| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
* Division of Immune Regulation, and
Division of Experimental Medicine, Torrey Pines Institute for Molecular Studies, San Diego, CA 92121;
Autoimmunity and Transplantation Division, The Walter and Eliza Hall Institute, Royal Melbourne Hospital, Parkville, Australia;
Institut National de la Santé et de la Recherche Médicale, Unité 561, Hopital Cochin-Saint Vincent de Paul, Paris, France; and
¶ Diabetes Center, University of California, San Francisco, CA 94143
 |
Abstract |
|---|
 Top Abstract IntroductionGAD-65 T cell determinantsBDC2.5 T cellsMaterials and MethodsResultsDiscussionDisclosuresReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionGAD-65 T cell determinantsBDC2.5 T cellsMaterials and MethodsResultsDiscussionDisclosuresReferences |
|---|
cells, contributes to the recruiting of diabetogenic T cells in the islets. In GAD-65 transgenic mice, it is unlikely that those cryptic and subdominant determinants of GAD-65, which have been considered crucial for the development of autoimmune disease (9), could induce tolerance, although the transgene may greatly increase the expression of GAD-65 in the thymus and the periphery. Finally, although thymic selection depletes many high affinity autoreactive T cells, the peripheral T cell repertoire is strongly biased to recognize Ags similar to self molecules encountered during maturation (10, 11). |
GAD-65 T cell determinants |
|---|
|
TopAbstractIntroductionGAD-65 T cell determinantsBDC2.5 T cellsMaterials and MethodsResultsDiscussionDisclosuresReferences |
|---|
|
BDC2.5 T cells |
|---|
|
TopAbstractIntroductionGAD-65 T cell determinantsBDC2.5 T cellsMaterials and MethodsResultsDiscussionDisclosuresReferences |
|---|
|
Materials and Methods |
|---|
|
TopAbstractIntroductionGAD-65 T cell determinantsBDC2.5 T cellsMaterials and MethodsResultsDiscussionDisclosuresReferences |
|---|
NOD mice were purchased from The Jackson Laboratory and bred for two generations at the Torrey Pines Institute for Molecular Studies. BDC2.5 TCR transgenic mice on a NOD background (BDC/NOD) were provided by Dr. D. Mathis (Harvard University, Boston, MA) and Dr. N. Sarvetnick (The Scripps Institute, San Diego, CA). Screening BDC2.5 TCR transgenes was performed by FACS analysis of peripheral blood samples using anti-CD4 and anti-TCRV4 Abs.
Generation of GAD-65-Fc transgenic mice
A transgenic mouse line overexpressing GAD-65 in B cells was generated by Dr. A. Lehuen (Institut National de la Santé et de la Recherche Médicale, Paris, France). Briefly, mouse GAD-65 cDNA was cloned from a C57BL/6 brain library (Stratagene) using a PCR-generated probe. The cDNA was inserted into the pCD4HG8 plasmid (a gift from K. Karjalainen, Basel, Switzerland). The plasmid contains a mouse Ig
promoter and genomic human Fc
R sequence (Fc). GAD-65 cDNA was inserted into the plasmid between the promoter and Fc sequences. The original stop codon of the GAD-65 cDNA was replaced with a splice donor site by PCR. For generation of GAD-65 transgenic mice, purified GAD-65-Fc plasmids were digested by restriction enzymes to obtain GAD-65-Fc fragments, which were purified by agarose gel electrophoresis for microinjection. Fertilized NOD oocytes injected with GAD-65-Fc fragments were reimplanted into F1(NOD x C57BL/6) foster mothers. The first offspring were screened for the GAD-65-Fc transgene by Southern blotting using the PstI fragment (800 bp) of GAD-65 cDNA as a probe. Subsequent genotyping was performed by PCR, using specific primers for GAD-65 (5' forward, atggtgtttgatgggaagcctc) and the human Fc region (3' reverse, tgtgtgcagggcctgggttag).
Peptides and Ags
GAD-65 peptides p246–266, p524–538, p530–543, and p524–543 were synthesized at the University of California-Los Angeles peptide synthesis laboratory on an Advanced Chemtech 395 synthesizer using F-moc chemistry and were purified by HPLC to >90% purity. GAD-65 peptides p524–539, 525–539, 526–539, 527–539, 528–539, p524–540, p525–540, p526–540, p527–540, p528–540, p524–541, p525–541, p526–541, p527–541, and p528–541 were synthesized at the Torrey Pines Institute for Molecular Studies by the simultaneous multiple peptide method, a tea bag method (24), using Boc chemistry, followed by HPLC to achieve >90% purity. Hen egg white lysozyme (HEL) was purchased from Sigma-Aldrich. BDC2.5 mimotopes 1040-31 (YVRPLWVRME), 1040-79 (AVRPLWVRME), and 1040-51 (RVLPLWVRME) were also synthesized at Torrey Pines Institute for Molecular Studies and used as strong agonists (22).
Immunization and proliferation assays
Various amount of peptides or HEL were emulsified in an equal volume of CFA or IFA (Difco), and injected s.c. at the base of the tail and on the back. Inguinal, axillary, and brachial draining lymph nodes were collected 9–12 days later. Proliferation assays were performed as described previously (25). Briefly, 5 x 105 draining lymph node cells were placed into each well of 96-well, flat-bottom plates together with various concentrations of Ag in 10% FCS complete RPMI 1640 medium, containing 100 U/ml penicillin, 100 µg/ml streptomycin, 2 mM L-glutamine, 10 mM HEPES buffer, and 0.1 mM MEM nonessential amino acids (Invitrogen Life Technologies). After 3 days of culture, [3H]thymidine (International Chemical and Nuclear) was added for another 18–24 h of culture. Cells were harvested with a Micro Cell Harvester (Skatron Instruments), and incorporation of [3H]thymidine was measured on a Wallac MicroBeta Trilux counter (PerkinElmer).
Production of Ag-specific APC and generation of T cell lines
To prepare Ag-primed APC, GAD-65 peptides or HEL were emulsified in CFA or IFA and injected i.p. After 2 wk, the mice were boosted with the same peptide or Ag emulsified in IFA i.p., and spleens were collected 4 wk after the first immunization. After lysing RBC with RBC-lysing buffer (Sigma-Aldrich), splenic APC cells were either purified using MACS beads coated with anti-B220 Ab (Miltenyi Biotec) or irradiated at 3000 rad by a Gammacell 40 irradiator (Atomic Energy). To generate T cell lines, 6- to 8-wk-old female NOD mice were immunized with a GAD-65 peptide emulsified in CFA i.p. After 2 wk, spleens were collected, and single-cell suspensions were prepared. Stimulation and expansion of peptide-specific T cells were conducted in vitro by adding 10 µg/ml peptide(s) in culture for 5 days, followed by a period in culture without Ag but with 25 U/ml rIL-2 (PeproTech). After three cycles of stimulation and resting, >90% of cells were CD4 positive. The specificity of the line was tested by proliferation assay with peptides or control Ags in the presence of irradiated NOD splenocytes. A BDC2.5 T cell line was generated by stimulating naive BDC2.5 splenocytes collected from BDC2.5 TCR transgenic mice with 0.2 µg/ml of the mimotope, m1040-31, for 5 days, followed by culture in complete RPMI 1640 containing 25 U/ml rIL-2 for 1 wk.
FACS
Staining of lymphocytes for surface markers was performed using a 1/100 dilution of respective Abs. Abs specific for mouse CD4, TCRV4, CD44, CD69, and IgG2b were purchased from BD Pharmingen. To detect binding of specific MHC-Ag complexes by BDC2.5 T cells, an I-Ag7-Ig dimer, covalently linked to a BDC2.5 mimotope, m1040-31, was generated by Dr. J. Bluestone and his colleagues (San Francisco, CA) (26). The dimer was visualized by secondary protein G-coupled FITC fluorescence (Sigma-Aldrich). A BDC2.5-specific clonotypic mAb was provided by Dr. O. Kanagawa (Washington University, St. Louis, MO) to stain the BDC2.5 T cells, followed by a secondary anti-IgG2b-FITC Ab.
CFSE-labeled adoptive transfer experiments
For CFSE labeling, 107 cells/ml suspended in RPMI 1640 medium were incubated at 37°C with 5 µM CFSE (Sigma-Aldrich). The labeling reaction was stopped after 10 min by addition of 5% FCS/RPMI 1640 medium, and residual CFSE was removed by washing with RPMI 1640 medium. Transfer experiments were performed by injecting 107 CFSE-labeled cells into the tail vein of irradiated (900 rad) or normal young NOD and GAD-Fc/NOD mice. One week after the transfer injections, the spleen, pancreatic lymph nodes, inguinal lymph nodes, and pancreas were collected to study the distribution and proliferation of the CFSE-labeled cells. Pancreas-infiltrating cells were collected by Ficoll separation after collagenase digestion (0.46 mg/ml) for 15 min at 37°C as previously described (19).
Diabetes
Diabetes development was monitored once a week starting at 12 wk of age by testing the urine glucose level using Chemstrip uG (Roche). Mice with two consecutive measurements >250 mg glucose/dl were considered diabetic.
|
Results |
|---|
|
TopAbstractIntroductionGAD-65 T cell determinantsBDC2.5 T cellsMaterials and MethodsResultsDiscussionDisclosuresReferences |
|---|
The quest to find the native Ag of the well-known diabetogenic T cell clone BDC2.5 (27) remains unsolved, although several strongly agonistic peptides (mimotopes) homologous to a region of the mouse GAD-65 molecule have been recently identified through combinatorial peptide library techniques (22). What is interesting to us is that the mimotopes cover a limited region within a dominant GAD-65 determinant (p524–543), which had been identified a decade ago as one of the earliest diabetes-related T cell determinants in the NOD mouse (1). To test whether p524–543-reactive T cells are cross-reactive to BDC2.5 mimotopes, we generated T cell lines specific for peptide p524–543. Several of the mimotopes have shown activity in stimulating a T cell line specific for p524–543 (Fig. 1A), but no activity for a control, HEL-specific T cell line (data not shown), indicating a possible relationship between the ligands recognized by the p524–543-specific T cells and the BDC2.5 T cells. To directly measure the binding affinity of the mimotopes to p524–543-specific T cells, we used an I-Ag7 Ig dimer covalently linked with one of the mimotopes stimulating BDC2.5 T cells. The I-Ag7 dimer binds strongly to BDC2.5 T cells, as expected, and also exhibits a weak, but consistent, staining of the p524–543-specific T cell line (Fig. 1B), confirming the cross-reactivity of p524–543-specific T cells to the BDC2.5 mimotopes, which was demonstrated in Fig. 1A by T cell activation. However, peptide p524–543 failed in direct activation of BDC2.5 T cells in the presence of syngeneic splenic APC, as tested many times by direct proliferation or cytokine releasing assays (data not shown), suggesting that a low affinity for the peptide/MHC complex might preclude activation of BDC2.5 T cells by p524–543.
|
|
Instead of continuing to search for a possible high affinity ligand of BDC2.5 T cells within p524–543 using synthetic peptides, we took a different approach to study the processing and presentation of a possibly cryptic, high affinity ligand of BDC2.5 T cells within peptide p524–543. Because APC diversity and activity have been shown to be crucial in processing and presentation of cryptic T cell determinants (31), we decided to treat splenic APC with various inflammatory stimuli such as IFN-, anti-CD40, and LPS, asking whether these activated APC cells could stimulate BDC2.5 T cells in the culture. However, none of these activated APC populations could stimulate BDC2.5 T cells after processing of p524–543 (data not shown).
A second pathway for inducing visibility of previously cryptic determinants that we have proposed previously (32) requires Ag processing in Ag-specific B cells. To examine the role of Ag-primed B cells in activation of BDC2.5 T cells, we immunized and boosted NOD mice 2 wk later with the p524–543 peptide, and these peptide-primed splenocytes were then used as APC for activation of BDC2.5 T cells in the presence of p524–543 in culture. Surprisingly, after earlier in vivo priming with p524–543, the NOD splenocytes became efficient in activating the BDC2.5 T cells (Fig. 3A), whereas control splenocytes challenged with a second GAD-65 peptide, p246–66 (p246), or HEL protein were inefficient. A similar result was observed in four separate experiments. These data suggest that p524–543 priming generates an activity within a population of APC, perhaps through special processing, which favors the proliferation of BDC2.5 T cells, although BDC2.5 does not respond to splenic dendritic cells or peritoneal macrophages directly pulsed with p524–543 (data not shown). CFA is not required for generation of this unique APC activity, because splenocytes challenged with p524–543 peptide emulsified in IFA were also sufficient in activating BDC2.5 T cells in the presence of p524–543 peptide (Fig. 3A). Therefore, nonspecific activation of APC, such as macrophages or dendritic cells, may not be responsible; alternatively, we propose that Ag-specific B cells generated by p524–543 priming are the agents for BDC2.5 activation by p524–543. This hypothesis is supported by the observation that magnetically sorted B cells, via the B220 marker, from p524–543-primed, but not p246–66-primed, splenocytes are as good as primed splenocytes in activation of BDC2.5 cells by p524–543 (Fig. 3B). The activation cannot be attributed to an in vitro activation by some contaminated T cells, generated by p524–543 immunization, because 1) in the absence of BDC2.5 T cells, purified B220+ cells or irradiated Ag-primed splenocytes were unresponsive to the p524–543 peptide; and 2) similarly primed B cells specific for a second Ag, e.g., GAD65 p246–266 or HEL, could not present the same priming Ag and p524–543 peptide to activate BDC2.5 T cells.
|
|
To examine whether GAD-65 Ag plays a role in the development and activation of BDC2.5 T cells during the course of diabetes in NOD mice, we generated a double-transgenic mouse line, BDC2.5/GAD-65, by breeding BDC2.5 TCR transgenic mice with a GAD-65 transgenic mouse line in which the GAD-65 transgene was fused to a human IgG-Fc region and driven by an Ig promoter; therefore, transgene overexpression is restricted to B cells. Interestingly, the overexpression of GAD-65 does not seem to affect the development and maturation of BDC2.5 T cells, because the double-transgenic mice exhibit normal development of thymus and spleen, with >80% CD4+ T cells carrying the BDC2.5 TCRBV transgene (TCRBV4), similar to those observed in the BDC2.5 TCR single-transgenic mouse, although we do not know whether the percentage of T cells with a different endogenous TCR 
-chain in the double-transgenic mouse is different from that in the BDC2.5 mouse. There are also no significant differences in total cell number or CD4/CD8 ratios in the spleen. In addition, splenocytes from double-transgenic mice show comparable percentages of T cell subpopulations, such as CD4+CD25+, CD4+CD69+, CD4+CD62L+, and CD4+CD44+, with those in BDC2.5 single-transgenic mice (data not shown). However, when we compared cells isolated from pancreatic lymph nodes or the pancreas from the double-transgenic mice, we found that BDC2.5/GAD-65 mice consistently show a significant decrease in total lymphocyte number in the pancreatic lymph nodes and pancreas at the age of 12–16 wk. Fig. 4A shows one typical example of more than five similar observations. The total cell number in two pancreatic lymph nodes in a 12- to 16-wk-old BDC2.5/GAD-65 mouse is 
106, but in a BDC2.5 mouse of the same age, this value can be 3 times higher. In addition, the percentage of BDC2.5 T cells exhibiting the clonotypic phenotype (stained positively by a clonotypic Ab) also decreased significantly in the pancreases of BDC2.5/GAD-65 mice from 19.6% in the BDC2.5 mouse to 11.6% in the BDC2.5/GAD-65 mouse (Fig. 4B). These data suggest that peripheral overexpression of GAD-65 in B cells can inhibit the infiltration and expansion of BDC2.5 T cells in the pancreas, possibly through a dose-dependent enhancement of self tolerance.
|
The reduced recruitment of BDC2.5 T cells into the pancreas in the BDC2.5/GAD-65 double-transgenic mouse indicates that tolerance might have been induced in BDC2.5 T cells. We were unable to distinguish the BDC2.5 T cells isolated from the double-transgenic or single-transgenic mice by surface markers such as CTLA-4, CD25, CD44, or CD62L. However, it is possible that in the double-transgenic mouse, the T cells could be functionally altered during maturation despite undetectable phenotypic changes. We performed adoptive transfer experiments by injecting CFSE-labeled BDC2.5 T cells separately into either NOD mice or GAD-65 transgenic mice. In this way, we could address the question of whether peripheral tolerance after overexpression of GAD-65 contributes to the reduced recruitment and/or expansion of BDC2.5 in the pancreas of double-transgenic mice. Nonirradiated NOD or GAD-65 transgenic mice (12–16 wk old) were used as recipients in the transfer experiments, so that a competitive normal T cell repertoire was maintained in the recipients. Distribution and expansion of CFSE-labeled BDC2.5 donor cells in the recipient mice were monitored on days 2, 4, and 7 after injection. BDC2.5 cells cannot be activated in the periphery and remain undivided in the spleen and inguinal lymph nodes isolated from both NOD and GAD-65-Fc recipients at the time points that we examined, and there were no significant differences with respect to the percentage and number of donor BDC2.5 cells between the NOD and GAD-65 transgene recipients (data not shown). Interestingly, in the pancreatic lymph nodes, a vigorous division of CFSE-labeled BDC2.5 donor cells occurred; however, only in the NOD recipients (some labeled BDC2.5 cells performed over five divisions on day 7 after transfer), but not in the GAD-65-Fc recipients (Fig. 5). From days 2–7, a steady increase in the percentage of CFSE-positive BDC2.5 cells, including CFSEhigh and CFSElow, in the pancreatic lymph nodes was observed in NOD recipients, whereas this CFSE-positive percentage remained barely changed in the GAD-65-Fc recipients (Fig. 5). This is an important finding that emphasizes a clear relationship between BDC2.5 cells and the GAD65 molecule. The data confirm that the pancreas provides the primary stimulatory signal for recruiting and activating BDC2.5 T cells and indicate that enhanced peripheral tolerance of BDC2.5 T cells by GAD-65 down-regulates this priming process of BDC2.5 T cells in the pancreas.
|
To further explore the tolerance mechanism of BDC2.5 T cells by GAD-65, we examined the proliferative response of naive T cells in lymphopenic recipients. It has been suggested that lymphopenia-induced, homeostatic proliferation might result from a low affinity interaction of T cells with compatible ligands (33). We have demonstrated that BDC2.5, a well-known autoreactive T cell clone, interacts with GAD-65, possibly with a low affinity. How would GAD65 affect BDC2.5 tolerance within a lymphopenic environment? To accomplish this, CFSE-labeled naive BDC2.5 T cells, isolated from BDC2.5 transgenic mice, were transferred into sublethally irradiated (900 rad) NOD or GAD-65-Fc transgenic mice. Three or 5 days later, spleens from recipients were collected to monitor the lymphopenia-induced homeostatic proliferation of the CFSE-labeled cells. We repeatedly observed that the total cell number collected from a GAD-65-Fc recipient was significantly higher than that from a NOD recipient, although an equal number of donor cells was transferred at the outset. More importantly, the percentage of CD4+CFSE+ donor cells in GAD-65-Fc recipients was about twice the number in NOD recipients on days 3 and 5 after transfer (Fig. 6A), whereas the total number of CD4+CFSE– cells, which were most likely the residual recipient’s cells survival from the irradiation, was about equal in the GAD-65-Fc and NOD recipients, suggesting a possibly enhanced homeostatic proliferation of BDC2.5 cells in GAD-65-Fc transgenic mice. In addition, we observed that BDC2.5-like precursor cells increased significantly in GAD-65-Fc transgenic mice, as detected using a BDC2.5-specific clonotypic Ab (data not shown). This increased frequency of a BDC2.5-like population in the GAD-65 transgenic mouse was also confirmed by a proliferation assay in which splenocytes from GAD-65-Fc transgenic NOD mice responded more vigorously to a BDC2.5 mimotope, m1040-31, than cells from NOD mice (Fig. 6B). The data support the idea that overexpression of self Ag in the periphery enhances homeostatic proliferation of autoreactive T cells and reinforce the accumulated evidence presented in this paper, that BDC2.5 T cells can recognize a GAD-65 epitope.
|
|
Discussion |
|---|
|
TopAbstractIntroductionGAD-65 T cell determinantsBDC2.5 T cellsMaterials and MethodsResultsDiscussionDisclosuresReferences |
|---|
However, we were able to activate BDC2.5 T cells using APC cells isolated from mice immunized with p524–543, presumably because p524–543-specific APC might be efficient in processing the p524–543 peptide into a ligand suitable for BDC2.5 recognition. One possible mechanism that might mediate the generation of such a ligand by p524–543-primed APC cells would involve differential protein splicing (34, 35); p524–543 peptides could be spliced and religated by special protein ligases, omitting a few amino acids flanking the spliced small fragments. Interestingly, the best agonist mimotopes of BDC2.5 T cells seem to result from omission of a few amino acids within the p524–543 peptide (Fig. 2). Artificially spliced peptides can lead to new, dominant determinants (36), and it is probable that spliced determinants are often responsible for reactivity in autoimmune and tumor systems (37). A second mechanism could be due to differential Ag processing and presentation after receptor-mediated Ag internalization (38, 39); for example, the receptor could be surface Ig specific for the p524–543 peptide. Not only is enhanced Ag uptake relevant, but also a different protease activity in the specific B cells may play a crucial role in the presentation of a unique self Ag(s) and activation of autoreactive T cells (40, 41). The requirement for additional processing of the 20-mer peptide p524–543 for generation of a suitable ligand for BDC2.5 CD4+ T cells indicates a third mechanism that MHC class I may use through a possible TAP-independent cross-presentation in those Ag-primed APC (42). Finally, an additional mechanism may involve the sharing of the MHC groove by short peptides (43) derived from this region, and rendered highly immunogenic by an altered peptide ligand-type mechanism.
We have clearly shown that GAD-65 does play a role in tolerizing BDC2.5 T cells and preventing their infiltration into pancreatic islets in NOD mice by observing a reduced recruitment and expansion of BDC2.5 T cells in the pancreas of GAD-65 transgenic mice. We could not completely exclude that this reduced infiltration and expansion of BDC2.5 in the pancreas were due to bystander suppression through the induction of regulatory cells after overexpression of GAD-65 in the periphery instead of a direct interaction of GAD-65 with BDC2.5 cells. However, the GAD-65 transgenic mice that we used in this study have a similar susceptibility to diabetes as wild-type NOD mice (Dr. A. Lehuen, unpublished observation), suggesting that overexpression of GAD-65 does not tolerize all diabetogenic T cells. Therefore, the tolerance of BDC2.5 cells observed in this study most likely resulted from a specific interaction of GAD-65 in the periphery. Presumably, in the normal NOD mouse, GAD65 is expressed in thymus and peripheral tissue (44), and BDC2.5 T cells have experienced central and/or peripheral tolerance by interaction with GAD65, whereas overexpression of GAD65 did not change the phenotype of BDC2.5 cells and certainly could not deplete BDC2.5-like cells. In contrast, we observed an increased frequency and activity of BDC2.5-like cells in GAD65 transgenic cells, although their pathogenic activity seems partially damaged. Does enhanced homeostatic proliferation heighten or depress autoimmunity (45)? One possible explanation of our observations could be that the requirements for stimulating homeostatic expansion are different from those for generating pathogenic effectors. Altered Ag processing of GAD65, as proposed in this study in Ag-primed APC, may create a different, high affinity ligand for activation of BDC2.5 cells in the pancreatic lymph nodes and the islets.
Finally, it is not known whether the BDC2.5 clone belongs to the earliest islet-infiltrating T cell family that can initiate a long process of diabetes progression. The BDC2.5 T cell clone can induce severe diabetes in young NOD recipients (46), whereas BDC2.5 TCR transgenic NOD mice are not very susceptible to type 1 diabetes (47). Using the I-Ag7 tetramer loaded with a mimotope of the BDC2.5 clone, several studies have shown that BDC2.5-like cells could be found early in the thymus, the periphery, and the pancreas of NOD mice (48, 49, 50). However, we could not identify a significant clonal expansion of BDC2.5 T cells in NOD islets until a late prediabetic stage of islet infiltration (9–10 wk), as detected by CDR3-length spectroscopy.4 BDC2.5 cells may be recruited to the inflammatory sites after activation of early, high affinity, disease-driving T cells. It needs to be considered that the late, possibly low affinity, interaction exemplified by BDC2.5 T cells with the GAD-65 peptide p524–543 or some other Ags expressed in the islets, attributable to a degeneracy of TCR specificity, may be sufficient to recruit or activate a second or third wave of islet-infiltrating T cells. Whether and how these late infiltrators cause pathology in the pancreas remain unresolved. We have suggested that their delayed reactivity may be related to the difficulty inherent in creating a suitable ligand from a self Ag such as GAD-65.
|
Acknowledgments |
|---|
|
Disclosures |
|---|
|
TopAbstractIntroductionGAD-65 T cell determinantsBDC2.5 T cellsMaterials and MethodsResultsDiscussionDisclosuresReferences |
|---|
|
Footnotes |
|---|
1 This work was supported by National Institutes of Health Grant AI48077 (to E.E.S.) and Juvenile Diabetes Research Foundation Grant 1-2003-707 (to E.E.S.). Y.D.D. is the recipient of Postdoctoral Fellowship Award 3-2004-138 from the Juvenile Diabetes Research Foundation. 
2 Address correspondence and reprint requests to Dr. Eli Sercarz, Division of Immune Regulation, Torrey Pines Institute for Molecular Studies, 3550 General Atomics Court, San Diego, CA 92121. E-mail address: esercarz{at}tpims.org
3 Abbreviations used in this paper: GAD, glutamic acid decarboxylase; HEL, hen egg white lysozyme.
4 A. Quinn, M. McInerney, D. Huffman, B. McInerney, K. Haskins, and E. Sercarz. T cells to a dominant epitope of GAD65 express a public CDR3 motif. Submitted for publication.
Received for publication December 30, 2004. Accepted for publication July 1, 2005.
|
References |
|---|
|
TopAbstractIntroductionGAD-65 T cell determinantsBDC2.5 T cellsMaterials and MethodsResultsDiscussionDisclosuresReferences |
|---|
cells. Science 284:1183.-1187. genes. J. Immunol. 166:2982.-2991. -granule antigen. Diabetes 43:197.-203. [Abstract]
receptor-mediated induction of dendritic cell maturation and major histocompatibility complex class I-restricted antigen presentation after immune complex internalization. J. Exp. Med. 189:371.-380. This article has been cited by other articles:
|
|
 |
|
  C.-Q. Xia, R. Peng, Y. Qiu, M. Annamalai, D. Gordon, and M. J. Clare-Salzler Transfusion of Apoptotic {beta}-Cells Induces Immune Tolerance to {beta}-Cell Antigens and Prevents Type 1 Diabetes in NOD Mice Diabetes, August 1, 2007; 56(8): 2116 - 2123. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. M. Jasinski, L. Yu, M. Nakayama, M. M. Li, M. A. Lipes, G. S. Eisenbarth, and E. Liu Transgenic Insulin (B:9-23) T-Cell Receptor Mice Develop Autoimmune Diabetes Dependent Upon RAG Genotype, H-2g7 Homozygosity, and Insulin 2 Gene Knockout. Diabetes, July 1, 2006; 55(7): 1978 - 1984. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Tian, D. Zekzer, Y. Lu, H. Dang, and D. L. Kaufman B Cells Are Crucial for Determinant Spreading of T Cell Autoimmunity among beta Cell Antigens in Diabetes-Prone Nonobese Diabetic Mice J. Immunol., February 15, 2006; 176(4): 2654 - 2661. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
