsets of FoxP3+ Regulatory T Cells Participate in the Control of Immune Responses J. Immunol., June 1, 2007; 178(11): 6901 - 6911. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Mallevaey, J. Fontaine, L. Breuilh, C. Paget, A. Castro-Keller, C. Vendeville, M. Capron, M. Leite-de-Moraes, F. Trottein, and C. Faveeuw Invariant and Noninvariant Natural Killer T Cells Exert Opposite Regulatory Functions on the Immune Response during Murine Schistosomiasis Infect. Immun., May 1, 2007; 75(5): 2171 - 2180. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Cain, J. A. Smith, J. K. Ondr, B. Wang, and J. D. Katz NKT Cells and IFN-{gamma} Establish the Regulatory Environment for the Control of Diabetogenic T Cells in the Nonobese Diabetic Mouse J. Immunol., February 1, 2006; 176(3): 1645 - 1654. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |