The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dooley, J.
Right arrow Articles by Farr, A. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dooley, J.
Right arrow Articles by Farr, A. G.
The Journal of Immunology, 2005, 175: 4331-4337.
Copyright © 2005 by The American Association of Immunologists

An Organized Medullary Epithelial Structure in the Normal Thymus Expresses Molecules of Respiratory Epithelium and Resembles the Epithelial Thymic Rudiment of Nude Mice1

James Dooley*, Matt Erickson* and Andrew G. Farr2,*,{dagger}

* Department of Biological Structure and {dagger} Department of Immunology, University of Washington, Seattle, WA 98195


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The expression of tissue-specific Ags (TSA) within the thymic environment has emerged as an important contribution to the establishment of self-tolerance. The mechanistic basis for this property is poorly understood. One model has proposed stochastic derepression of gene expression by mature medullary epithelial cells, whereas another model has suggested that this property of thymic epithelial cells reflects transcriptional activity during their differentiation. Most of the analyses of thymic TSA expression have been done with populations of dissociated thymic epithelial cells; therefore, there is little information regarding the spatial pattern of TSA expression within the thymus. We have evaluated a subset of thymic epithelial cells in the murine thymus that display several unique features. First, within the normal thymus, they form cysts that express several TSA of respiratory epithelium and exhibit some morphological features consistent with respiratory epithelium. These cells also display a phenotypic profile that has been proposed for immature thymic epithelium. The cystic epithelia in the normal thymus and in the nude thymic rudiment are phenotypically very similar, suggesting that they may have a similar developmental program. The coordinated expression of respiratory TSA by an organized subset of thymic epithelial cells and the phenotypic resemblance of these cells to progenitor cells seem consistent with a developmental basis for TSA expression by thymic epithelial cells. Finally, epitopes that define thymic epithelial heterogeneity are reciprocally expressed by respiratory epithelium, which raises interesting questions regarding the developmental relationship of different endodermal derivatives.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Endoderm of the third pharyngeal pouch gives rise to morphologically and phenotypically distinct epithelial compartments of the thymus that support discreet aspects of thymocyte development. Cortical and subcapsular epithelia provide signals to attract lymphoid progenitor cells (1), to provide T lineage commitment signals (2), and to promote the positive selection of immature T cells bearing Ag receptors of appropriate specificity (3). Medullary thymic epithelium (MTE)3 participates in the establishment of self-tolerance by the elimination of autoreactive thymocytes and may support the further differentiation of mature thymocyte subsets (reviewed in Ref.4).

The involvement of medullary epithelium in negative selection is related to the ability of these cells to express a remarkable spectrum of Ags characteristic of other tissues (5, 6, 7). These tissue-specific Ags (TSAs) represent a wide range of tissues/organs of diverse embryological derivation, although there seems to be a bias toward epithelial tissue of ectodermal, endodermal, and neuroectodermal origins. Expression of some, but not all, of these TSA by MTE is dependent on the action of the autoimmune regulator gene (aire), which can function as a transcription factor (8) and also has E3 ubiquitin ligase activity (9). Mice lacking functional aire express a reduced spectrum of TSA expression by thymic epithelium and exhibit an increased frequency of autoimmunity (10).

Originally, two models were proposed to account for TSA expression by MTE. One proposed that this property reflected derepression of gene expression by differentiated MTE, leading to promiscuous expression of genes characteristic of different epithelial lineages (11). In this context, aire has been proposed to act as a "randomizer" of gene expression by individual differentiated MTE (10). The demonstration that genes expressed promiscuously colocalize in chromosomal clusters indicate that epigenetic mechanisms contribute to the regulation of TSA expression (12). We have proposed that the expression of these TSAs reflected the poorly defined process of thymic epithelium (TE) differentiation as a means to account for the morphological and ultrastructural heterogeneity exhibited by clusters or groups of medullary epithelial cells in situ (13, 14).

Much of our current understanding of TSA expression by thymic epithelial cells is based on the evaluation of message expression by fractionated populations of enzymatically dissociated thymic stromal cells. Analysis of in situ expression of TSAs might shed new light on mechanisms underlying this important aspect of the epithelial component of the thymic environment. For instance, spatially coordinated expression of related TSA by a subset of MTE would be consistent with a developmental basis, particularly if the subset of thymic epithelium expressing this set of TSA also exhibited features reminiscent of the tissue in which these TSAs would normally be found. Alternatively, the lack of coordinate expression of developmentally related TSAs would be more compatible with a mechanism unrelated to TE development.

To explore this issue, we have evaluated the thymic expression of a subset of TSA, those that are normally associated with respiratory epithelium, at the RNA and protein levels. We report here that multiple respiratory epithelial TSAs are expressed by epithelial cells comprising unique structures within the medullary compartment that have respiratory epithelial characteristics. The organization of these cysts, their ultrastructural features, and their expression of respiratory TSA collectively indicate a regulated program of differentiation leading to acquisition of a respiratory character. Paradoxically, these epithelial cells also bear some phenotypic resemblance to TE progenitor cells. Furthermore, the organization and phenotype of cystic epithelium in the normal thymus resembled the cystic epithelium comprising the thymic rudiment of nude mice, epithelium that has been considered to be immature TE cells arrested in their differentiation (15). On the basis of morphological and phenotypic similarities, we suggest that the developmental program exhibited by the epithelial cells comprising the cysts in the normal thymus is similar to that taken by the cystic thymic epithelium of the nude thymus.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Mice

BALB/c mice were obtained from Charles River Laboratories and used in accordance with protocols approved by the International Animal Care and Use Committees at the University of Washington (Seattle, WA). Tissue samples were from mice 3–6 wk old.

Abs and reagents

Primary Abs for immunohistochemistry include anti-surfactant Abs (SP-A, SP-B, and SP-C, purchased from Chemicon), rabbit anti-PLUNC (16), anti-CC-10 (17), anti-CFTR (18), and a monoclonal anti E-cadherin Ab, ECCD2 (19). Other anti-stromal cell Abs include ER-TR series developed by van Vliet et al. (20), anti-EpCAM (G8.8; Ref.21), and several rat anti-murine thymic stromal cell Abs developed in this laboratory (3G10 and F611). MTS24 Ab (15) was a gift from Dr. Richard Boyd. Monoclonal anti-CD40 Ab was purchased from Serotec, and polyclonal anti-keratin 5 was purchased from Covance. Troma-1 Ab was obtained from the Developmental Studies Hybridoma Bank, anti-class II MHC M5114 was obtained from American Type Culture Collection, and anti-B7-2 Ab (GL-1) (22) was a gift from Richard Hodes. Secondary Abs for immunofluorescence microscopy (goat anti-rabbit IgG and goat anti-rat IgG conjugated with Alexa 488 or Alexa 546) were purchased from Molecular Probes. Goat anti-rat IgG Abs (Pierce) was conjugated with N-hydroxysuccinimidyl digoxygenin (Bohringer-Mannheim) according to the manufacturer’s recommendations and used in conjunction with goat anti-digoxygenin-HRP conjugates or FITC conjugates (Bohringer-Mannheim). The following Abs were used for flow cytometry of thymic epithelial cells: G8.8 Ab conjugated with digoxygenin; a PE- anti-CD45 conjugate purchased from BD Pharmingen; and CDR1 Abs (23) conjugated with Alexa 647 according to the manufacturer’s recommendations (Molecular Probes). Taq enzyme was purchased from Promega, whereas collagenase, dispase, and DNase was from Roche.

Immunohistochemistry

Intact, unfixed thymus lobes were embedded in OCT (Sakura Finetek) for cryostat sectioning. Entire thymic lobes were cut serially, with multiple sections mounted on each slide. To identify sections containing cystic epithelium, every fourth slide was processed to demonstrate E-cadherin. The subset of slides containing epithelial cysts was then subjected to further analysis. Lung tissue was partially inflated with a 1:1 mixture of FBS and OCT by injection into the trachea. The bronchi were ligated while still under pressure; the individual lobes were separated, immersed in OCT, and then frozen. Cryostat tissue sections were mounted on Superfrost slides (Fisher Scientific) and fixed by immersion in cold acetone (–20°C) for 20 min. After the slides were washed in PBS, primary Abs that had been diluted in PBS containing 10% v/v normal mouse serum was applied. Following incubation for 1 h @ room temperature, the slides were washed again in PBS and secondary Abs applied. The secondary Abs were diluted in PBS containing 1%BSA (w/v) and 10% normal mouse serum. Immunofluorescence samples received coverslips without dehydration, using Fluormount G (Southern Biotechnology). For immunoperoxidase, the sections were developed in hydrogen peroxidase with 3,3'-diaminobenzidine (Sigma-Aldrich) as the chromagen.

Flow cytometric isolation of MTE

After being minced with scissors, thymic fragments were washed repeatedly by unit gravity sedimentation in HBSS to remove thymocytes. The remaining tissue fragments were incubated with a mixture of collagenase and DNase for 20 min at 37°C with agitation. Remaining fragments were then digested with a mixture of dispase, collagenase, and DNase with gentle agitation until most of the tissue fragments were digested. The resulting cell suspension was passed through nylon mesh (80-µm pore size mesh), washed twice in calcium/magnesium-free HBSS containing 2% FBS and in 10 mM HEPES buffer, and then processed for flow cytometric separation with a FACSvantage (BD Biosciences). The CD45G8.8+CDR1 population of cells represents highly enriched medullary epithelial cells and was used for further analysis.

Analysis of gene expression

Total RNA from lung and thymic tissue or sorted TE cells was isolated with Absolute RNA RT-PCR kits (Stratagene) and used to generate cDNA. PCRs were performed with the following primer sets: forward reverse: E-cadherin, AGGAAATGCACCCCTCCAATGCATCTTAGAGAACGGTTTC; HoxA3, CTGCCAGCACAGCCAAGAG AGGCACAGGGCTCCGAC; thyroid transcription factor 1 (TTF1), CATCTCCCGCTTCATGGGCCGCTGTCCTGCTGCAGT; Plunc, TCACCATCCCTCTGGGCTTAGACTGGGCAAGAGGCAGG; SP-A, CTTCCAGGGTTTCCAGCTTACCCAGGAGTCTGGCCTTCAATCAC; SP-B, CAGCTCCCCATTCCCCTG GAAATGGCACTCAGTGTCCTGTAGT; SP-C, GGCTCTGCTCATGGGCCTGGTGGGTGTGGAGGGCTT; CFTR, GATCAAGATACCCCCGGTGATACTAGCCCTGGCACCGTTG; mucin, GGAACATTTCTGGATTGTTTCTGCGTGGTCACCACAGCTGGGTT; lactoferrin, CTTCTCCGCCAGTCACAGGAAGAGCTCCAGGTGAAGCCAG; lysozyme, AAAGGAATGGAATGGCTGGCCAGTAGAAGCACACCGCGGT; T1{alpha}, GGGCTTAATGAATCTACTGGCAAGCCATGGGTCATCTTCCTCCA; aire, AAGATCCAAGAAGTGCATTCAGG GTCTCTGCAGGTAGCTCCGG; Ep-Cam, CAAAATCCATCTCAAGCTCGCGGCTCTTTGACCACCGTTCTC.

The following conditions were used for all PCR except E-cadherin: 3 min start at 94°C, with denaturation (94°C) and annealing (60°C) periods of 30 s each, followed by an extension period (72°C) of 45 s. For E-cadherin primers, the extension period was increased to 1 min. Magnesium concentration was 2.5 mM.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Expression of respiratory-type gene products by thymic epithelium

In previous work, RT-PCR of whole thymus samples demonstrated expression of several gene products that would be considered respiratory TSAs (14). These included surfactants A-C and CC-10. In addition, a number of regulatory genes that are involved in the organogenesis of the respiratory system (and other tissues/organs) were also expressed in the thymus. These included TTF-1/Nkx2.1, HNF3{alpha}/Foxa1, and HNF3{beta}/Foxa2. Here, we have confirmed and expanded the spectrum of respiratory epithelial genes detected in the thymus to include plunc, CFTR, mucin, and gene products that are produced by submucosal glandular tissue associated with the airways (Fig. 1, a and b). Similar analyses were performed with sorted populations of thymic epithelial cells (Fig. 1c). A representative flow cytometric profile of the isolated epithelial cells used for the type of analysis shown in Fig. 1c is depicted by Fig. 1d. This CD45 and CDR1/BP1, EpCAM (G8.8)+ population of thymic stromal cells corresponds to the MTE subset that has been shown to express the broadest spectrum of tissue-specific Ags and to expresses aire message (11, 24). Approximately 8% of the dissociated thymic prep was CD45, and ~40% of those cells were G8.8+ and CDR1/BP1. In addition to signals for Ep-CAM and aire, two markers for medullary epithelium, signals for other genes expressed by respiratory epithelia were also detected (plunc, CC-10, SP-A, SP-C, and mucin. We also detected signal for Pax1 and Pax9, two transcription factors previously implicated in thymic epithelial function during fetal organogenesis (25, 26).



View larger version (43K):
[in this window]
[in a new window]
 
FIGURE 1. Expression of respiratory system gene products by thymus and thymic epithelium. a, Comparison of selected gene expression by whole thymus and lung. b, Expression of message for surfactants A-C and for T1{alpha} in whole thymus. c, Expression of respiratory genes by sorted population of CD45, G8.8+, and CDR1TE cells that is highly enriched for medullary epithelial cells. d, Dissociated thymus cells were first separated on the basis of their expression of CD45 (gated cells, left panel), and the CD45 cells further separated on the basis of their expression of BP1/CDR1 (right panel).

 
We used immunohistochemistry to localize the expression of some of these molecules within the thymus (Fig. 2). The specificity and reactivity of some of these reagents with lung tissue have been described previously (27). Many of these respiratory-related TSA were associated with a cystic epithelial compartment of the thymus. One of the gene products, TTF1/Nkx2.1, is regulatory and has been shown to play an important role in both thyroid and lung development (28, 29), It has also been identified as a regulatory element for CC-10 expression (30). The immunohistochemical demonstration of plunc associated with cysts is in agreement with an earlier in situ hybridization analysis of thymic plunc expression, where ring-like profiles of labeling were seen in the thymic medulla (31). Surfactants A-C and CC-10 were also expressed by some of the epithelial cells lining the cysts. This is a widespread property of the cystic epithelium. Virtually every cyst examined displayed respiratory epithelial products. In addition to the labeling of epithelial cells lining cysts, scattered individual labeled cells were also detected in the medulla. Although E-cadherin is expressed by both cortical and medullary epithelial cells, the denser organization or the medullary compartment can be used to discriminate between these two compartments.



View larger version (67K):
[in this window]
[in a new window]
 
FIGURE 2. A subset of thymic epithelial cells preferentially express respiratory system molecules. In a–h, E-cadherin is localized in the red channel, and the respiratory Ags are localized in the green channel. The cystic epithelium displays patchy expression of TTF1 (a), surfactant A (b), CC-10 (c), and plunc (d). No reactivity of the cyst was observed with normal rabbit serum (e). In addition to the cystic epithelium, isolated medullary thymic epithelial cells also expressed surfactant A (f), CC-10 (g) and plunc (h). *, Cysts; arrows, individual cells.

 
Epithelial cells lining cysts display a mixed cortical and medullary phenotype

These epithelial cysts represent a small but very reproducible compartment of thymic epithelium (14) that have been described in detail by Khosla and Ovalle (32). The ultrastructural features of this epithelium were very reminiscent of respiratory epithelium, displaying mixtures of ciliated epithelium and epithelial cells that resembled mucus-secreting goblet cells. Having established that these cysts of epithelial cells expressed a number of molecules characteristic of respiratory epithelium, we also wanted to characterize the epithelium lining these cysts with Abs widely used to define thymic epithelial heterogeneity. As shown in Fig. 3, the epithelial cysts could be distinguished from blood vessels by reactivity of the former with anti-E-cadherin Abs (ECCD2), whereas blood vessels could be distinguished by their investment by ER-TR7+ cells. A striking feature of the cystic epithelium was reactivity with both cortical and medullary marker reagents, where we observed labeling with ER-TR5, 3G10, and G8.8, three Abs that label most of the medullary epithelium and with NLDC145, ER-TR4, and F6.11, which label cortical epithelium (NLDC 145; data not shown). In addition, the cystic epithelium was labeled with MTS24 Abs, which also detect a small subset of scattered medullary epithelial cells. The MTS24+ phenotype has been proposed to identify progenitor epithelial cells in the fetal thymus able to give rise to both cortical and medullary epithelial subsets (15, 33, 34).



View larger version (118K):
[in this window]
[in a new window]
 
FIGURE 3. A compartment of cyst epithelium in the normal thymus expresses phenotypic features of cortical and medullary epithelium. a, E-cadherin (pan-epithelial marker); b, Ep-CAM preferentially expressed by medullary epithelium; c and d, cortical markers, ER-TR4 and F.6.11, respectively; e and f, medullary markers, ER-TR5 and 3G10, respectively; g, A marker of fibroblasts, ER-TR7. h, A putative marker of progenitor epithelium in the fetal thymus, MTS24. Arrows, cyst; *, blood vessels.

 
As shown in Fig. 4, some of the epithelial cells lining the cysts coexpress keratin 8 and keratin 5, a phenotype attributed to a less mature population of thymic epithelial cells. We also found that epithelial cells lining the cysts expressed class II MHC molecules at levels comparable with those of other thymic epithelial cells (Fig. 4b) but expressed low levels of B7-2 (Fig. 4c) or CD40 (data not shown).



View larger version (114K):
[in this window]
[in a new window]
 
FIGURE 4. Phenotypic properties of cystic epithelium. a, Epithelial cells lining the cysts coexpress keratins 8 and 5. Keratin 8 expression is demonstrated in the green channel, and keratin 5 is indicated in the red channel. B, Epithelial cells lining the cysts express class II MHC molecules. c, Expression of B7-2 is associated with medullary epithelium but not by epithelial cells lining the cysts. d, Background staining with the FITC-anti-digoxygenin Abs used to demonstrate B7-2 expression. *, cysts; M, medullary areas.

 
Cysts are formed during fetal development

This cystic epithelial compartment may reflect terminal differentiation of medullary epithelium or may represent remnants of pharyngeal endoderm. During early thymic organogenesis, third pharyngeal pouch endoderm forms an evagination as it grows into surrounding mesenchyme. The resulting thymopharyngeal duct gives rise to a thymopharyngeal cyst when the connection to the pharyngeal lumen is lost. This cyst may degenerate and disappear with further development or may persist in the postnatal thymus. We examined fetal thymic lobes with immunohistochemistry to follow the appearance of the cysts, using E-cadherin staining to discriminate between blood vessels and cysts, because the epithelium lining the cysts is strongly E-cadherin positive (Fig. 5). Cystic epithelium, identified along the periphery of the developing thymus at day 15 of development, assumed a more central location at later stages of development. By day 18 of gestation, the cysts were found in the central region of the developing thymus and were often found to be contiguous with small islands of denser epithelium that give rise to the medullary compartment. The changing location of the cysts during development and the fact that these cysts are often found associated connective tissue septae continuous with the thymic capsule (14, 32) collectively suggest that the central position of the cysts in the adult thymus is secondary to subsequent fetal and postnatal expansion of other components of the thymic environment. The appearance of these cysts in the fetal thymus when the medullary compartment is not well established would be more consistent with a thymopharyngeal origin of these structures.



View larger version (124K):
[in this window]
[in a new window]
 
FIGURE 5. Cystic epithelial structures are evident in the fetal thymus. Serial sections from fetal thymus at day 15 thymus (a and b) or day 18 (c and d) were stained with anti-E-cadherin Ab to demonstrate the epithelial compartment. At day 15, a dense collection of epithelial cells form a cyst along the periphery of the thymic lobe (arrows; a and b). By day 18 of development, cysts have acquired a more central location in the thymic lobe (c). The cyst shown in c is continuous with a developing island of medullary epithelium (identified by the denser packing of the epithelial cells; arrow) in d.

 
The cystic epithelial compartment in normal thymus and the nude thymic rudiment have a similar phenotype

The small but reproducible cystic epithelial compartment of the normal thymus is contrasted by the predominance of this type of epithelial organization in the thymic rudiment of nude mice that results from a loss-of-function mutation of the foxn1 transcription factor (15, 35). Using the ER-TR series of Abs, Van Vliet et al. (20) examined embryonic nude thymic rudiment and reported that the majority of epithelial cells did not react with these reagents and that the few epithelial cells that were labeled with cortical or medullary markers did so in a mutually exclusive manner. We examined the reactivity of adult nude thymus with the panel of Abs that were used to define the phenotype of cystic epithelium in normal mice (Fig. 6). In agreement with the studies of Blackburn et al. (15), who examined the composition of the nude thymus with the MTS series of anti-stromal Abs, we found that the epithelial compartment of the adult nude thymus coexpressed cortical and medullary markers and thus resemble the phenotype of the cystic epithelium of the normal thymus described above. This finding suggests that the pattern of differentiation exhibited by the cystic epithelium of the nude thymus also occurs in the normal thymus, albeit at a much lower frequency.



View larger version (111K):
[in this window]
[in a new window]
 
FIGURE 6. The cystic epithelium in the nude thymus displays a mixed cortical/medullary phenotype similar to the cystic epithelium of the normal thymus. Adult nude thymic rudiment was processed with the same set of Abs demonstrated in Fig. 3. a, E-cadherin (pan-epithelial marker); b, Ep-CAM preferentially expressed by medullary epithelium; c and d, cortical markers ER-TR4 and F.6.11, respectively; e and f, medullary markers ER-TR5 and 3G10, respectively; g, a marker of fibroblasts, ER-TR7; h, a putative marker of progenitor epithelium in the fetal thymus, MTS24.

 
Epithelia of the thymus and primary airways display a common phenotype

The epithelial cells that comprise the cystic structures in both the nude and normal thymus and that express respiratory epithelial gene products also react with a panel of Abs that have been used to define subsets of thymic epithelial cells. This prompted an evaluation of the reactivity of these anti-thymic stromal cell Abs with respiratory epithelium. As shown in Fig. 7, Abs that define cortical and MTE react with respiratory epithelium, with preferential reactivity with the epithelium of the conducting portion of the respiratory system. Whereas both alveolar and conducting respiratory epithelium express E-cadherin, bronchiolar epithelial cells and type II alveolar cells preferentially react with G8.8. Furthermore, in addition to reacting with pairs of Abs that react with cortical TE (ER-TR4 and F6.11) and medullary (ER-TR5 and 3G10) epithelium, respiratory epithelium also expresses the epitope recognized by MTS24, the putative marker of progenitor thymic epithelial cells. These Abs also reacted with the epithelium that lines the trachea and comprises the submucosal glands (data not shown).



View larger version (93K):
[in this window]
[in a new window]
 
FIGURE 7. Proximal respiratory epithelium displays many of the phenotypic characteristics of thymic epithelium. Adult lung tissue was processed with the same set of Abs demonstrated in Fig. 3. *, Lumina of bronchioles; #, transition to alveolar epithelium seen in respiratory bronchioles. a, E-cadherin (pan-epithelial marker); b, Ep-CAM (G8.8) preferentially expressed by medullary epithelium and scattered type II alveolar epithelial cells; c and d, cortical markers, ER-TR4 and F.6.11, respectively; e and f, medullary markers: ER-TR5 and 3G10, respectively. G, a marker of fibroblasts, ER-TR7; h, a putative marker of progenitor epithelium in the fetal thymus, MTS24.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Here, we have characterized a unique medullary epithelial cystic structure in the normal thymus that displays organizational and phenotypic properties of respiratory epithelium. Cells comprising these cysts represent one source of the TSAs within the thymus that are thought to play an important role in establishing tolerance to self-Ags and preventing organ-specific autoimmune disease. This epithelial population also displays a number of phenotypic properties previously attributed to progenitor thymic epithelial cells (discussed below) and thus may represent an epithelial subset with progenitor potential. Finally, this study highlights the phenotypic similarities between the epithelium of the thymus and the proximal or conducting portions of the respiratory system and raises some interesting questions regarding thymic organogenesis.

On the basis of phenotypic properties, Ropke et al. (36) suggested that a precursor population to cortical and medullary epithelial populations expressed both cortical and medullary markers. Similarly, a population of TE cells expressing both keratin 5 and keratin 8 have been proposed as precursors to keratin 8+keratin 5 cortical epithelial cells (37). Two groups have used the MTS20 and MTS24 Abs to isolate a population of TE cells from the fetal thymus that generated both cortical and medullary thymic compartments upon grafting under the kidney capsule (33, 34). Thus, according to these phenotypic criteria, the epithelial cells lining the cysts could have progenitor activity.

The origin of these epithelial cells is unclear. One possibility is that they represent remnants of the thymopharyngeal cyst that is formed by the evagination of the third pharyngeal endodermal pouch into the surrounding mesenchyme. This remnant of pharyngeal pouch endoderm may not receive the environmental cues required for specification and subsequent differentiation to become thymic epithelium and, as a consequence, give rise to cells that follow a respiratory program of development instead. Alternatively, the cysts may reflect the terminal differentiation of a subset of medullary thymic epithelial cells with respiratory character. However, the presence of these cystic epithelial structures in day 14–15 fetal thymi indicate that they are established early in thymic organogenesis before the medullary epithelial compartment is well formed, making this second possibility less likely.

We have recently described the organization and phenotype of the thymic rudiment of nude mice, where, lacking functional foxn1, the thymic rudiment of nude mice appears to follows a respiratory developmental pathway (27). The morphological and phenotypic similarities between the thymic epithelial rudiment of nude mice and the subset of normal thymic epithelium described here suggest that the program of epithelial differentiation that predominates in the nude thymus is also followed by a small population of epithelial cells in the normal thymus. The cystic epithelium in the normal thymus may represent progenitor cells or their progeny that fail to receive the environmental cues that induce appropriate levels of foxn1 expression and, as a consequence, these cells recapitulate the developmental program displayed by nude pharyngeal pouch endoderm lacking functional foxn1. Wnt signaling could be one such cue, because this signaling pathway can regulate foxn1 expression in vitro and both thymocytes and thymic epithelial cells secrete Wnt molecules (38).

Multiple mechanisms almost certainly contribute to the mosaic of self-Ags expressed by thymic epithelial cells. Expression of some of these TSAs are dependent on the activity of aire within MTE, whereas others are clearly aire independent (10). Previous in situ immunohistochemical localization of other thymically expressed TSAs has revealed single isolated cells (39), whereas the results presented here describe a coordinated pattern of respiratory TSA expression that was highly reminiscent of developing respiratory epithelium and in addition to scattered cells in the medulla. Additional studies will determine whether or not this coordinated pattern of expression within the thymus is unique to respiratory Ags or the epithelial cells comprising the cysts and whether or not this coordinated pattern of TSA expression is evident when other sets of related TSAs are examined.

Although it is possible to attribute this phenotype to a derepression of gene expression by mature TE, the multicellular nature of the epithelial structures expressing these respiratory TSAs indicate that either multiple cells coordinately effect this derepression program or that the proposed gene derepression also activates a program of epithelial proliferation and differentiation to generate a cohort of similar cells. We favor the hypothesis that the coordinated expression of these respiratory genes by an epithelial subset that bears organizational and morphological similarities to respiratory epithelium reflects a developmental program initiated by multipotential epithelial progenitor population in the thymus. It is likely that understanding how thymic epithelial differentiation is regulated will provide important insight into the control of TSA expression by thymic epithelium.

Finally, the extent to which thymic and respiratory epithelium share a common phenotype is intriguing when considering the developmental programs undertaken by different endodermal derivatives as the acquire their unique organization and functions and the nature of the signals that are responsible. With the demonstration that many of the Abs used to define TE heterogeneity also react with respiratory epithelium and probably a range of other epithelia as well comes the realization that there are presently few, if any, molecular signals that are signature for thymic epithelium. This in turn suggests that specialized tissue-specific properties may reflect unique combinatorial expression of a spectrum of regulatory and structural genes that are widely expressed among different epithelia.


    Acknowledgments
 
We thank Drs. Sikander Katyal, Angus Nairn, Philip Whitney, Richard Hodes, and Richard Boyd for their gifts of Abs to CC-10, CFTR, plunc, B7-2, and MTS24, respectively.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work supported by National Institutes of Health Grants AI-024137 and AI-059575. Back

2 Address correspondence and reprint requests to Dr. Andrew G. Farr, Department of Biological Structure, Box 357420, University of Washington, Seattle, WA 98195-7420. E-mail address: farr{at}u.washington.edu Back

3 Abbreviations used in this paper: MTE, medullary thymic epithelium; TE, thymic epithelium; TSA, tissue-specific Ag; aire, autoimmune regulator gene; TTF1, thyroid transcription factor 1. Back

Received for publication May 20, 2005. Accepted for publication July 26, 2005.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Lind, E. F., S. E. Prockop, H. E. Porritt, H. T. Petrie. 2001. Mapping precursor movement through the postnatal thymus reveals specific microenvironments supporting defined stages of early lymphoid development. J. Exp. Med. 194:127.-134. [Abstract/Free Full Text]
  2. Radtke, F., A. Wilson, S. J. Mancini, H. R. MacDonald. 2004. Notch regulation of lymphocyte development and function. Nat. Immunol. 5:247.-153. [Medline]
  3. Benoist, C., D. Mathis. 1989. Positive selection of the T cell repertoire: where and when does it occur?. Cell 58:1027.-1033. [Medline]
  4. Naquet, P., M. Naspetti, R. Boyd. 1999. Development, organization and function of the thymic medulla in normal, immunodeficient or autoimmune mice. Semin. Immunol. 11:47.-55. [Medline]
  5. Hanahan, D.. 1998. Peripheral-antigen-expressing cells in thymic medulla: factors in self-tolerance and autoimmunity. Curr. Opin. Immunol. 10:656.-662. [Medline]
  6. Geenen, V., P. J. Lefebvre. 1998. The intrathymic expression of insulin-related genes: implications for pathophysiology and prevention of Type 1 diabetes. Diabetes Metab. Rev. 14:95.-103. [Medline]
  7. Klein, L., M. Klugmann, K. A. Nave, V. K. Tuohy, B. Kyewski. 2000. Shaping of the autoreactive T-cell repertoire by a splice variant of self protein expressed in thymic epithelial cells. Nat. Med. 6:56.-61. [Medline]
  8. Pitkanen, J., V. Doucas, T. Sternsdorf, T. Nakajima, S. Aratani, K. Jensen, H. Will, P. Vahamurto, J. Ollila, M. Vihinen, et al 2000. The autoimmune regulator protein has transcriptional transactivating properties and interacts with the common coactivator CREB-binding protein. J. Biol. Chem. 275:16802.-16809. [Abstract/Free Full Text]
  9. Uchida, D., S. Hatakeyama, A. Matsushima, H. Han, S. Ishido, H. Hotta, J. Kudoh, N. Shimizu, V. Doucas, K. I. Nakayama, et al 2004. AIRE functions as an E3 ubiquitin ligase. J. Exp. Med. 199:167.-172. [Abstract/Free Full Text]
  10. Anderson, M. S., E. S. Venanzi, L. Klein, Z. Chen, S. P. Berzins, S. J. Turley, H. von Boehmer, R. Bronson, A. Dierich, C. Benoist, D. Mathis. 2002. Projection of an immunological self shadow within the thymus by the aire protein. Science 298:1395.-1401. [Abstract/Free Full Text]
  11. Derbinski, J., A. Schulte, B. Kyewski, L. Klein. 2001. Promiscuous gene expression in medullary thymic epithelial cells mirrors the peripheral self. Nat. Immunol. 2:1032.-1039. [Medline]
  12. Gotter, J., B. Brors, M. Hergenhahn, B. Kyewski. 2004. Medullary epithelial cells of the human thymus express a highly diverse selection of tissue-specific genes colocalized in chromosomal clusters. J. Exp. Med. 199:155.-166. [Abstract/Free Full Text]
  13. Farr, A. G., A. Rudensky. 1998. Medullary thymic epithelium: a mosaic of epithelial "self"?. J. Exp. Med. 188:1.-4. [Free Full Text]
  14. Farr, A. G., J. L. Dooley, M. Erickson. 2002. Organization of thymic medullary epithelial heterogeneity: implications for mechanisms of epithelial differentiation. Immunol. Rev. 189:20.-27. [Medline]
  15. Blackburn, C. C., C. L. Augustine, R. Li, R. P. Harvey, M. A. Malin, R. L. Boyd, J. F. Miller, G. Morahan. 1996. The nu gene acts cell-autonomously and is required for differentiation of thymic epithelial progenitors. Proc. Natl. Acad. Sci. USA 93:5742.-5746. [Abstract/Free Full Text]
  16. Campos, M. A., A. R. Abreu, M. C. Nlend, M. A. Cobas, G. E. Conner, P. L. Whitney. 2004. Purification and characterization of PLUNC from human tracheobronchial secretions. Am. J. Respir. Cell Mol. Biol. 30:184.-192. [Abstract/Free Full Text]
  17. Cardoso, W. V., L. G. Stewart, K. E. Pinkerton, C. Ji, G. E. Hook, G. Singh, S. L. Katyal, W. M. Thurlbeck, C. G. Plopper. 1993. Secretory product expression during Clara cell differentiation in the rabbit and rat. Am. J. Physiol. 264:L543.-L552.
  18. Webster, P., L. Vanacore, A. C. Nairn, C. R. Marino. 1994. Subcellular localization of CFTR to endosomes in a ductal epithelium. Am. J. Physiol. 267:C340.-C348.
  19. Shirayoshi, Y., A. Nose, K. Iwasaki, M. Takeichi. 1986. N-linked oligosaccharides are not involved in the function of a cell-cell binding glycoprotein E-cadherin. Cell Struct. Funct. 11:245.-252. [Medline]
  20. Van Vliet, E., E. J. Jenkinson, R. Kingston, J. J. Owen, W. Van Ewijk. 1985. Stromal cell types in the developing thymus of the normal and nude mouse embryo. Eur. J. Immunol. 15:675.-681. [Medline]
  21. Farr, A., A. Nelson, J. Truex, S. Hosier. 1991. Epithelial heterogeneity in the murine thymus: a cell surface glycoprotein expressed by subcapsular and medullary epithelium. J. Histochem. Cytochem. 39:645.-653. [Abstract]
  22. Hathcock, K. S., G. Laszlo, H. B. Dickler, S. O. Sharrow, P. Johnson, I. S. Trowbridge, R. J. Hodes. 1992. Expression of variable exon A-, B-, and C-specific CD45 determinants on peripheral and thymic T cell populations. J. Immunol. 148:19.-28. [Abstract]
  23. Rouse, R. V., L. M. Bolin, J. R. Bender, B. A. Kyewski. 1988. Monoclonal antibodies reactive with subsets of mouse and human thymic epithelial cells. J. Histochem. Cytochem. 36:1511.-1517. [Abstract]
  24. Zuklys, S., G. Balciunaite, A. Agarwal, E. Fasler-Kan, E. Palmer, G. A. Hollander. 2000. Normal thymic architecture and negative selection are associated with Aire expression, the gene defective in the autoimmune-polyendocrinopathy-candidiasis-ectodermal dystrophy (APECED). J. Immunol. 165:1976.-1983. [Abstract/Free Full Text]
  25. Wallin, J., H. Eibel, A. Neubuser, J. Wilting, H. Koseki, R. Balling. 1996. Pax1 is expressed during development of the thymus epithelium and is required for normal T-cell maturation. Development 122:23.-30. [Abstract]
  26. Hetzer-Egger, C., M. Schorpp, A. Haas-Assenbaum, R. Balling, H. Peters, T. Boehm. 2002. Thymopoiesis requires Pax9 function in thymic epithelial cells. Eur. J. Immunol. 32:1175.-1181. [Medline]
  27. Dooley, J. L., M. Erickson, H. Roelink, A. G. Farr. 2005. The nude thymic rudiment lacking functional foxn1 resembles respiratory epithelium. Dev. Dyn. 233:1605.-1612. [Medline]
  28. Kimura, S., J. M. Ward, P. Minoo. 1999. Thyroid-specific enhancer-binding protein/thyroid transcription factor 1 is not required for the initial specification of the thyroid and lung primordia. Biochimie 81:321.-327. [Medline]
  29. Minoo, P., G. Su, H. Drum, P. Bringas, S. Kimura. 1999. Defects in tracheoesophageal and lung morphogenesis in Nkx2.1–/– mouse embryos. Dev. Biol. 209:60.-71. [Medline]
  30. Ray, M. K., C. Y. Chen, R. J. Schwartz, F. J. DeMayo. 1996. Transcriptional regulation of a mouse Clara cell-specific protein (mCC10) gene by the NKx transcription factor family members thyroid transcription factor 1 and cardiac muscle-specific homeobox protein (CSX). Mol. Cell. Biol. 16:2056.-2064. [Abstract]
  31. LeClair, E. E., L. Nguyen, L. Bingle, A. MacGowan, V. Singleton, S. J. Ward, C. D. Bingle. 2001. Genomic organization of the mouse plunc gene and expression in the developing airways and thymus. Biochem. Biophys. Res. Commun. 284:792.-797. [Medline]
  32. Khosla, S., W. K. Ovalle. 1986. Morphology and distribution of cystic cavities in the normal murine thymus. Cell Tissue Res. 246:531.-542. [Medline]
  33. Gill, J., M. Malin, G. A. Hollander, R. Boyd. 2002. Generation of a complete thymic microenvironment by MTS24+ thymic epithelial cells. Nat. Immunol. 3:635.-642. [Medline]
  34. Bennett, A. R., A. Farley, N. F. Blair, J. Gordon, L. Sharp, C. C. Blackburn. 2002. Identification and characterization of thymic epithelial progenitor cells. Immunity 16:803.-814. [Medline]
  35. Nehls, M., D. Pfeifer, M. Schorpp, H. Hedrich, T. Boehm. 1994. New member of the winged-helix protein family disrupted in mouse and rat nude mutations. Nature 372:103.-107. [Medline]
  36. Ropke, C., P. Van Soest, P. P. Platenburg, W. Van Ewijk. 1995. A common stem cell for murine cortical and medullary thymic epithelial cells?. Dev. Immunol. 4:149.-156. [Medline]
  37. Klug, D. B., C. Carter, E. Crouch, D. Roop, C. J. Conti, E. R. Richie. 1998. Interdependence of cortical thymic epithelial cell differentiation and T-lineage commitment. Proc. Natl. Acad. Sci. USA 95:11822.-11827. [Abstract/Free Full Text]
  38. Balciunaite, G., M. P. Keller, E. Balciunaite, L. Piali, S. Zuklys, Y. D. Mathieu, J. Gill, R. Boyd, D. J. Sussman, G. A. Hollander. 2002. Wnt glycoproteins regulate the expression of FoxN1, the gene defective in nude mice. Nat. Immunol. 3:1102.-1108. [Medline]
  39. Smith, K. M., D. C. Olson, R. Hirose, D. Hanahan. 1997. Pancreatic gene expression in rare cells of thymic medulla: evidence for functional contribution to T cell tolerance. Int. Immunol. 9:1355.-1365. [Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Immunol.Home page
J. Dooley, M. Erickson, and A. G. Farr
Lessons from Thymic Epithelial Heterogeneity: FoxN1 and Tissue-Restricted Gene Expression by Extrathymic, Endodermally Derived Epithelium
J. Immunol., October 15, 2009; 183(8): 5042 - 5049.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Dooley, M. Erickson, and A. G. Farr
Alterations of the Medullary Epithelial Compartment in the Aire-Deficient Thymus: Implications for Programs of Thymic Epithelial Differentiation
J. Immunol., October 15, 2008; 181(8): 5225 - 5232.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
A. Liston, A. G. Farr, Z. Chen, C. Benoist, D. Mathis, N. R. Manley, and A. Y. Rudensky
Lack of Foxp3 function and expression in the thymic epithelium
J. Exp. Med., March 19, 2007; 204(3): 475 - 480.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G. O. Gillard, J. Dooley, M. Erickson, L. Peltonen, and A. G. Farr
Aire-Dependent Alterations in Medullary Thymic Epithelium Indicate a Role for Aire in Thymic Epithelial Differentiation
J. Immunol., March 1, 2007; 178(5): 3007 - 3015.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
W. Wang, J. Zhong, B. Su, Y. Zhou, and Y.-Q. Wang
Comparison of Pax1/9 Locus Reveals 500-Myr-Old Syntenic Block and Evolutionary Conserved Noncoding Regions
Mol. Biol. Evol., March 1, 2007; 24(3): 784 - 791.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. Lomada, B. Liu, L. Coghlan, Y. Hu, and E. R. Richie
Thymus Medulla Formation and Central Tolerance Are Restored in IKK{alpha}-/- Mice That Express an IKK{alpha} Transgene in Keratin 5+ Thymic Epithelial Cells
J. Immunol., January 15, 2007; 178(2): 829 - 837.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
G. O. Gillard and A. G. Farr
The thymus: a house dividing
Blood, December 1, 2006; 108(12): 3629 - 3630.
[Full Text] [PDF]


Home page
J. Immunol.Home page
J. Dooley, M. Erickson, G. O. Gillard, and A. G. Farr
Cervical Thymus in the Mouse.
J. Immunol., June 1, 2006; 176(11): 6484 - 6490.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G. O. Gillard and A. G. Farr
Features of Medullary Thymic Epithelium Implicate Postnatal Development in Maintaining Epithelial Heterogeneity and Tissue-Restricted Antigen Expression
J. Immunol., May 15, 2006; 176(10): 5815 - 5824.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dooley, J.
Right arrow Articles by Farr, A. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dooley, J.
Right arrow Articles by Farr, A. G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS