The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shao, M. X. G.
Right arrow Articles by Nadel, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shao, M. X. G.
Right arrow Articles by Nadel, J. A.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Substance via MeSH
The Journal of Immunology, 2005, 175: 4009-4016.
Copyright © 2005 by The American Association of Immunologists

Neutrophil Elastase Induces MUC5AC Mucin Production in Human Airway Epithelial Cells via a Cascade Involving Protein Kinase C, Reactive Oxygen Species, and TNF-{alpha}-Converting Enzyme1

Matt X. G. Shao and Jay A. Nadel2

Cardiovascular Research Institute and Departments of Medicine and Physiology, University of California San Francisco, San Francisco, California 94143


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Mucus hypersecretion is a prominent manifestation in patients with chronic inflammatory airway diseases and contributes to their morbidity and mortality by plugging airways and causing recurrent infections. Human neutrophil elastase (HNE) exists in high concentrations (1–20 µM) in airway secretions of these patients and induces overproduction of MUC5AC mucin, a major component of airway mucus. Previous studies showed that HNE induces MUC5AC mucin production involving reactive oxygen species (ROS) generation and TGF-{alpha}-dependent epidermal growth factor receptor (EGFR) activation in human airway epithelial cells. However, the molecular mechanisms involved in these responses are not defined. TNF-{alpha}-converting enzyme (TACE) cleaves pro-TGF-{alpha} into soluble TGF-{alpha} and can be activated by ROS. We hypothesize that HNE activates TACE via ROS generation, resulting in cleavage of pro-TGF-{alpha}, EGFR activation, and MUC5AC mucin expression in airway epithelial cells. Here we show that in human airway epithelial cells HNE increases TGF-{alpha} release, EGFR phosphorylation, and MUC5AC mucin expression, effects that were attenuated by TACE inhibitor TAPI-1 and by specific knockdown of TACE expression with small interfering RNA, implicating TACE in HNE-induced responses. These responses to HNE were also reduced by pretreatment with ROS scavengers, implicating ROS. Furthermore, we show that HNE causes protein kinase C (PKC) activation and translocation from cytosol to plasma membrane; blockade of this effect by PKC inhibitors reduced HNE-induced ROS generation and other responses, implicating PKC. We conclude that HNE induces MUC5AC mucin expression via a cascade involving PKC-ROS-TACE in human airway epithelial cells.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Mucus hypersecretion is an important manifestation of chronic inflammatory airway diseases, including severe asthma, cystic fibrosis, chronic bronchitis, and bronchiectasis (1, 2). Excessive mucus contributes to morbidity and mortality in these diseases by plugging airways and causing recurrent infections. MUC5AC mucin is a major component of airway mucus (3, 4), and its gene expression is regulated by a signaling pathway involving epidermal growth factor receptor (EGFR)3-Ras-Raf-MEK1/2-ERK1/2-Sp1 (5, 6).

Neutrophil influx into airways is a predominant pathophysiologic feature in chronic inflammatory airway diseases. Human neutrophil elastase (HNE) is a 29 kDa serine protease secreted by neutrophils into airways, which is present in high concentrations (5–20 µM) (7, 8) in airway secretions of subjects with chronic inflammatory airway diseases and mucus hypersecretion. HNE has been reported to cause goblet cell hyperplasia in airways (9, 10) and MUC5AC mucin expression in cultured airway epithelial cells (11). Kohri et al. (12) reported that HNE induces MUC5AC mucin protein production by increasing release of soluble TGF-{alpha} and causing EGFR activation in NCI-H292 airway epithelial cells. Fischer et al. (13) reported that HNE induces MUC5AC gene expression via a signaling pathway involving reactive oxygen species (ROS) in both normal human bronchial epithelial and A549 cells. Aoshiba et al. (14) showed that stimulation of normal airway epithelial cells with HNE produces ROS. Together, these studies show that TGF-{alpha} release and ROS production are involved in MUC5AC mucin production by HNE in airway epithelial cells. However, the molecular mechanism by which HNE causes ROS production and TGF-{alpha} release is not known.

Previous studies in airway epithelial cells showed that PMA and Pseudomonas aeruginosa supernatants induce MUC5AC gene expression and mucin protein production by causing activation of TNF-{alpha}-converting enzyme (TACE), which cleaves pro-TGF-{alpha} into soluble TGF-{alpha}, leading to EGFR phosphorylation and mucin production (15). Studies in various cell types showed that ROS can cause TACE activation (16, 17, 18). Protein kinase C (PKC) has been reported to mediate ROS generation in inflammatory cells in response to PMA stimulation (19). Our current hypothesis is that HNE causes PKC activation, leading to production of ROS, which activates TACE, resulting in TGF-{alpha} release, EGFR phosphorylation, and MUC5AC mucin production in human airway epithelial cells.

To examine this hypothesis, first we investigated whether TACE is involved in HNE-induced TGF-{alpha} release, EGFR activation, and MUC5AC mucin expression with two approaches: pharmacological inhibition of TACE activation and specific knockdown of TACE expression with small interfering RNA (siRNA). Next, we examined whether ROS production is required for TACE activation by HNE. Finally, we examined whether HNE induces PKC activation and, if so, whether PKC activation mediates HNE-induced ROS production and TGF-{alpha} release. Here we show that HNE causes PKC activation and translocation from cytosol to plasma membrane, which mediates ROS production, resulting in TACE activation and subsequent TGF-{alpha} release, leading to EGFR activation and mucin production in human airway epithelial cells.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Materials

1,3-Dimethyl-2-thiourea (DMTU) and n-propyl gallete (nPG) were purchased from Sigma-Aldrich. HNE was purchased from Elastin Products. Calphostin C (CC), bisindolylmaleimide III (BIM), TNF-{alpha} proteinase inhibitor-1 (TAPI-1), EGFR (Ab-5) mAb, anti-phosphotyrosine (PY99) mAb were purchased from Calbiochem. MUC5AC mAb (clone 1-13M1) was purchased from NeoMarkers. Phospho-PKC (pan) Ab was purchased from Cell Signaling.

Cell culture

Proliferating normal human bronchial epithelial (NHBE) cells were purchased in T75 flasks from Cambrex. When NHBE cells reached 80% confluence and contained many mitotic figures throughout the flask, the cells were seeded at a density of 2 x 104 cells/cm2 onto Costar brand Transwell plate inserts with a diameter of 24.5 or 12 mm (Fisher Scientific), growing in bronchial epithelial growth medium (BEGM) (Cambrex) supplemented with defined growth factors and retinoic acid (0.1 µg/l) contained in the SingleQuot kit (Cambrex) at 37°C in a humidified, 5% CO2/95% air, water-jacketed incubator. After 7 days in an immersed culture condition, cell culture was switched to an air-liquid interface condition for 2 to 3 wk. During this time, the cell cultures contained differentiated airway epithelial cells, some of which contained mucus-secreting granules and some contained cilia (20).

NCI-H292 cells (a human pulmonary mucoepidermoid carcinoma cell line) were plated at 5–6 x 105 cells in 2 ml in each well of a 6-well plate or at 1–2 x 105 cells in 1 ml in each well of a 24-well plate (both 6-well and 24-well plates were purchased from BD Falcon) and were grown in RPMI 1640 medium containing 10% FCS, penicillin (100 U/ml), streptomycin (100 µg/ml), and HEPES (25 mM) at 37°C in a humidified, 5% CO2/95% air, water-jacketed incubator. After the cells reached confluence, they were serum-starved for 24 h before experiments to maintain low basal levels of MUC5AC expression.

Culture conditions of airway epithelial cells with stimuli and inhibitors

NHBE or NCI-H292 cells were treated with stimuli as indicated in each experiment. For inhibition studies, NHBE cells or serum-starved NCI-H292 cells were pretreated with inhibitors for 30 min before exposure to stimuli. In studies of HNE, the cells were treated with HNE (100 nM) for 1 h. Then the cells were washed three times with BEGM (NHBE cells) or serum-free RPMI 1640 medium (NCI-H292 cells) and cultured for an additional 10 or 24 h in BEGM with supplements or serum-free RPMI 1640 medium with the same concentrations of inhibitors as in the pretreatment period. After 10 or 24 h, cell culture supernatants and cell lysates were collected to measure MUC5AC expression.

Cytotoxicity detection and measurement of total protein

Lactate dehydrogenase activity in supernatants of cell cultures treated with or without inhibitors was measured with a cytotoxicity detection kit (Roche Diagnostics). Total protein in cell lysates of cell cultures treated with or without inhibitors was measured with the BCA protein assay kit (Pierce). None of the measurements showed significant cytotoxicity for the inhibitors at the concentrations used in the present studies.

Measurement of H2O2 production

Cells were either incubated with HNE or maintained in medium alone for various times as indicated in each experiment. H2O2 production in cells was measured with the Amplex Rad hydrogen peroxide/peroxidase assay kit (Molecular Probes), according to the manufacturer’s instructions.

RNA isolation, reverse transcription, and TaqMan real-time quantitative PCR

Total RNA was isolated with the RNAqueous-4 PCR kit (Ambion), and 1.0–1.5 µg was primed with oligo(dT) and reverse transcribed with the RETROscript kit (Ambion) in a final volume of 20 µl (RT reaction), following manual instructions. TaqMan analysis of MUC5AC gene expression was achieved using Prim 7900 sequence detector (Applied Biosystems), according to manufacturer’s instructions. MUC5AC gene expression was expressed using 2–D{Delta}Ct method (21) and was presented as the fold change in MUC5AC gene expression normalized to 18S RNA gene expression and relative to the untreated controls. The following Taqman primers and probes were used: 18S rRNA (forward) GATCCATTGGAGGGCAAGTCT, (reverse) GCAGCAACTTTAATATACGCTATTGC, and probe-FAM TGCCAGCAGCCGCGGTAATTC; MUC5AC (forward) GGAGGTGCCCTTCAGCAA, (reverse) CGTGCGGCACTCATCCTT, and probe-FAM AGTGCGGCACTTGCACCAACGAC. Each reaction consisted of 12.5 µl 2x QuantiTect Probe PCR master mix (Qiagen), 300 nM forward and 300 nM reverse primers and 175 nM probe and 1 µl of cDNA made up to 25 µl with nuclease-free water.

MUC5AC ELISA

Production of MUC5AC protein in cell lysates and in cell culture supernatants were measured by ELISA with mAb MUC5AC (clone 1-13M1), as described previously (5). The amount of MUC5AC mucin in each sample was normalized to total protein in cell lysate and was expressed as micrograms of mucin per milligram of total cellular protein.

Effect of human neutrophil elastase on cleavage and release of soluble TGF-{alpha}

Cells were stimulated with HNE (100 nM) or maintained in medium alone for 2 h. To prevent soluble TGF-{alpha} from binding to EGFR, an EGFR neutralizing Ab (Ab-3, 4 µg/ml) was added 10 min before adding a stimulus. Cell supernatants were collected and TGF-{alpha} was measured with the TGF-{alpha} ELISA kit (Oncogene), according to the manufacturer’s instructions.

TACE siRNA preparation and transfection

To design TACE-specific siRNA duplexes, we selected sequences of the type AAN19 (N, any nucleotide) from the open reading frame of TACE (ADAM 17) mRNA (NM_003183, GenBank accession number) to obtain a 21-nt sense and 21-nt antisense strand with a GC content below 50%. A selected siRNA sequence was submitted to a BLAST search against the human genome sequence to ensure that only TACE gene of the human genome was targeted. The selected 21-nt sequences of TACE are (sense) 5'-AAGCTTGATTCTTTGCTCTCA-3' and (antisense) 5'-AATGAGAGCAAAGAATCAAGC-3'. As nonspecific siRNA control, a sequence targeting firefly (Photinus pyralis) luciferase gene (X65324) 153–175 was used (22, 23). dsRNA (21-nt) was prepared in vitro by Silencer siRNA Construction Kit (Ambion Inc.). siRNA transfection into NCI-H292 cells was conducted using Lipofectamine 2000 (Invitrogen). Western blotting was used to confirm TACE silencing by siRNA at 72 h after transfection.

Recombinant TACE cleavage assay

Purified recombinant TACE without the prodomain was purchased from Calbiochem. TACE inhibitory peptide (TIP) was synthesized from TACE prodomain sequence, PKVCGYLK (24), by Biosource. TACE activity was determined by continuous kinetic assays using the fluorogenic TACE substrate III, DABCYL-LAQAVRSSSR-EDANS (Calbiochem). The fluorescence intensity was monitored in a CytoFluor 2350 multiwell fluorescent plate reader (Applied Biosystems) using a wavelength of 340 nm and 490 nm for excitation and emission, respectively. All reactions were initiated in 50 µl of 50 mM Tricine buffer (pH 7.5) containing 100 mM NaCl, 10 mM CaCl2, and 1 mM ZnCl2. To inhibit TACE, TIP (400 µM) was incubated with TACE (200 nM) for 1 h at 27°C. To test whether HNE can reverse TACE inhibition, HNE was added to the reactions (TACE + TIP) for a final concentration of 10, 100, and 1000 nM, respectively, and incubated for 30 min. H2O2 (4 mM), which has been reported to be able to reverse TACE inhibition by TIP (17), was used as a positive control. Finally, TACE substrate III was added to the reactions for a final concentration of 20 µM, and the fluorescence intensity was monitored every 10 min for 6 h.

Preparation of membrane fraction

Membrane fraction of NHBE and NCI-H292 cells was prepared according to the method described (25). Briefly, the cells were harvested and washed twice with PBS after various treatments. The cell pellet was resuspended in relaxation buffer (100 mM KCl, 3 mM NaCl, 3.5 mM MgCl2, 1 mM EGTA, 10 mM HEPES, 0.5 mM PMSF, and 1/100 dilution of proteinase inhibitors (Complete Mini; Roche)), disrupted by 2 x 10 s cycles of sonication on ice, and then centrifuged at 600 x g for 10 min at 4°C to remove nuclei and unbroken cells. The supernatant was then ultracentrifuged at 100,000 x g for 30 min at 4°C. The supernatant represented the soluble cytosolic fraction. The pellet was resuspended in relaxation buffer with vigorous mixing and again centrifuged at 100,000 x g for 15 min at 4°C. The final pellet, representing the particulate/membrane fraction, was resuspended in relaxation buffer; hereafter, the pellet is referred to as the membrane fraction. The membrane fraction was suspended in SDS sample buffer, boiled for 5 min, and subjected to electrophoresis on 7.5% SDS-PAGE and immunoblotting as described below.

Cell lysis, immunoprecipitation, and immunoblotting

After various treatments, cells were lysed on ice in PBS lysis buffer containing 1% Triton X-100, 1% deoxycholic acid, 50 mM NaF, 1 mM sodium orthovanadate, and proteinase inhibitors (Complete Mini; Roche). Lysates were precleared by centrifugation at 14,000 rpm for 15 min at 4°C. Protein concentration was determined using the bicinchoninic acid-based BCA protein assay kit (Pierce). For immunoprecipitation, aliquots of cell lysates containing equal amounts of protein were immunoprecipitated with 4 µg of anti-EGFR Ab and 40 µl of protein A/G-agarose beads (Santa Cruz Biotechnology) for 16 h at 4°C. Precipitates were washed three times with 0.5 ml of PBS, suspended in SDS sample buffer, boiled for 5 min, and subjected to electrophoresis on 7.5% SDS-PAGE. For Western blotting, 30 µg of protein from each treatment was subjected to 7.5% SDS-PAGE. After electrophoresis, protein samples were transferred to a polyvinylidene difluoride membrane (Bio-Rad Laboratories), which was blocked with 5% BSA, probed with specific primary Abs indicated in each experiment, washed with PBS, and then probed with secondary Abs conjugated to HRP. Immunoreactive bands were visualized by chemiluminescence using Western blotting luminol reagent (Santa Cruz Biotechnology).

Statistical analysis

All studies were performed in duplicates at least three separate times. Data are presented as mean ± SD (n = 3). ANOVA was used to determine statistically significant differences (p < 0.01).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Human neutrophil elastase induces MUC5AC gene expression and mucin protein production via TACE in NCI-H292 airway epithelial cells

HNE induced MUC5AC gene expression (Fig. 1A) and mucin protein production (Fig. 1B) in NCI-H292 cells dose dependently. HNE had a maximal effect on mucin expression at a concentration of 100 nM. Pretreatment of the cells with TACE inhibitor TAPI-1 (5 and 20 µM) reduced HNE-induced MUC5AC gene expression (Fig. 1C) and mucin protein production (Fig. 1D) dose dependently, implicating TACE in HNE-induced MUC5AC mucin expression.



View larger version (22K):
[in this window]
[in a new window]
 
FIGURE 1. Effect of human neutrophil elastase on MUC5AC gene expression and mucin protein production and effect of TACE inhibitor TAPI-1. NCI-H292 cells were treated with vehicle or with HNE at various concentrations for 10 h and analyzed for MUC5AC gene expression by real-time quantitative PCR (A), or stimulated for 24 h and analyzed for MUC5AC mucin protein production by ELISA (B). Mucins were measured in the cell lysate (dark areas) and in the supernatant (light areas). Data are expressed as mean ± SD (n = 3). *, p < 0.01, compared with vehicle alone. C, After pretreatment with or without TACE inhibitor TAPI-1 (5 and 20 µM) for 30 min, NCI-H292 cells were stimulated with HNE (100 nM) for 10 h and analyzed for MUC5AC gene expression by real-time quantitative PCR, or stimulated for 24 h and analyzed for MUC5AC mucin protein production by ELISA (D). Mucins were measured in the cell lysate (dark areas) and in the supernatant (light areas). Data are expressed as mean ± SD (n = 3). #, p < 0.01, compared with vehicle alone; *, p < 0.01, compared with HNE alone.

 
TACE mediates HNE-induced TGF-{alpha} release and EGFR activation

TGF-{alpha} release and subsequent EGFR phosphorylation have been shown to be responsible for mucin induction in response to multiple stimuli. To examine whether HNE-induced release of TGF-{alpha} requires TACE activation, we pretreated NCI-H292 cells with TACE inhibitor TAPI-1. Pretreatment with TAPI-1 reduced TGF-{alpha} release (Fig. 2A) and EGFR phosphorylation (Fig. 2B) by HNE dose dependently, implicating TACE in TGF-{alpha} release and EGFR phosphorylation by HNE in NCI-H292 cells.



View larger version (19K):
[in this window]
[in a new window]
 
FIGURE 2. Effect of TACE inhibitor TAPI-1 on HNE-induced TGF-{alpha} release and EGFR phosphorylation. A, NCI-H292 cells were pretreated with vehicle or with TACE inhibitor TAPI-1 (5 and 20 µM) for 30 min and then with an anti-EGFR neutralizing Ab (Ab-3, 4 µg/ml) for 10 min to block EGFR ligand binding sites and then stimulated with HNE (100 nM) for 2 h. Supernatants were collected for measurement of soluble TGF-{alpha} by ELISA. Data are expressed as mean ± SD (n = 3). #, p < 0.01, compared with vehicle alone; *, p < 0.01, compared with HNE alone. B, After pretreatment with or without TACE inhibitor TAPI-1 (5 and 20 µM) for 30 min, cells were stimulated with HNE (100 nM) for 5 min. After lysis, EGFR was immunoprecipitated with a monoclonal anti-EGFR Ab followed by immunoblotting with an anti-phosphotyrosine Ab (p-Tyr (PY99), upper panel) and reprobing with polyclonal anti-EGFR Ab (lower panel). Findings are typical of the results in three separate experiments.

 
Knockdown of TACE reduces TGF-{alpha} release, EGFR phosphorylation, MUC5AC gene expression, and mucin protein production by HNE

Because TAPI-1 is not completely selective for TACE, we examined the role of TACE in HNE-induced responses by specifically knocking down the expression of TACE with siRNA. TACE siRNA successfully knocked down the expression of TACE at both mRNA and protein levels (data not shown; also see Refs.15 and 16). Knockdown of TACE reduced HNE-induced TGF-{alpha} release (Fig. 3A), EGFR phosphorylation (Fig. 3B), MUC5AC mucin gene expression (Fig. 3C), and mucin protein production (Fig. 3D), whereas luciferase siRNA (Luc, used as a nonspecific control) was without inhibitory effect on these responses (Fig. 3, AD). From these results, we conclude that TACE is involved in HNE-induced TGF-{alpha} release, EGFR activation, and mucin expression in NCI-H292 cells.



View larger version (30K):
[in this window]
[in a new window]
 
FIGURE 3. Effect of knockdown of TACE expression on HNE-induced TGF-{alpha} release, EGFR phosphorylation, MUC5AC gene expression, and mucin protein production. NCI-H292 cells were treated with siRNA transfection reagent Lipofectamine 2000 (Lip), or transfected with TACE siRNA (TACE, 10 nM) or luciferase siRNA (Luc, 10 nM, as nonspecific control) and cultured for 72 h. A, After preincubation with an EGFR neutralizing Ab (4 µg/ml) for 10 min to block EGFR ligand binding sites, the cells were stimulated with HNE (100 nM) for 2 h. Supernatants were collected for measurement of soluble TGF-{alpha} by ELISA. Data are expressed as mean ± SD (n = 3). #, p < 0.01, compared with vehicle alone; *, p < 0.01, compared with Lipofectamine 2000 treatment and with luciferase siRNA. B, The cells were stimulated with HNE (100 nM) for 5 min. After lysis, EGFR was immunoprecipitated with a monoclonal anti-EGFR Ab followed by immunoblotting with an anti-phosphotyrosine Ab (p-Tyr (PY99), upper panel) and reprobing with polyclonal anti-EGFR Ab (lower panel). Findings are typical of the results in three separate experiments. C, The cells were treated with HNE (100 nM) for 10 h and analyzed for MUC5AC gene expression by real-time quantitative PCR, or for 24 h and measured for MUC5AC mucin protein production (D). Mucins were measured in the cell lysate (dark areas) and in the supernatant (light areas). Data are expressed as mean ± SD (n = 3). #, p < 0.01, compared with vehicle alone; *, p < 0.01, compared with Lipofectamine 2000 treatment and with the negative control luciferase siRNA.

 
Human neutrophil elastase does not act directly on TACE

Having determined the involvement of TACE in HNE-induced responses, we asked whether HNE has a direct action on TACE. To address this question, we performed recombinant TACE cleavage assay in a cell-free system. Recombinant active TACE cleaved its substrate (Fig. 4). Preincubation of the recombinant TACE with TIP, which mimics the effect of the prodomain of TACE, prevented cleavage of TACE substrate. Various concentrations of HNE (10, 100, and 1000 nM) did not reverse the inhibitory effect of TIP on TACE, whereas exogenous H2O2 (4 mM) reversed TACE inhibition by TIP, suggesting a direct action of H2O2, but not of HNE, on TACE. From these results, we conclude that HNE does not act directly on TACE.



View larger version (15K):
[in this window]
[in a new window]
 
FIGURE 4. Effect of human neutrophil elastase on recombinant TACE activity. First, purified recombinant TACE (200 nM) was incubated with or without TIP (400 µM) for 1 h at 27°C and then incubated with TACE substrate III (20 µM) to measure fluorescence intensity, as described in Materials and Methods. Second, TACE (200 nM) was preincubated with TIP (400 µM) for 1 h to inactivate TACE, and then H2O2 (4 mM) or various concentrations of HNE (10, 100, and 1000 nM, respectively) were added to the reactions for 30 min and then TACE substrate was added, and the fluorescence intensity was monitored for 6 h (data shown for fluorescence intensity at 6 h only). Data are expressed as mean ± SD (n = 3). #, p < 0.01, compared with vehicle alone; *, p < 0.01, compared with TACE alone.

 
Human neutrophil elastase causes TACE activation via ROS generation

Because ROS have been implicated in TACE activation (16, 17), and because HNE has been shown to induce ROS generation in both normal human airway epithelial cells and A549 airway epithelial cells (13, 14), we asked whether ROS mediate TACE activation by HNE in NCI-H292 cells. To address this question, we pretreated the cells with ROS scavengers DMTU and nPG. This treatment reduced HNE-induced TGF-{alpha} release (Fig. 5A), EGFR phosphorylation (Fig. 5B), MUC5AC gene expression (Fig. 5C), and mucin protein production (Fig. 5D), but not the mucin expression induced by an EGFR ligand TGF-{alpha} (10 ng/ml) (Fig. 5C, three right bars; data not shown for mucin protein). These data implicate the ROS generation in HNE-induced responses in NCI-H292 cells.



View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 5. Effect of ROS scavengers on HNE-induced TGF-{alpha} release, EGFR phosphorylation, MUC5AC gene expression, and mucin protein production. A, NCI-H292 cells were pretreated with vehicle or with ROS scavengers DMTU (20 mM) or nPG (100 µM) for 30 min and then with an EGFR neutralizing Ab (Ab-3, 4 µg/ml) for 10 min to block EGFR ligand-binding sites and then stimulated with HNE (100 nM) for 2 h. Supernatants were collected for measurement of soluble TGF-{alpha} by ELISA. Data are expressed as mean ± SD (n = 3). *, p < 0.01, compared with HNE alone. B, After pretreatment with vehicle or with ROS scavengers DMTU (20 mM) or nPG (100 µM) for 30 min, cells were stimulated with HNE (100 nM) for 5 min. After lysis, EGFR was immunoprecipitated with a monoclonal anti-EGFR Ab followed by immunoblotting with an anti-phosphotyrosine Ab (p-Tyr (PY99), upper panel) and reprobing with a polyclonal anti-EGFR Ab (lower panel). Findings are typical of the results in three separate experiments. C, After pretreatment with vehicle or with ROS scavengers DMTU (20 mM) or nPG (100 µM) for 30 min, cells were stimulated with HNE (100 nM) or TGF-{alpha} (10 ng/ml) for 10 h and analyzed for MUC5AC gene expression by real-time quantitative PCR, or stimulated for 24 h and analyzed for MUC5AC mucin protein production (D). Mucins were measured in the cell lysate (dark areas) and in the supernatant (light areas). Data in A, C, and D are expressed as mean ± SD (n = 3). #, p < 0.01, compared with vehicle alone; *, p < 0.01, compared with HNE alone.

 
Human neutrophil elastase induces ROS generation and TACE activation via PKC activation

Because PKC activation is linked to ROS generation in inflammatory cells (e.g., U937 cells) (19), we asked whether PKC also mediates ROS generation and subsequent TACE activation by HNE in NCI-H292 cells. To address this question, we pretreated the cells with PKC inhibitors CC and BIM. Both inhibitors inhibited HNE-induced PKC activation and translocation to the plasma membrane (Fig. 6A), reduced ROS generation (Fig. 6B), TGF-{alpha} release (Fig. 6C), MUC5AC gene expression (Fig. 6D), and mucin protein production (Fig. 6E); whereas the PKC inhibitors had no inhibitory effects on mucin gene expression in response to TGF-{alpha} (10 ng/ml) (Fig. 6D, three right bars). From these results, we conclude that PKC activation is required for HNE-induced responses in NCI-H292 cells.



View larger version (17K):
[in this window]
[in a new window]
 
FIGURE 6. Effect of PKC inhibitors on HNE-induced ROS generation, TGF-{alpha} release, MUC5AC gene expression, and mucin protein production. A, NCI-H292 cells were pretreated with or without PKC inhibitors CC (500 nM) or BIM (300 nM) for 30 min and then stimulated with HNE (100 nM) for 5 min. Plasma membrane fraction was prepared and subjected to Western blot analysis for detection of phospho-PKC with an anti-phospho-PKC (pan) Ab in membranes, as described in Materials and Methods. Blots are representative of three separate experiments showing similar findings. B, Cells were pretreated with vehicle or with PKC inhibitors CC (500 nM) or BIM (300 nM) for 30 min, and then stimulated with HNE (100 nM) for 5 min. H2O2 production in the cells was measured, as described in Materials and Methods. C, Cells were pretreated with vehicle or with PKC inhibitors CC (500 nM) or BIM (300 nM) for 30 min and then with an anti-EGFR neutralizing Ab (Ab-3, 4 µg/ml) for 10 min to block EGFR ligand-binding sites and then stimulated with HNE (100 nM) for 2 h. Supernatants were collected for measurement of soluble TGF-{alpha} by ELISA. D, After pretreatment with vehicle or with PKC inhibitors CC (500 nM) or BIM (300 nM) for 30 min, the cells were stimulated with HNE (100 nM) or TGF-{alpha} (10 ng/ml) for 10 h and analyzed for MUC5AC gene expression by real-time quantitative PCR, or stimulated for 24 h and analyzed for MUC5AC mucin protein production (E). Mucins were measured in the cell lysate (dark areas) and in the supernatant (light areas). Data in BE are expressed as mean ± SD (n = 3). #, p < 0.01, compared with vehicle alone; *, p < 0.01, compared with HNE alone.

 
Human neutrophil elastase induces mucin expression in normal human bronchial epithelial cells via a signaling pathway involving PKC-ROS-TACE

Having established the role of PKC-ROS-TACE cascade in NCI-H292 airway epithelial cells, we examined whether this mechanism could be extended to NHBE cells. Pretreatment of NHBE cells with PKC inhibitor BIM, or with ROS scavenger nPG, or with TACE inhibitor TAPI-1 reduced HNE-induced TGF-{alpha} release (Fig. 7A), MUC5AC gene expression (Fig. 7B), and mucin protein production (Fig. 7C). From these results, we conclude that PKC-ROS-TACE cascade is also involved in mucin induction by HNE in normal human bronchial epithelial cells.



View larger version (17K):
[in this window]
[in a new window]
 
FIGURE 7. Effect of inhibitors for PKC-ROS-TACE cascade on HNE-induced responses in normal human bronchial epithelial cells. A, After NHBE cells were cultured at an air-liquid interface for 3 wk, they were pretreated with vehicle or with PKC inhibitor BIM (500 nM), or with ROS scavenger nPG (100 µM), or with TACE inhibitor TAPI-1 (20 µM) for 30 min and then with an anti-EGFR neutralizing Ab (Ab-3, 4 µg/ml) for 10 min to block EGFR ligand-binding sites and then stimulated with HNE (100 nM) for 2 h. Supernatants were collected for measurement of soluble TGF-{alpha} by ELISA. B, After pretreatment with vehicle or with BIM (500 nM), or with nPG (100 µM), or with TAPI-1 (20 µM) for 30 min, NHBE cells were stimulated with HNE (100 nM) for 10 h and analyzed for MUC5AC gene expression by real-time quantitative PCR, or stimulated for 24 h and analyzed for MUC5AC mucin protein production (C). Mucins were measured in the cell lysate (dark areas) and in the supernatant (light areas). Data are expressed as mean ± SD (n = 3). #, p < 0.01, compared with vehicle alone; *, p < 0.01, compared with HNE alone.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Here we show that HNE causes PKC activation and subsequent generation of ROS, which activates TACE, leading to cleavage of pro-TGF-{alpha} into mature soluble TGF-{alpha}, resulting in EGFR activation and mucin production in human airway epithelial cells.

Neutrophil elastase (1–20 µM) is present in airway secretions of patients with chronic inflammatory airway diseases including cystic fibrosis, bronchiectasis, chronic obstructive pulmonary disease, and severe asthma (7, 8, 26, 27). Thus, airway epithelial cells are exposed to HNE in high concentrations in pathological conditions. HNE has been known to induce mucin overproduction in airways, but the mechanisms involved have not been completely defined. Although previous studies suggested that HNE might cleave pro-TGF-{alpha} into soluble TGF-{alpha} in cell-free systems (28, 29), there is lack of solid evidence that HNE cleaves pro-TGF-{alpha} in vitro or in vivo. Deficiency of mature soluble TGF-{alpha} in TACE knockout mice (30) suggests a direct action of TACE, but not of neutrophil elastase, on pro-TGF-{alpha}. In the present studies, we investigated the mechanism of TGF-{alpha} release by HNE in vitro. We showed that a metalloprotease/TACE inhibitor TAPI-1 and specific knockdown of TACE expression with siRNA reduced TGF-{alpha} release by HNE (Figs. 2A and 3A), suggesting that TGF-{alpha} release by HNE requires TACE activation.

The cellular process for TACE activation has not been defined. TACE is synthesized in a latent form with an inhibitory N-terminal prodomain masking the catalytic domain (31). Schlondorff et al. (32) reported that the prodomain is cleaved at a furin site in a late Golgi compartment and the processed TACE is transported to and localized in a perinuclear compartment and on cell surface membrane. Black et al. (31) reported that the cell surface TACE is without a prodomain, suggesting that TACE releases its prodomain before reaching the cell surface membrane. However, conflicting evidence also exists. Doedens et al. (33) showed that PMA increases TACE-specific peptide cleavage without altering TACE expression on cell surface membrane at early time points (7–15 min after PMA stimulation), suggesting that the increased activity of TACE is not due to an increase in TACE abundance on the cell surface, but is due to an unknown mechanism that causes TACE activation upon stimulation. In support of this speculation, Milla et al. (34) showed that the prodomain of TACE is essential for appropriate secretion and processing of TACE catalytic domain. Deletion of the prodomain appears to make the catalytic domain a target for intracellular degradation. Zhang et al. (17) showed that a peptide synthesized from TACE prodomain sequence can inhibit the activity of the recombinant active TACE. Moreover, this TACE inhibition can be reversed by treatment with exogenous ROS, implicating ROS in TACE activation. In agreement with this observation, we showed that ROS scavengers (DMTU and nPG) reduced HNE-induced TGF-{alpha} release/TACE activation and the subsequent EGFR activation, implicating ROS in TACE activation by HNE. Thus, we propose that TACE prodomain is cleaved at a furin site in a late Golgi compartment, but the cleaved prodomain is still associated with the catalytic domain via an intramolecular bond between the cysteine residue in the prodomain and the zinc atom in the catalytic domain (17). Processed TACE molecules are transported to their destinations (e.g., the cell surface membranes). Furthermore, we propose that the cysteine-zinc bond breaks upon cellular stimulation. Then the prodomain is released with an immediate exposure of the catalytic domain and TACE-dependent cleavage of substrates takes place. Thus, stimulation with HNE generates ROS (e.g., H2O2), which attack the cysteine sulfhydryl moiety and release it from coordination with the catalytic zinc, thus activating TACE.

ROS have long been known to be generated by NADPH oxidase in inflammatory cells and play a critical role in defending the host against invading microbes and cancer cells (35). ROS have also been found to be produced by noninflammatory cells (e.g., airway epithelial cells) (13, 14). Recent advances in identification of homologues of NADPH oxidase in airway epithelial cells (e.g., dual oxidase-1 and -2 (36, 37)) suggest that ROS generation in airway epithelium is a fine-tuned biological process that could have important physiological functions in addition to host defense against invading microorganisms. Previously, Kohri et al. (12) showed that a 30 min-preincubation of NCI-H292 cells with ROS scavengers (1% DMSO, 50 mM DMTU, and 300 U/ml SOD) followed by a 30-min coincubation with HNE had no inhibitory effects on mucin production in response to NHE. In the present study, we pretreated the cells with ROS scavengers during the whole experimental period (10 h for analysis of MUC5AC gene expression and 24 h for measurement of MUC5AC mucin protein production). ROS scavengers reduced both mucin gene expression and protein production in response to HNE. The disparity between these two studies regarding the role of ROS scavengers in mucin production by HNE may be attributed to the different times of the treatments of the cells with ROS scavengers. To examine whether the reduced mucin expression is caused by increased cell death due to the longer treatments with the scavengers, we measured lactate dehydrogenase activity in the supernatants of the cell cultures and the total protein of the cell lysates. None of these measurements showed significant cytotoxicity for the inhibitors at concentrations used in the present studies (data not shown). Thus, the reduction in HNE-induced mucin expression is due to blockade of the ROS production by the scavengers. We also show that ROS are involved in TACE activation by HNE (Fig. 5A). Because TACE cleaves many cell membrane-bound molecules (e.g., TNF-{alpha}, TGF-{alpha}, L-selectin, and p55 and p75 TNF receptors), the finding of the role of ROS in TACE activation by HNE could have broad implications concerning the understanding of both physiological and pathophysiological processes in cells.

PKC activation has been implicated in mucin induction in human epithelial cells (15, 38, 39, 40). Using PMA as a PKC activator, Hewson et al. (38) showed that PKC isoforms {delta} and {theta} mediate MUC5AC expression by PMA in human airway epithelial NCI-H292 cells. PKC activation and translocation from cytosol to plasma membrane have also been linked to ROS generation in macrophages (19). In the present study, we show that PKC mediates H2O2 production in response to HNE stimulation in NCI-H292 airway epithelial cells. The mechanism of PKC activation by HNE is currently unknown. Because HNE is a large molecule (molecular mass {cong} 29.5 kDa), and because a study showed solely extracellular staining of HNE after prolonged incubation of HNE with airway epithelium (41), it is speculated that HNE exerts its function on cell membrane surface. Further studies to identify a possible HNE receptor or other cell surface molecules are needed to understand fully the actions of HNE.

In summary, we show that stimulation of NCI-H292 airway epithelial cells with HNE activates PKC, which mediates ROS generation, resulting in TACE activation and release of soluble TGF-{alpha}, leading to mucin expression via an EGFR cascade. We also confirmed the role of PKC-ROS-TACE cascade in normal human bronchial epithelial cells. These findings are especially important because HNE is implicated in mucus hypersecretion associated with many chronic inflammatory airway diseases. The discovery that PKC-ROS-TACE is involved in mucin induction by HNE suggests new therapies for hypersecretory airway diseases.


    Acknowledgments
 
We thank Iris F. Ueki for technical assistance and useful discussions, and Drs. John Fahy and Silvio Favoreto (UCSF) for providing assistance in measuring hydrogen peroxide.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This study was supported by private funding. Back

2 Address correspondence and reprint requests to Dr. Jay A. Nadel, Cardiovascular Research Institute, 505 Parnassus Ave., M-1325, Box 0130, University of California San Francisco, San Francisco, CA 94143-0130. E-mail address: janadel{at}itsa.ucsf.edu Back

3 Abbreviations used in this paper: EGFR, epidermal growth factor receptor; HNE, human neutrophil elastase; PKC, protein kinase C; ROS, reactive oxygen species; siRNA, small interfering RNA; TACE, TNF-{alpha} converting enzyme; TAPI-1, TNF-{alpha} protease inhibitor-1; TIP, TACE inhibitory peptide; DMTU, 1,3-dimethyl-2-thiourea; nPG, n-propyl gallete; CC, calphostin C; BIM, bisindolylmaleimide III; NHBE, normal human bronchial epithelial; BEGM, bronchial epithelial growth medium. Back

Received for publication December 15, 2004. Accepted for publication June 2, 2005.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Nadel, J. A.. 2002. Chronic Obstructive Lung Diseases. N. F. Voelkel, and N. F. Mac Neew, eds. Chronic Obstructive Lung Diseases 161. BC Decker Inc., Hamelton.
  2. Hogg, J. C., F. Chu, S. Utokaparch, R. Woods, W. M. Elliott, L. Buzatu, R. M. Cherniack, R. M. Rogers, F. C. Sciurba, H. O. Coxson, P. D. Pare. 2004. The nature of small-airway obstruction in chronic obstructive pulmonary disease. N. Engl. J. Med. 350:2645.-2653. [Abstract/Free Full Text]
  3. Hovenberg, H. W., J. R. Davies, I. Carlstedt. 1996. Different mucins are produced by the surface epithelium and the submucosa in human trachea: identification of MUC5AC as a major mucin from the goblet cells. Biochem J 318:319.-324.
  4. Hovenberg, H. W., J. R. Davies, A. Herrmann, C. J. Linden, I. Carlstedt. 1996. MUC5AC, but not MUC2, is a prominent mucin in respiratory secretions. Glycoconj. J. 13:839.-847. [Medline]
  5. Takeyama, K., K. Dabbagh, H. M. Lee, C. Agusti, J. A. Lausier, I. F. Ueki, K. M. Grattan, J. A. Nadel. 1999. Epidermal growth factor system regulates mucin production in airways. Proc. Natl. Acad. Sci. USA 96:3081.-3086. [Abstract/Free Full Text]
  6. Perrais, M., P. Pigny, M. C. Copin, J. P. Aubert, I. Van Seuningen. 2002. Induction of MUC2 and MUC5AC mucins by factors of the epidermal growth factor (EGF) family is mediated by EGF receptor/Ras/Raf/extracellular signal-regulated kinase cascade and Sp1. J. Biol. Chem. 277:32258.-32267. [Abstract/Free Full Text]
  7. Vandivier, R. W., V. A. Fadok, P. R. Hoffmann, D. L. Bratton, C. Penvari, K. K. Brown, J. D. Brain, F. J. Accurso, P. M. Henson. 2002. Elastase-mediated phosphatidylserine receptor cleavage impairs apoptotic cell clearance in cystic fibrosis and bronchiectasis. J. Clin. Invest. 109:661.-670. [Medline]
  8. Liu, H., S. C. Lazarus, G. H. Caughey, J. V. Fahy. 1999. Neutrophil elastase and elastase-rich cystic fibrosis sputum degranulate human eosinophils in vitro. Am. J. Physiol. 276:L28.-L34.
  9. Breuer, R., T. G. Christensen, E. C. Lucey, P. J. Stone, G. L. Snider. 1987. An ultrastructural morphometric analysis of elastase-treated hamster bronchi shows discharge followed by progressive accumulation of secretory granules. Am. Rev. Respir. Dis. 136:698.-703. [Medline]
  10. Breuer, R., T. G. Christensen, R. M. Niles, P. J. Stone, G. L. Snider. 1989. Human neutrophil elastase causes glycoconjugate release from the epithelial cell surface of hamster trachea in organ culture. Am. Rev. Respir. Dis. 139:779.-782. [Medline]
  11. Voynow, J. A., L. R. Young, Y. Wang, T. Horger, M. C. Rose, B. M. Fischer. 1999. Neutrophil elastase increases MUC5AC mRNA and protein expression in respiratory epithelial cells. Am. J. Physiol. 276:L835.-l843.
  12. Kohri, K., I. F. Ueki, J. A. Nadel. 2002. Neutrophil elastase induces mucin production by ligand-dependent epidermal growth factor receptor activation. Am. J. Physiol. Lung Cell Mol. Physiol. 283:L531.-l540. [Abstract/Free Full Text]
  13. Fischer, B. M., J. A. Voynow. 2002. Neutrophil elastase induces MUC5AC gene expression in airway epithelium via a pathway involving reactive oxygen species. Am. J. Respir. Cell Mol. Biol. 26:447.-452. [Abstract/Free Full Text]
  14. Aoshiba, K., K. Yasuda, S. Yasui, J. Tamaoki, A. Nagai. 2001. Serine proteases increase oxidative stress in lung cells. Am. J. Physiol. Lung Cell Mol. Physiol. 281:L556.-L564. [Abstract/Free Full Text]
  15. Shao, M. X., I. F. Ueki, J. A. Nadel. 2003. Tumor necrosis factor {alpha}-converting enzyme mediates MUC5AC mucin expression in cultured human airway epithelial cells. Proc. Natl. Acad. Sci. USA 100:11618.-11623. [Abstract/Free Full Text]
  16. Shao, M. X., T. Nakanaga, J. A. Nadel. 2004. Cigarette smoke induces MUC5AC mucin overproduction via tumor necrosis factor-{alpha}-converting enzyme in human airway epithelial (NCI-H292) cells. Am. J. Physiol. Lung Cell Mol. Physiol. 287:L420.-L427. [Abstract/Free Full Text]
  17. Zhang, Z., P. Oliver, J. J. Lancaster, P. O. Schwarzenberger, M. S. Joshi, J. Cork, J. K. Kolls. 2001. Reactive oxygen species mediate tumor necrosis factor {alpha}-converting, enzyme-dependent ectodomain shedding induced by phorbol myristate acetate. FASEB J. 15:303.-304. [Free Full Text]
  18. Lemjabbar, H., D. Li, M. Gallup, S. Sidhu, E. Drori, C. Basbaum. 2003. Tobacco smoke-induced lung cell proliferation mediated by tumor necrosis factor {alpha}-converting enzyme and amphiregulin. J. Biol. Chem. 278:26202.-26207. [Abstract/Free Full Text]
  19. Datta, R., K. Yoshinaga, M. Kaneki, P. Pandey, D. Kufe. 2000. Phorbol ester-induced generation of reactive oxygen species is protein kinase C{beta}-dependent and required for SAPK activation. J. Biol. Chem. 275:41000.-41003. [Abstract/Free Full Text]
  20. Wu, R., Y. H. Zhao, M. M. Chang. 1997. Growth and differentiation of conducting airway epithelial cells in culture. Eur. Respir. J. 10:2398.-2403. [Abstract]
  21. Livak, K. J., T. D. Schmittgen. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25:402.-408. [Medline]
  22. Elbashir, S. M., J. Harborth, W. Lendeckel, A. Yalcin, K. Weber, T. Tuschl. 2001. Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 411:494.-498. [Medline]
  23. Harborth, J., S. M. Elbashir, K. Bechert, T. Tuschl, K. Weber. 2001. Identification of essential genes in cultured mammalian cells using small interfering RNAs. J. Cell Sci. 114:4557.-4565.
  24. Roghani, M., J. D. Becherer, M. L. Moss, R. E. Atherton, H. Erdjument-Bromage, J. Arribas, R. K. Blackburn, G. Weskamp, P. Tempst, C. P. Blobel. 1999. Metalloprotease-disintegrin MDC9: intracellular maturation and catalytic activity. J. Biol. Chem. 274:3531.-3540. [Abstract/Free Full Text]
  25. Clark, R. A., B. D. Volpp, K. G. Leidal, W. M. Nauseef. 1990. Two cytosolic components of the human neutrophil respiratory burst oxidase translocate to the plasma membrane during cell activation. J. Clin. Invest. 85:714.-721. [Medline]
  26. Rees, D. D., J. D. Brain. 1995. Effects of cystic fibrosis airway secretions on rat lung: role of neutrophil elastase. Am. J. Physiol. 269:L195.-L202.
  27. Fahmi, A. I., M. Patel, E. B. Stevens, A. L. Fowden, J. E. John, 3rd, K. Lee, R. Pinnock, K. Morgan, A. P. Jackson, J. I. Vandenberg. 2001. The sodium channel {beta}-subunit SCN3b modulates the kinetics of SCN5a and is expressed heterogeneously in sheep heart. J. Physiol. 537:693.-700. [Abstract/Free Full Text]
  28. Mueller, S. G., A. J. Paterson, J. E. Kudlow. 1990. Transforming growth factor {alpha} in arterioles: cell surface processing of its precursor by elastases. Mol. Cell Biol. 10:4596.-4600. [Abstract/Free Full Text]
  29. Ignotz, R. A., B. Kelly, R. J. Davis, J. Massague. 1986. Biologically active precursor for transforming growth factor type {alpha}, released by retrovirally transformed cells. Proc. Natl. Acad. Sci. USA 83:6307.-6311. [Abstract/Free Full Text]
  30. Peschon, J. J., J. L. Slack, P. Reddy, K. L. Stocking, S. W. Sunnarborg, D. C. Lee, W. E. Russell, B. J. Castner, R. S. Johnson, J. N. Fitzner, R. W. Boyce, et al 1998. An essential role for ectodomain shedding in mammalian development. Science 282:1281.-1284. [Abstract/Free Full Text]
  31. Black, R. A., C. T. Rauch, C. J. Kozlosky, J. J. Peschon, J. L. Slack, M. F. Wolfson, B. J. Castner, K. L. Stocking, P. Reddy, S. Srinivasan, et al 1997. A metalloproteinase disintegrin that releases tumour-necrosis factor-{alpha} from cells. Nature 385:729.-733. [Medline]
  32. Schlondorff, J., J. D. Becherer, C. P. Blobel. 2000. Intracellular maturation and localization of the tumour necrosis factor {alpha} convertase (TACE). Biochem. J. 347:131.-138.
  33. Doedens, J. R., R. A. Black. 2000. Stimulation-induced down-regulation of tumor necrosis factor-{alpha} converting enzyme. J. Biol. Chem. 275:14598.-14607. [Abstract/Free Full Text]
  34. Milla, M. E., M. A. Leesnitzer, M. L. Moss, W. C. Clay, H. L. Carter, A. B. Miller, J. L. Su, M. H. Lambert, D. H. Willard, D. M. Sheeley, et al 1999. Specific sequence elements are required for the expression of functional tumor necrosis factor-{alpha}-converting enzyme (TACE). J. Biol. Chem. 274:30563.-30570. [Abstract/Free Full Text]
  35. Babior, B. M.. 1995. The respiratory burst oxidase. Curr. Opin. Hematol. 2:55.-60. [Medline]
  36. Geiszt, M., J. Witta, J. Baffi, K. Lekstrom, T. L. Leto. 2003. Dual oxidases represent novel hydrogen peroxide sources supporting mucosal surface host defense. FASEB J. 17:1502.-1504. [Abstract/Free Full Text]
  37. De Deken, X., D. Wang, M. C. Many, S. Costagliola, F. Libert, G. Vassart, J. E. Dumont, F. Miot. 2000. Cloning of two human thyroid cDNAs encoding new members of the NADPH oxidase family. J. Biol. Chem. 275:23227.-23233. [Abstract/Free Full Text]
  38. Hewson, C. A., M. R. Edbrooke, S. L. Johnston. 2004. PMA induces the MUC5AC respiratory mucin in human bronchial epithelial cells, via PKC, EGF/TGF-{alpha}, Ras/Raf, MEK, ERK and Sp1-dependent mechanisms. J. Mol. Biol. 344:683.-695. [Medline]
  39. Lee, H. W., D. H. Ahn, S. C. Crawley, J. D. Li, J. R. Gum, Jr, C. B. Basbaum, N. Q. Fan, D. E. Szymkowski, S. Y. Han, B. H. Lee, et al 2002. Phorbol 12-myristate 13-acetate up-regulates the transcription of MUC2 intestinal mucin via Ras, ERK, and NF-kappa B. J. Biol. Chem. 277:32624.-32631. [Abstract/Free Full Text]
  40. Shao, M. X., J. A. Nadel. 2005. Dual oxidase 1-dependent MUC5AC mucin expression in cultured human airway epithelial cells. Proc. Natl. Acad. Sci. USA 102:767.-772. [Abstract/Free Full Text]
  41. Christensen, T. G., P. A. Alonso. 1996. Immunocytochemical evidence for extra-cellular initiation of elastase-induced bronchial secretory cell metaplasia in hamsters. Eur. Respir. J. 9:535.-541. [Abstract]



This article has been cited by other articles:


Home page
J. Immunol.Home page
S.-C. Ho, K.-Y. Lee, Y.-F. Chan, L.-W. Kuo, K. Ito, I. M. Adcock, B.-C. Chen, J.-R. Sheu, C.-H. Lin, and H.-P. Kuo
Neutrophil Elastase Represses IL-8/CXCL8 Synthesis in Human Airway Smooth Muscle Cells through Induction of NF-{kappa}B Repressing Factor
J. Immunol., July 1, 2009; 183(1): 411 - 420.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y. Zhou, A. Mohsenin, E. Morschl, H. W. J. Young, J. G. Molina, W. Ma, C.-X. Sun, H. Martinez-Valdez, and M. R. Blackburn
Enhanced Airway Inflammation and Remodeling in Adenosine Deaminase-Deficient Mice Lacking the A2B Adenosine Receptor
J. Immunol., June 15, 2009; 182(12): 8037 - 8046.
[Abstract] [Full Text] [PDF]


Home page
Toxicol PatholHome page
J. G. Wagner, J. R. Harkema, Q. Jiang, B. Illek, B. N. Ames, and D. B. Peden
{gamma}-Tocopherol Attenuates Ozone-induced Exacerbation of Allergic Rhinosinusitis in Rats
Toxicol Pathol, June 1, 2009; 37(4): 481 - 491.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. Finzi, M. X. G. Shao, F. Paye, C. Housset, and J. A. Nadel
Lipopolysaccharide Initiates a Positive Feedback of Epidermal Growth Factor Receptor Signaling by Prostaglandin E2 in Human Biliary Carcinoma Cells
J. Immunol., February 15, 2009; 182(4): 2269 - 2276.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y. Wang, A. H. Herrera, Y. Li, K. K. Belani, and B. Walcheck
Regulation of Mature ADAM17 by Redox Agents for L-Selectin Shedding
J. Immunol., February 15, 2009; 182(4): 2449 - 2457.
[Abstract] [Full Text] [PDF]


Home page
ChestHome page
J. A. Voynow and B. K. Rubin
Mucins, Mucus, and Sputum
Chest, February 1, 2009; 135(2): 505 - 512.
[Abstract] [Full Text] [PDF]


Home page
The Journal of RheumatologyHome page
T. HARA, F. OGAWA, K. YANABA, Y. IWATA, E. MUROI, K. KOMURA, M. TAKENAKA, K. SHIMIZU, M. HASEGAWA, M. FUJIMOTO, et al.
Elevated Serum Concentrations of Polymorphonuclear Neutrophilic Leukocyte Elastase in Systemic Sclerosis: Association with Pulmonary Fibrosis
J Rheumatol, January 1, 2009; 36(1): 99 - 105.
[Abstract] [Full Text] [PDF]


Home page
Eur Respir JHome page
P-R. Burgel and J. A. Nadel
Epidermal growth factor receptor-mediated innate immune responses and their roles in airway diseases
Eur. Respir. J., October 1, 2008; 32(4): 1068 - 1081.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
S. J. Moghaddam, C. G. Clement, M. M. De la Garza, X. Zou, E. L. Travis, H. W. J. Young, C. M. Evans, M. J. Tuvim, and B. F. Dickey
Haemophilus influenzae Lysate Induces Aspects of the Chronic Obstructive Pulmonary Disease Phenotype
Am. J. Respir. Cell Mol. Biol., June 1, 2008; 38(6): 629 - 638.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
C. Pantano, J. L. Ather, J. F. Alcorn, M. E. Poynter, A. L. Brown, A. S. Guala, S. L. Beuschel, G. B. Allen, L. A. Whittaker, M. Bevelander, et al.
Nuclear Factor-{kappa}B Activation in Airway Epithelium Induces Inflammation and Hyperresponsiveness
Am. J. Respir. Crit. Care Med., May 1, 2008; 177(9): 959 - 969.
[Abstract] [Full Text] [PDF]


Home page
Eur Respir JHome page
S. Siddiqui, F. Hollins, S. Saha, and C. E. Brightling
Inflammatory cell microlocalisation and airway dysfunction: cause and effect?
Eur. Respir. J., December 1, 2007; 30(6): 1043 - 1056.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
I. Kuwahara, E. P. Lillehoj, T. Koga, Y. Isohama, T. Miyata, and K. C. Kim
The Signaling Pathway Involved in Neutrophil Elastase Stimulated MUC1 Transcription
Am. J. Respir. Cell Mol. Biol., December 1, 2007; 37(6): 691 - 698.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
D. Y. C. Wu, R. Wu, Y. Chen, N. Tarasova, and M. M. J. Chang
PMA Stimulates MUC5B Gene Expression through an Sp1-Based Mechanism in Airway Epithelial Cells
Am. J. Respir. Cell Mol. Biol., November 1, 2007; 37(5): 589 - 597.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
T. Koga, I. Kuwahara, E. P. Lillehoj, W. Lu, T. Miyata, Y. Isohama, and K. C. Kim
TNF-{alpha} induces MUC1 gene transcription in lung epithelial cells: its signaling pathway and biological implication
Am J Physiol Lung Cell Mol Physiol, September 1, 2007; 293(3): L693 - L701.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
L. H. Abdullah and C. W. Davis
Regulation of airway goblet cell mucin secretion by tyrosine phosphorylation signaling pathways
Am J Physiol Lung Cell Mol Physiol, September 1, 2007; 293(3): L591 - L599.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
T. Nakanaga, J. A. Nadel, I. F. Ueki, J. L. Koff, and M. X. G. Shao
Regulation of interleukin-8 via an airway epithelial signaling cascade
Am J Physiol Lung Cell Mol Physiol, May 1, 2007; 292(5): L1289 - L1296.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
D. Yuan-chen Wu, R. Wu, S. P. Reddy, Y. C. Lee, and M. M.-J. Chang
Distinctive Epidermal Growth Factor Receptor/Extracellular Regulated Kinase-Independent and -Dependent Signaling Pathways in the Induction of Airway Mucin 5B and Mucin 5AC Expression by Phorbol 12-Myristate 13-Acetate
Am. J. Pathol., January 1, 2007; 170(1): 20 - 32.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
I. Kuwahara, E. P. Lillehoj, W. Lu, I. S. Singh, Y. Isohama, T. Miyata, and K. C. Kim
Neutrophil elastase induces IL-8 gene transcription and protein release through p38/NF-{kappa}B activation via EGFR transactivation in a lung epithelial cell line
Am J Physiol Lung Cell Mol Physiol, September 1, 2006; 291(3): L407 - L416.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
F. M. Kouri and O. Eickelberg
Transforming Growth Factor-{alpha}, a Novel Mediator of Strain-Induced Vascular Remodeling
Circ. Res., August 18, 2006; 99(4): 348 - 350.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shao, M. X. G.
Right arrow Articles by Nadel, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shao, M. X. G.
Right arrow Articles by Nadel, J. A.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Substance via MeSH


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS