|
|
||||||||



* Skirball Institute of Biomedical Research and
Department of Medicine, New York University School of Medicine, New York, NY 10016; and
Department of Pharmaceutics, Rutgers University College of Pharmacy, Piscataway, NJ 08854
| Abstract |
|---|
|
|
|---|
subunit of AP-2 complex and a small interference RNA that is specific for the µ2 subunit of AP-2 complex. We show that both HIV Nef- and SIV Nef-mediated CD4 down-regulations were profoundly blocked by the synergistic effect of Eps15DIII and RNA interference of AP-2 expression. The results demonstrate that HIV/SIV Nef-mediated CD4 down-regulation is AP-2 dependent. We also show that the PMA-induced CD4 down-regulation was blocked by these two inhibitors. Therefore, PMA-induced CD4 down-regulation is also AP-2 dependent. The results demonstrate that, like the tyrosine sorting motif-dependent endocytosis (for which the transferrin receptor and the epidermal growth factor receptor are the two prototypes), dileucine sorting motif-dependent endocytosis of Nef and CD4 are also AP-2 dependent. | Introduction |
|---|
|
|
|---|
CD4 also serves as the primary receptor for HIV to enter cells. In T cells expressing HIV Nef, CD4 is also down-regulated (4). The Nef-mediated CD4 down-regulation correlates with Nef-dependent enhancement of viral pathogenicity (5, 6, 7, 8, 9, 10, 11, 12). Available data indicate that Nef connects CD4 to an AP complex in the absence of CD4 phosphorylation (4) and that the Nef-AP interaction requires the dileucine sorting motif located in the C-terminal portion of the Nef protein (13, 14, 15). As with the PMA-induced CD4 down-regulation, the identity of the AP complex implicated in this tripartite CD4-Nef-AP complex is unclear and remains a matter of debate (16). It has been shown that the colocalization of HIV Nef with the AP-2 complex correlates with Nef-mediated CD4 down-regulation (17). However, yeast two- or three-hybrid studies show that the dileucine motif in HIV Nef interacts mainly with AP-1 and AP-3 and only weakly with AP-2 (18, 19). A GST-tagged HIV Nef binds to AP-1, but not to AP-2 (20).
The term AP complex, or adaptor, generally denotes one of four heterotetrameric protein complexes (AP-1, AP-2, AP-3, and AP-4) (for reviews, see Refs.21 and 22). These AP complexes are essential components of the clathrin-coated vesicles. As their name implies, APs select and link specific cargo molecules to the clathrin molecules, participating in the membrane assembly of clathrin-coated pits. Each AP complex is composed of two large subunits (
and
;
100 kDa), one medium subunit (µ;
50 kDa), and one small (
;
17 kDa) subunit. The prevailing view is that AP-2 mediates endocytosis from the plasma membrane, whereas AP-1, AP-3, and AP-4 participate in the protein sorting from the trans-Golgi network and/or endosomes to lysosomes. Some clathrin-mediated endocytosis requires an additional class of single subunit adaptors (also known as accessory proteins) that bind to the appendage domains of the
or
subunit of APs (e.g., Eps15, epsin,
-arresting, amphiphysin, AP180, and autosomal recessive hypercholesterolemia). Emerging evidence suggests that these accessory proteins assist AP-2 in assembling clathrin-coated pits and selecting cargo molecules (23, 24, 25).
Recently, we reported that PMA-induced serine phosphorylation of CD4 partially reversed Nef-dependent CD4 down-regulation (26). The results suggested that the PMA-induced phosphorylation of CD4 might disrupt the interaction between Nef and CD4, switching CD4s connection from the CD4-Nef-AP complex to a CD4-AP complex. To elucidate the mechanism related to the switching, we examined the adaptor protein complex required for Nef-mediated and PMA-induced CD4 down-regulation, respectively. The results indicated that both required AP-2, probably in the form of an AP-2/Eps15 complex.
| Materials and Methods |
|---|
|
|
|---|
The generation of the CD4 Jurkat T cell line has been described previously (27). The PE-conjugated anti-CD4 mAb (Leu 3a) was purchased from BD Biosciences; mAbs against the
subunit of AP-2, the
subunit of AP-1 and the clathrin H chain, and pAb against actin were obtained from Sigma-Aldrich; and mAb against the µ2 subunit of AP-2 (AP50) was purchased from Transduction Laboratories. Texas Red-conjugated anti-mouse Ab was obtained from Molecular Probes. Plasmid Nef (pNA7)-GFP (HIV) and the bicistronic expression vector containing 239-Nef (SIV) followed by GFP were provided by Dr. J. Skowronski (Cold Spring Harbor Laboratory, Cold Spring Harbor, NY) (28). Plasmids Eps15DIII (GFP tagged) and Eps15d3
2 (GFP tagged) were provided by Dr. A. Benmerah (29). The plasmids encoding wild-type (wt)3 dynamin (Dyn) and the Dyn K44A mutant were provided by Dr. S. L. Schmid (Scripps Research Institute, La Jolla, CA).
Transient expression of cDNA and flow cytometric analysis of CD4 internalization
For transient expression, double CsCl gradient-purified plasmid DNA was electroporated into 107 T cells at 800 µF and 250 V. Sixteen to 20 h after transfection, cells were incubated with PE-conjugated anti-CD4 mAb, Leu 3A (1/100 diluted in PBS) on ice for 45 min. Cells were then subjected to FACS analysis in a FACScan (BD Biosciences). The relative surface CD4 (percentage) is the ratio of the medium CD4 staining of cells transfected with a cDNA to the steady state CD4 staining of nontransfected cells. The results are the average of three independent experiments (mean ± SD).
Immunofluorescence staining of CD4 and confocal microscopy
Cells were incubated with the anti-CD4 mAb (1/100 diluted in PBS) on ice for 30 min. After washing, cells were stained with the Texas Red-conjugated anti-mouse IgG (1/1000) on ice for 15 min and attached to coverslips precoated with 5 mg/ml polylysine in PBS. For attachment, 5 x 105 cells/slip were incubated at room temperature for 1015 min, then fixed with 4% paraformaldehyde at room temperature for 5 min. Confocal microscopy was performed on a Bio-Rad confocal microscopy (MRC-1024) equipped with an A1.4 NA oil immersion objective.
AP-2 knockdown
The target sequence of the AP-2 µ2 small interference RNA (siRNA) was AAGUGGAUGCCUUUCGGGUCA as previously reported (30). The control siRNA used was a firefly luciferase siRNA. T cells were grown in RPMI 1640 culture medium containing 12% FBS and antibiotics. T cells (4 x 107) were resuspended in 1 ml of RPMI 1640 medium/12% FBS without antibiotics, then incubated with 20 µl of siRNA (40 pmol/µl) at room temperature for 20 min. The cells were electroporated in a 0.5-ml volume at 800 µF and 250 V, then incubated at room temperature for an additional 15 min, followed by transfer to RPMI 1640 culture medium containing 12% FBS and antibiotics. Twenty-four hours after the first transfection, cells were spun down and transfected for the second time. At the third transfection, the cells were divided into the required number of aliquots and then incubated with the respective siRNA and the plasmid DNAs together before electroporation.
Immunoblotting analysis
Immunoblotting analysis was performed as previously described (27). Briefly, the control and AP-2 knockdown cells were lysed in 1% Nonidet P-40 lysis buffer and centrifuged at 12,000 rpm for 15 min to remove the debris. The Nonidet P-40 cell lysates were boiled in SDS sample buffer, resolved by reducing SDS-PAGE, transferred to a polyvinylidene difluoride membrane, and then immunoblotted with the respective Abs.
| Results |
|---|
|
|
|---|
In HeLa cells, PMA treatment increased the distribution of exogenous CD4 in clathrin-coated pits (3). To verify that PMA-induced CD4 down-regulation was clathrin dependent, we first tested a GTPase-inactive mutant of Dyn-1 (Dyn K44A) that blocks clathrin-mediated endocytosis (22). GFP was cotransfected as a marker for the expression of wt Dyn or Dyn K44A. Sixteen to 20 h after transfection, cells were treated with PMA and examined by FACS for CD4 internalization (Fig. 1). In mock-transfected CD4 T cells, PMA induced
60% CD4 down-regulation determined by surface CD4 staining (medium fluorescence; Fig. 1a). The coexpression of wt Dyn or Dyn K44A and GFP had no effect on the steady-state surface CD4 level (Fig. 1b, PMA). However, PMA-induced CD4 down-regulation was blocked in cells expressing Dyn K44A (GFP positive) in a K44A dose-dependent manner (Fig. 1b, middle panels, +PMA). CD4 was not internalized by PMA in cells expressing high levels of Dyn K44A and GFP (GFP fluorescence, >80). In contrast, the similar levels of expression of wt Dyn and GFP did not block the PMA-induced CD4 down-regulation (Fig. 1b, top panels). The results support the previous study that suggested that PMA-induced CD4 down-regulation was clathrin mediated (3). We also transfected Dyn K44A into T cells expressing a serine CD4 mutant (Ser408 and Ser414 to Ala; Fig. 1b, bottom panels) that was unable to undergo PMA-induced serine phosphorylation in the CD4 tail (26). Overexpression of Dyn K44A did not alter the cell surface expression of this serine CD4 mutant regardless of the PMA treatment, confirming that Dyn K44A only affects PMA-induced CD4 down-regulation, not the steady-state surface CD4 expression.
|
2 (29), a mutant of Eps15-DIII in which the AP-2 binding region had been removed. The FACS results showed that the expression of GFP-tagged Eps15DIII or GFP-tagged Eps15-d3
2 had no effect on the steady-state surface expression of CD4 (without PMA). However, PMA-induced CD4 down-regulation was blocked in a dose-dependent manner by Eps15DIII. In cells expressing high levels of Eps15DIII (GFP fluorescence, >250), PMA-induced CD4 down-regulation was completely blocked. The negative control, Eps15d3
2, did not show such an effect, and the serine CD4 mutant was also not affected.
The effect of Eps15DIII on PMA-induced CD4 down-regulation was also analyzed by confocal microscopy (Fig. 2). Clathrin-coated pits and vesicles were stained with anti-clathrin or anti-
-adaptin mAbs and appeared as punctate dots in nontransfected cells. These punctate dots were almost completely absent in cells overexpressing Eps15DIII (data not shown). Cells transfected with Eps15DIII or Eps15d3
2 were surface stained with anti-CD4 (mAb) and Texas Red-conjugated anti-mouse Ab, then left untreated or treated with PMA. Without PMA treatment (Fig. 2, a and c), Texas Red-stained CD4 was localized on the T cell surface with some degree of aggregation, as described previously (27). PMA treatment caused the majority of the surface-stained CD4 to move inside the cells (Fig. 2, b and data not shown). This was similarly observed in nontransfected cells and cells expressing Eps15d3
2 (green, Fig. 2b). In contrast, in cells expressing high levels of Eps15DIII (
18% of cells; Fig. 2d), CD4 remained on the cell surface after PMA treatment. This was consistent with the FACS results showing that Eps15DIII blocked PMA-induced CD4 down-regulation, indicating that the down-regulation was clathrin mediated, AP-2 dependent, and involved Eps15.
|
To further prove that the PMA-induced CD4 down-regulation was AP-2 dependent, we knocked down the expression of AP-2 using an AP-2 µ2 subunit-specific siRNA. This siRNA knocked down µ2 expression to an undetectable level in HeLa cells (30). We transfected µ2 siRNA into CD4 T cells two or three times. Western blotting showed an
75% and an
90% decrease in the µ2 amount after two and three electroporations, respectively (Fig. 3a). In agreement with the observation in HeLa cells (30), the amount of
subunit was also decreased, although µ2 siRNA only directly affected the expression of the µ2 subunit. It is possible that AP-2 subunits may have a higher turn off rate without correct assembly. In contrast the amounts of
subunit of AP-1 and actin proteins were not decreased in cells treated with µ2 siRNA.
|
60% down-regulation in control cells, but a significantly diminished down-regulation in the RNAi cells (
45 and
40%, transfected two and three times, respectively). The average CD4 down-regulation was reduced by
20% (also see Fig. 3c). In 35% of the RNAi cells, PMA-induced CD4 down-regulation was blocked by
80% (data not shown). The results also demonstrated that the PMA-induced CD4 down-regulation was AP-2 dependent.
Because Esp15 is an accessory protein in clathrin-mediated endocytosis and because it binds to AP-2 constitutively, Eps15DIII and AP-2 siRNA may work synergistically at the same step in PMA-induced CD4 down-regulation. To test this possibility, we transfected Eps15DIII into control and AP-2 RNAi cells, respectively (Fig. 3c, top panels). The results show that in addition to causing
20% less CD4 down-regulation, siRNA depletion of AP-2 also reduced the requirement for Eps15DIII to block PMA-induced CD4 down-regulation. In RNAi cells, the Eps15DIII fluorescence intensity that completely blocked PMA-induced CD4 down-regulation was only half as much as that in control cells (indicated by arrows). Thus, there was a synergy between Eps15DIII and AP-2, which also proved that the PMA-induced CD4 down-regulation is AP-2 dependent and probably involves an AP-2/Eps15 complex. We also tested whether Dyn K44A and the AP-2 RNAi were synergistic. The results showed that there was no apparent synergy between these two agents (Fig. 3c, bottom panels), suggesting that AP-2 and Dyn-1 work at two distinct steps of the endocytosis pathway.
AP-2 RNAi and the overexpression of Eps15DIII synergistically blocked HIV Nef-mediated CD4 down-regulation
A previous study showed that overexpression of Dyn K44A blocked HIV Nef-mediated CD4 internalization (33). To determine whether HIV Nef-mediated CD4 down-regulation was clathrin mediated and AP-2 dependent, we first determined the effect of the overexpression of Dyn K44A or Eps15DIII on cell surface CD4 levels (Fig. 4a). CD4 T cells were cotransfected with Nef-GFP and wt Dyn, Nef-GFP and Dyn K44A, Nef-GFP and Eps15d3
2, or Nef-GFP and Eps15DIII. Nef-GFP expression resulted in a dose-dependent down-regulation of CD4 with or without coexpression of the other proteins (Fig. 4a). It was somewhat unexpected that the expression of Eps15DIII did not significantly block Nef-mediated CD4 down-regulation, whereas Dyn K44A did. At the cotransfection ratio of 0.53 µg of Nef-GFP to 20 µg of Eps15DIII or to 20 µg of Eps15-d3
2, there was no significant difference in the down-regulation between these two treatments (see also Fig. 4b, control).
|
2, or Nef-GFP plus 20 µg of Eps15DIII were cotransfected. The results indicated that AP-2 RNAi alone did not significantly block Nef-mediated CD4 internalization (RNAi), nor was it blocked when Eps15d3
2 was coexpressed (RNAi+d3
2). However, the combination of the AP-2 RNAi and Eps15DIII profoundly blocked down-regulation (con+DIII), but this was not blocked in control cells expressing Eps15DIII (con+DIII). In RNAi cells transfected with 1 and 3 µg of Nef, the expression of Eps15DIII blocked Nef-mediated CD4 down-regulation by
85 and
60%, respectively. In contrast to the synergistic effects of AP-2 RNAi and Eps15DIII, Fig. 4c shows that the combined use of Dyn K44A and AP-2 RNAi had no synergistic effect on Nef-mediated CD4 down-regulation, again suggesting that Dyn-1 and AP-2 work at two distinct steps of the same endocytosis pathway.
The synergy between Eps15DIII and the AP-2 RNAi was also analyzed by confocal microscopy (Fig. 5). The expression of Nef-GFP (green) significantly reduced the surface CD4 staining (red) in control and AP-2 RNAi-transfected cells (Fig. 5, a and b), as well as in cells expressing Eps15d3
2 (Fig. 5, c and d). However, in
14% of the AP-2 RNAi cells that expressed high levels of Eps15DIII, the surface CD4 level was not significantly reduced (Fig. 5f), showing a blockage of Nef-mediated CD4 down-regulation. In contrast, this was not observed in control cells that expressed a similar (high) level of Eps15DIII (Fig. 5e). The fact that only the combination of Eps15DIII and AP-2 RNAi could block Nef-mediated CD4 down-regulation indicates that the down-regulation is AP-2 dependent and probably AP-2/Eps15 complex dependent.
|
SIV Nef also down-regulates CD4. The binding of SIV Nef to the AP-2 µ2 subunit is stronger than that of HIV Nef (14, 28, 34). Two sorting motifs in SIV Nef (Y28Y39 and L194M195) have been implicated in the SIV Nef-mediated CD4 down-regulation (14, 28). However, a reduction in the binding to AP-2 resulting from mutations in SIV Nef did not correlate with CD4 down-regulation (14, 28, 34). Therefore, an obligatory role of AP-2 in SIV Nef-mediated CD4 down-regulation was brought into question. To resolve this issue, we used the above approach for homologous SIV Nef (Fig. 6). A bicistronic expression vector (28) expressing the SIV Nef (239-Nef) and GFP was transfected into CD4 T cells. As with HIV Nef-mediated CD4 down-regulation, SIV Nef-mediated CD4 down-regulation was profoundly blocked by synergistic effect of the overexpression of Eps15DIII and the µ2 RNAi (RNAi+DIII). There was a minor difference, in that overexpression of Eps15DIII alone moderately blocked SIV Nef-mediated CD4 down-regulation (con+DIII). Therefore, SIV Nef-dependent CD4 down-regulation was also AP-2 dependent and likely to be dependent on the AP-2/Eps15 complex.
|
| Discussion |
|---|
|
|
|---|
It was previously shown that the µ-chain of AP-2 cocrystallized with the peptides containing the tyrosine-sorting motif of TfR and EGFR (35). Another study has shown that synthetic photoreactive peptides containing the dileucine-sorting motif from CD4 and CD3
bound to the
-chain of AP-1 (36). In this study we demonstrate that dileucine sorting motif-based endocytosis of CD4 and HIV Nef is AP-2 dependent. The interaction between the dileucine motif and AP-2 could be indirect, being mediated or assisted by other components of the clathrin endocytic machinery, such as AP-2-binding accessory proteins.
Eps15 has previously been shown to be required for the formation of clathrin-coated pits on membranes (37). The endocytosis of TfR and EGFR was blocked by overexpression of Eps15DIII or intracellular microinjection of an anti-Eps15 Ab (29, 32). Both TfR and EGFR contain a tyrosine sorting motif. In this study, we found that Eps15DIII blocked PMA-induced CD4 down-regulation and, in synergy with AP-2 knockdown by µ2 siRNA, blocked HIV/SIV-Nef-mediated CD4 down-regulation. Nef and CD4 both contain a dileucine sorting motif for endocytosis. Our data thus indicate that Eps15 is also involved in dileucine sorting motif-dependent endocytosis, suggesting that Eps15 is an essential component of the clathrin endocytic machinery that interacts with dileucine sorting motif-containing cargo. It is known that Eps15, through its EH domains, binds to epsin, an accessory protein that interacts with phosphotidylinositol 4,5-bisphosphate on the plasma membrane (for a review, see Ref.23). Thus, the Eps15-epsin interaction may be involved in the recruitment of AP-2 to the membrane for the assembly of clathrin-coated pits. Both Eps15DIII and AP-2 RNAi could deplete a functional Eps15/AP-2 complex, exerting synergistically a negative effect on the assembly of clathrin-coated pits.
It has been suggested that Eps15 may also interact with the cargo molecules targeted for down-regulation. Eps15 was originally identified as a substrate of EGFR protein kinase (38). Recent studies show that the ubiquitin-interacting motif in Eps15 links ubiquitinated EGFR to the AP-2/clathrin complex, facilitating the entry of activated EGFR into clathrin-coated pits (39). Future studies are needed to determine whether Eps15 or other accessory proteins assist AP-2 in interacting with the dileucine sorting motif on cargo molecules.
We have previously shown that PMA treatment resulted in serine phosphorylation in the CD4 tail that disrupted the interaction between CD4 and Nef, allowing recycling of CD4 to the cell surface (26), but it was not clear how CD4 was connected to an AP complex during the endocytic pathway change. In the current study we show that both Nef and the phosphorylated CD4 are connected to the AP-2 complex. The expression of Eps15DIII alone or the knockdown of AP-2 alone blocked PMA-induced CD4 down-regulation, but unless combined, they did not block HIV Nef-mediated CD4 down-regulation. This suggests that the affinity of phosphorylated CD4 for AP-2 is lower than that of HIV Nef for AP-2. The difference in affinity also explains how PMA-induced CD4 phosphorylation that blocks Nef-mediated CD4 endocytosis may result in a net gain of surface CD4 in T cells expressing HIV Nef (26).
Recently, a paper published on-line shows that the decrease in the AP-2-dependent endocytosis impaired SIV Nef, but not HIV-induced, CD4 down-regulation (40). Specifically, Rose et al. (40) found that inhibition by the Eps15 DN mutant caused a modest inhibition of HIV Nef-mediated CD4 down-regulation in both Jurkat and HeLa cells, whereas the Eps15 DN mutant caused an almost complete inhibition of SIV Nef-mediated CD4 down-regulation in HeLa cells. SIV Nef-induced, but not HIV Nef-induced, CD4 down-regulation was blocked or reversed by siRNA depletion of AP-2 in HeLa cells. Similarly, we found that inhibition by the Eps15 DN mutant or by siRNA depletion of AP-2 did not significantly affect HIV Nef-mediated CD4 down-regulation in Jurkat T cells (Figs. 4 and 6). However, when combined, these two AP-2 inhibitors profoundly (up to 85%) blocked both HIV and SIV Nef-mediated CD4 down-regulation (Figs. 46). In contrast, Dyn K44A and AP-2 depletions did not act synergistically. Our studies suggest that it may be necessary to block AP-2-dependent endocytosis by using the combination of DN Eps15 inhibition and siRNA depletion of AP-2. Without using the combination, we also failed to see clear AP-2 dependence of both HIV and SIV Nef-mediated CD4 down-regulation in T cells, which may be the reason for the discrepancy between our conclusion and that of Rose et al. (40).
Finally, it is worth noting that in the absence of PMA or Nef, the overexpression of Dyn K44A or Eps15DIII alone or combined with AP-2 RNAi did not affect the surface levels of CD4. This suggests either a very slow turnover rate or a noninduced, constitutive CD4 endocytosis that is clathrin/AP-2 independent.
| Acknowledgments |
|---|
2-GFP, and Dr. S. L. Schmid for plasmids of wt Dyn and Dyn K44A. | Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported in part by National Institutes of Health Grant 7RO1AI17258 (to S.J.B.) and grants (to Y.-J.J.) from the Association for International Cancer Research (United Kingdom) and from a pilot AIDS funding from New York University. ![]()
2 Address correspondence and reprints requests to Dr. Yong-Jiu Jin, Skirball Institute of Biomedical Research, 540 1st Avenue, Lab 5-1, New York University School of Medicine, New York, NY 10016. E-mail address: jiny{at}saturn.med.nyu.edu ![]()
3 Abbreviations used in this paper: wt, wild type; DN, dominant negative; Dyn, dynamin; EGFR, epidermal growth factor receptor; RNAi, RNA interference; siRNA, small interference RNA; TfR, transferrin receptor. ![]()
Received for publication March 4, 2005. Accepted for publication June 22, 2005.
| References |
|---|
|
|
|---|
-
1 and AP-3
-
3 hemicomplexes. J. Cell Biol. 163:1281.-1290.
-appendage hub during clathrin-coated vesicle endocytosis. EMBO J. 23:4371.-4383. [Medline]
chain of AP-1 at a site distinct and regulated differently from the tyrosine-based motif-binding site. EMBO J. 17:2148.-2155. [Medline]
This article has been cited by other articles:
![]() |
N. Laguette, C. Bregnard, J. Bouchet, A. Benmerah, S. Benichou, and S. Basmaciogullari Nef-Induced CD4 Endocytosis in Human Immunodeficiency Virus Type 1 Host Cells: Role of p56lck Kinase J. Virol., July 15, 2009; 83(14): 7117 - 7128. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. L. P. daSilva, R. Sougrat, P. V. Burgos, K. Janvier, R. Mattera, and J. S. Bonifacino Human Immunodeficiency Virus Type 1 Nef Protein Targets CD4 to the Multivesicular Body Pathway J. Virol., July 1, 2009; 83(13): 6578 - 6590. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Chaudhuri, R. Mattera, O. W. Lindwasser, M. S. Robinson, and J. S. Bonifacino A Basic Patch on {alpha}-Adaptin Is Required for Binding of Human Immunodeficiency Virus Type 1 Nef and Cooperative Assembly of a CD4-Nef-AP-2 Complex J. Virol., March 15, 2009; 83(6): 2518 - 2530. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-J. Jin, C. Y. Cai, X. Zhang, and S. J. Burakoff Lysine 144, a Ubiquitin Attachment Site in HIV-1 Nef, Is Required for Nef-Mediated CD4 Down-Regulation J. Immunol., June 15, 2008; 180(12): 7878 - 7886. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. W. Lindwasser, W. J. Smith, R. Chaudhuri, P. Yang, J. H. Hurley, and J. S. Bonifacino A Diacidic Motif in Human Immunodeficiency Virus Type 1 Nef Is a Novel Determinant of Binding to AP-2 J. Virol., February 1, 2008; 82(3): 1166 - 1174. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Hubner, P. Chen, A. D. Portillo, Y. Liu, R. E. Gordon, and B. K. Chen Sequence of Human Immunodeficiency Virus Type 1 (HIV-1) Gag Localization and Oligomerization Monitored with Live Confocal Imaging of a Replication-Competent, Fluorescently Tagged HIV-1 J. Virol., November 15, 2007; 81(22): 12596 - 12607. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Chaudhuri, O. W. Lindwasser, W. J. Smith, J. H. Hurley, and J. S. Bonifacino Downregulation of CD4 by Human Immunodeficiency Virus Type 1 Nef Is Dependent on Clathrin and Involves Direct Interaction of Nef with the AP2 Clathrin Adaptor J. Virol., April 15, 2007; 81(8): 3877 - 3890. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Loomis, R. J. Courtney, and J. W. Wills Packaging Determinants in the UL11 Tegument Protein of Herpes Simplex Virus Type 1 J. Virol., November 1, 2006; 80(21): 10534 - 10541. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. F. Roeth and K. L. Collins Human Immunodeficiency Virus Type 1 Nef: Adapting to Intracellular Trafficking Pathways Microbiol. Mol. Biol. Rev., June 1, 2006; 70(2): 548 - 563. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |