HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) A correction has been published Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Jin, Y.-J. Articles by Burakoff, S. J. Search for Related Content PubMed PubMed Citation Articles by Jin, Y.-J. Articles by Burakoff, S. J.

HIV Nef-Mediated CD4 Down-Regulation Is Adaptor Protein Complex 2 Dependent¹

Yong-Jiu Jin^2,*,, Catherine Yi Cai^*, Xiaoping Zhang, Hui-Tang Zhang^*, John A. Hirst^* and Steven J. Burakoff^*,

^* Skirball Institute of Biomedical Research and Department of Medicine, New York University School of Medicine, New York, NY 10016; and Department of Pharmaceutics, Rutgers University College of Pharmacy, Piscataway, NJ 08854

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
Nef is a crucial viral protein for HIV to replicate at high titers and in the development of AIDS. One Nef function is down-regulating CD4 from the cell surface, which correlates with Nef-enhanced viral pathogenicity. Nef down-regulates CD4 by linking CD4 to clathrin-coated pits. However, the mechanistic connection between the C-terminal dileucine motif of Nef and the component(s) of the clathrin-coated pits has not been pinpointed. In this report we used two AP-2 complex-specific inhibitors: a dominant negative mutant of Eps15 (Eps15DIII) that binds to the subunit of AP-2 complex and a small interference RNA that is specific for the µ2 subunit of AP-2 complex. We show that both HIV Nef- and SIV Nef-mediated CD4 down-regulations were profoundly blocked by the synergistic effect of Eps15DIII and RNA interference of AP-2 expression. The results demonstrate that HIV/SIV Nef-mediated CD4 down-regulation is AP-2 dependent. We also show that the PMA-induced CD4 down-regulation was blocked by these two inhibitors. Therefore, PMA-induced CD4 down-regulation is also AP-2 dependent. The results demonstrate that, like the tyrosine sorting motif-dependent endocytosis (for which the transferrin receptor and the epidermal growth factor receptor are the two prototypes), dileucine sorting motif-dependent endocytosis of Nef and CD4 are also AP-2 dependent.

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
An integral membrane protein, CD4 is expressed primarily on the surface of Th cells and cells of the monocyte/macrophage lineage. In T cells the protein functions as a coreceptor of TCR, participating in T cell activation. In these cells, PMA can induce serine phosphorylation in the cytoplasmic tail of CD4 that triggers the down-regulation of CD4 from the cell surface (1, 2). Upon PMA treatment, CD4 becomes localized in clathrin-coated pits, suggesting that the down-regulation is a clathrin-mediated endocytosis process (3). The CD4 tail contains a dileucine sorting motif required for PMA-induced CD4 down-regulation (2). However, the specific component(s) of the clathrin endocytic machinery that interacts with the dileucine sorting motif has yet to be identified.

CD4 also serves as the primary receptor for HIV to enter cells. In T cells expressing HIV Nef, CD4 is also down-regulated (4). The Nef-mediated CD4 down-regulation correlates with Nef-dependent enhancement of viral pathogenicity (5, 6, 7, 8, 9, 10, 11, 12). Available data indicate that Nef connects CD4 to an AP complex in the absence of CD4 phosphorylation (4) and that the Nef-AP interaction requires the dileucine sorting motif located in the C-terminal portion of the Nef protein (13, 14, 15). As with the PMA-induced CD4 down-regulation, the identity of the AP complex implicated in this tripartite CD4-Nef-AP complex is unclear and remains a matter of debate (16). It has been shown that the colocalization of HIV Nef with the AP-2 complex correlates with Nef-mediated CD4 down-regulation (17). However, yeast two- or three-hybrid studies show that the dileucine motif in HIV Nef interacts mainly with AP-1 and AP-3 and only weakly with AP-2 (18, 19). A GST-tagged HIV Nef binds to AP-1, but not to AP-2 (20).

The term AP complex, or adaptor, generally denotes one of four heterotetrameric protein complexes (AP-1, AP-2, AP-3, and AP-4) (for reviews, see Refs.21 and 22). These AP complexes are essential components of the clathrin-coated vesicles. As their name implies, APs select and link specific cargo molecules to the clathrin molecules, participating in the membrane assembly of clathrin-coated pits. Each AP complex is composed of two large subunits ( and ; 100 kDa), one medium subunit (µ; 50 kDa), and one small (; 17 kDa) subunit. The prevailing view is that AP-2 mediates endocytosis from the plasma membrane, whereas AP-1, AP-3, and AP-4 participate in the protein sorting from the trans-Golgi network and/or endosomes to lysosomes. Some clathrin-mediated endocytosis requires an additional class of single subunit adaptors (also known as accessory proteins) that bind to the appendage domains of the or subunit of APs (e.g., Eps15, epsin, -arresting, amphiphysin, AP180, and autosomal recessive hypercholesterolemia). Emerging evidence suggests that these accessory proteins assist AP-2 in assembling clathrin-coated pits and selecting cargo molecules (23, 24, 25).

Recently, we reported that PMA-induced serine phosphorylation of CD4 partially reversed Nef-dependent CD4 down-regulation (26). The results suggested that the PMA-induced phosphorylation of CD4 might disrupt the interaction between Nef and CD4, switching CD4’s connection from the CD4-Nef-AP complex to a CD4-AP complex. To elucidate the mechanism related to the switching, we examined the adaptor protein complex required for Nef-mediated and PMA-induced CD4 down-regulation, respectively. The results indicated that both required AP-2, probably in the form of an AP-2/Eps15 complex.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
CD4 T cell lines, Abs, and plasmids

The generation of the CD4 Jurkat T cell line has been described previously (27). The PE-conjugated anti-CD4 mAb (Leu 3a) was purchased from BD Biosciences; mAbs against the subunit of AP-2, the subunit of AP-1 and the clathrin H chain, and pAb against actin were obtained from Sigma-Aldrich; and mAb against the µ2 subunit of AP-2 (AP50) was purchased from Transduction Laboratories. Texas Red-conjugated anti-mouse Ab was obtained from Molecular Probes. Plasmid Nef (pNA7)-GFP (HIV) and the bicistronic expression vector containing 239-Nef (SIV) followed by GFP were provided by Dr. J. Skowronski (Cold Spring Harbor Laboratory, Cold Spring Harbor, NY) (28). Plasmids Eps15DIII (GFP tagged) and Eps15d32 (GFP tagged) were provided by Dr. A. Benmerah (29). The plasmids encoding wild-type (wt)³ dynamin (Dyn) and the Dyn K44A mutant were provided by Dr. S. L. Schmid (Scripps Research Institute, La Jolla, CA).

Transient expression of cDNA and flow cytometric analysis of CD4 internalization

For transient expression, double CsCl gradient-purified plasmid DNA was electroporated into 10⁷ T cells at 800 µF and 250 V. Sixteen to 20 h after transfection, cells were incubated with PE-conjugated anti-CD4 mAb, Leu 3A (1/100 diluted in PBS) on ice for 45 min. Cells were then subjected to FACS analysis in a FACScan (BD Biosciences). The relative surface CD4 (percentage) is the ratio of the medium CD4 staining of cells transfected with a cDNA to the steady state CD4 staining of nontransfected cells. The results are the average of three independent experiments (mean ± SD).

Immunofluorescence staining of CD4 and confocal microscopy

Cells were incubated with the anti-CD4 mAb (1/100 diluted in PBS) on ice for 30 min. After washing, cells were stained with the Texas Red-conjugated anti-mouse IgG (1/1000) on ice for 15 min and attached to coverslips precoated with 5 mg/ml polylysine in PBS. For attachment, 5 x 10⁵ cells/slip were incubated at room temperature for 10–15 min, then fixed with 4% paraformaldehyde at room temperature for 5 min. Confocal microscopy was performed on a Bio-Rad confocal microscopy (MRC-1024) equipped with an A1.4 NA oil immersion objective.

AP-2 knockdown

The target sequence of the AP-2 µ2 small interference RNA (siRNA) was AAGUGGAUGCCUUUCGGGUCA as previously reported (30). The control siRNA used was a firefly luciferase siRNA. T cells were grown in RPMI 1640 culture medium containing 12% FBS and antibiotics. T cells (4 x 10⁷) were resuspended in 1 ml of RPMI 1640 medium/12% FBS without antibiotics, then incubated with 20 µl of siRNA (40 pmol/µl) at room temperature for 20 min. The cells were electroporated in a 0.5-ml volume at 800 µF and 250 V, then incubated at room temperature for an additional 15 min, followed by transfer to RPMI 1640 culture medium containing 12% FBS and antibiotics. Twenty-four hours after the first transfection, cells were spun down and transfected for the second time. At the third transfection, the cells were divided into the required number of aliquots and then incubated with the respective siRNA and the plasmid DNAs together before electroporation.

Immunoblotting analysis

Immunoblotting analysis was performed as previously described (27). Briefly, the control and AP-2 knockdown cells were lysed in 1% Nonidet P-40 lysis buffer and centrifuged at 12,000 rpm for 15 min to remove the debris. The Nonidet P-40 cell lysates were boiled in SDS sample buffer, resolved by reducing SDS-PAGE, transferred to a polyvinylidene difluoride membrane, and then immunoblotted with the respective Abs.

	Results

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
Overexpression of the K44A mutant of Dyn-1 (Dyn K44A) or the Eps15 DIII mutant (Eps15 DIII) blocked PMA-induced CD4 down-regulation in T cells

In HeLa cells, PMA treatment increased the distribution of exogenous CD4 in clathrin-coated pits (3). To verify that PMA-induced CD4 down-regulation was clathrin dependent, we first tested a GTPase-inactive mutant of Dyn-1 (Dyn K44A) that blocks clathrin-mediated endocytosis (22). GFP was cotransfected as a marker for the expression of wt Dyn or Dyn K44A. Sixteen to 20 h after transfection, cells were treated with PMA and examined by FACS for CD4 internalization (Fig. 1). In mock-transfected CD4 T cells, PMA induced 60% CD4 down-regulation determined by surface CD4 staining (medium fluorescence; Fig. 1a). The coexpression of wt Dyn or Dyn K44A and GFP had no effect on the steady-state surface CD4 level (Fig. 1b, –PMA). However, PMA-induced CD4 down-regulation was blocked in cells expressing Dyn K44A (GFP positive) in a K44A dose-dependent manner (Fig. 1b, middle panels, +PMA). CD4 was not internalized by PMA in cells expressing high levels of Dyn K44A and GFP (GFP fluorescence, >80). In contrast, the similar levels of expression of wt Dyn and GFP did not block the PMA-induced CD4 down-regulation (Fig. 1b, top panels). The results support the previous study that suggested that PMA-induced CD4 down-regulation was clathrin mediated (3). We also transfected Dyn K44A into T cells expressing a serine CD4 mutant (Ser⁴⁰⁸ and Ser⁴¹⁴ to Ala; Fig. 1b, bottom panels) that was unable to undergo PMA-induced serine phosphorylation in the CD4 tail (26). Overexpression of Dyn K44A did not alter the cell surface expression of this serine CD4 mutant regardless of the PMA treatment, confirming that Dyn K44A only affects PMA-induced CD4 down-regulation, not the steady-state surface CD4 expression.

View larger version (55K): [in this window] [in a new window]   FIGURE 1. PMA-induced CD4 internalization was blocked by the overexpression of DynK44A or Eps15DIII. Jurkat T cells expressing wt CD4 or serine CD4 mutant (ser CD4) were transfected with respective plasmids for 16 h, followed by PMA treatment. Cells were then stained with the PE-conjugated anti-CD4 mAb. a, FACS analysis of PMA-induced wt CD4 internalization in mock-transfected CD4 T cells. In the bottom panel, the log scale of surface CD4 staining (medium fluorescence) has been converted to a linear scale. b, Effects of DynK44A on PMA-induced CD4 internalization. The top and middle panels show wt CD4 T cells transfected with 20 µg of wt Dyn or Dyn K44A. The bottom panel shows ser CD4 T cells transfected with Dyn K44A. GFP plasmid (5 µg) was cotransfected with the above DNAs as a marker for wt Dyn or Dyn K44A expression. The GFP-positive cells (FL-1, >10) express the plasmid DNA. c, Effects of Eps15DIII on PMA-induced CD4 internalization. The top and middle panels show wt CD4 T cells transfected with 20 µg of Eps15d32 (GFP-tagged) or Eps15DIII (GFP tagged). The bottom panel shows ser CD4 T cells transfected with 20 µg of Eps15DIII (GFP tagged).

The effect of Eps15DIII on PMA-induced CD4 down-regulation was also analyzed by confocal microscopy (Fig. 2). Clathrin-coated pits and vesicles were stained with anti-clathrin or anti--adaptin mAbs and appeared as punctate dots in nontransfected cells. These punctate dots were almost completely absent in cells overexpressing Eps15DIII (data not shown). Cells transfected with Eps15DIII or Eps15d32 were surface stained with anti-CD4 (mAb) and Texas Red-conjugated anti-mouse Ab, then left untreated or treated with PMA. Without PMA treatment (Fig. 2, a and c), Texas Red-stained CD4 was localized on the T cell surface with some degree of aggregation, as described previously (27). PMA treatment caused the majority of the surface-stained CD4 to move inside the cells (Fig. 2, b and data not shown). This was similarly observed in nontransfected cells and cells expressing Eps15d32 (green, Fig. 2b). In contrast, in cells expressing high levels of Eps15DIII (18% of cells; Fig. 2d), CD4 remained on the cell surface after PMA treatment. This was consistent with the FACS results showing that Eps15DIII blocked PMA-induced CD4 down-regulation, indicating that the down-regulation was clathrin mediated, AP-2 dependent, and involved Eps15.

View larger version (22K): [in this window] [in a new window]   FIGURE 2. Subcellular distribution of wt CD4 in PMA-treated Jurkat T cells transfected with different plasmids. Cells were transfected with Eps15d32 (GFP tagged; a and b) or Eps15DIII-GFP (c and d) for 16 h. After an anti-CD4 staining (red), cells were left untreated (a and c) or were treated (b and d) with PMA. Cells were then attached to coverslips for confocal microscopy. Shown are confocal slices just below the half-height of the cells.

To further prove that the PMA-induced CD4 down-regulation was AP-2 dependent, we knocked down the expression of AP-2 using an AP-2 µ2 subunit-specific siRNA. This siRNA knocked down µ2 expression to an undetectable level in HeLa cells (30). We transfected µ2 siRNA into CD4 T cells two or three times. Western blotting showed an 75% and an 90% decrease in the µ2 amount after two and three electroporations, respectively (Fig. 3a). In agreement with the observation in HeLa cells (30), the amount of subunit was also decreased, although µ2 siRNA only directly affected the expression of the µ2 subunit. It is possible that AP-2 subunits may have a higher turn off rate without correct assembly. In contrast the amounts of subunit of AP-1 and actin proteins were not decreased in cells treated with µ2 siRNA.

View larger version (38K): [in this window] [in a new window]   FIGURE 3. AP-2 RNAi blocked PMA-induced CD4 down-regulation. Jurkat T cells were transfected with µ2-specific siRNA or control (luciferase) siRNA twice (total of 36 h in culture) or three times (total of 60 h in culture). GFP (5 µg) was cotransfected at the last transfection. Half the cells were then harvested and analyzed by Western blotting; the rest were subjected to PMA-induced CD4 internalization as described in Fig. 1. a, Western blot analysis of AP-2 and µ2 subunits, AP-1 subunit, and actin. Equal amounts of cellular proteins from control and AP-2 knockdown cells were resolved in 10% SDS-PAGE, transferred to a polyvinylidene difluoride membrane, and probed with the mAbs against AP-2 subunit, µ2 subunit, AP-1 subunit, and actin, respectively. b, Surface CD4 expression (medium CD4 staining) in control and AP-2 knockdown cells treated with PMA. The percentage is relative to that in untreated cells. Cells were transfected with control or µ2-specific siRNA twice (36 h) or three times (60 h). c, Synergistic effect of AP-2 RNAi and overexpression of Eps15DIII on PMA-induced CD4 down-regulation and the lack of synergy between AP-2 RNAi and Dyn K44A. Jurkat T cells were transfected first with µ2 siRNA twice at a 24-h interval. At the second transfection, 20 µg of the Eps15DIII (GFP tagged) or 15 µg of DynK44A plus 5 µg of GFP were cotransfected. PMA-induced CD4 internalization was determined 16 h after the second transfection. The arrows indicate the regions where CD4 internalization was blocked.

Because Esp15 is an accessory protein in clathrin-mediated endocytosis and because it binds to AP-2 constitutively, Eps15DIII and AP-2 siRNA may work synergistically at the same step in PMA-induced CD4 down-regulation. To test this possibility, we transfected Eps15DIII into control and AP-2 RNAi cells, respectively (Fig. 3c, top panels). The results show that in addition to causing 20% less CD4 down-regulation, siRNA depletion of AP-2 also reduced the requirement for Eps15DIII to block PMA-induced CD4 down-regulation. In RNAi cells, the Eps15DIII fluorescence intensity that completely blocked PMA-induced CD4 down-regulation was only half as much as that in control cells (indicated by arrows). Thus, there was a synergy between Eps15DIII and AP-2, which also proved that the PMA-induced CD4 down-regulation is AP-2 dependent and probably involves an AP-2/Eps15 complex. We also tested whether Dyn K44A and the AP-2 RNAi were synergistic. The results showed that there was no apparent synergy between these two agents (Fig. 3c, bottom panels), suggesting that AP-2 and Dyn-1 work at two distinct steps of the endocytosis pathway.

AP-2 RNAi and the overexpression of Eps15DIII synergistically blocked HIV Nef-mediated CD4 down-regulation

A previous study showed that overexpression of Dyn K44A blocked HIV Nef-mediated CD4 internalization (33). To determine whether HIV Nef-mediated CD4 down-regulation was clathrin mediated and AP-2 dependent, we first determined the effect of the overexpression of Dyn K44A or Eps15DIII on cell surface CD4 levels (Fig. 4a). CD4 T cells were cotransfected with Nef-GFP and wt Dyn, Nef-GFP and Dyn K44A, Nef-GFP and Eps15d32, or Nef-GFP and Eps15DIII. Nef-GFP expression resulted in a dose-dependent down-regulation of CD4 with or without coexpression of the other proteins (Fig. 4a). It was somewhat unexpected that the expression of Eps15DIII did not significantly block Nef-mediated CD4 down-regulation, whereas Dyn K44A did. At the cotransfection ratio of 0.5–3 µg of Nef-GFP to 20 µg of Eps15DIII or to 20 µg of Eps15-d32, there was no significant difference in the down-regulation between these two treatments (see also Fig. 4b, control).

View larger version (61K): [in this window] [in a new window]   FIGURE 4. AP-2 RNAi and the overexpression of Eps15DIII synergistically blocked HIV Nef-mediated CD4 down-regulation. a, Nef-mediated CD4 down-regulation was blocked by overexpression of Dyn K44A, but was not significantly blocked by overexpression of Eps15 DIII alone. Nef-GFP (0.5–3 µg) was cotransfected into cells along with 20 µg of Eps15d32 (GFP tagged; d32), Eps15DIII (GFP tagged; DIII), wt Dyn, or Dyn K44A (K44A), respectively. Cell surface CD4 levels were determined by FACS. The percentage is the ratio of the medium CD4 staining in cells expressing high level of GFP (fluorescence, >100 in d32 and DIII, or >30 in wt Dyn and K44A) to that in GFP-negative cells (fluorescence, <10; note that Nef-GFP made a minor contribution to the total green fluorescence). Each value was the average of three independent experiments (mean ± SD). b, AP-2 RNAi and Eps15DIII synergistically blocked Nef-mediated CD4 down-regulation. Cells were transfected with control (con) or µ2 siRNA (RNA) three times at 24-h intervals. At the third transfection, 0–3 µg of Nef-GFP and 20 µg of Eps15DIII (GFP tagged) or Eps15d32 (GFP tagged) were cotransfected. FACS analysis was performed 16 h after transfection. c, AP-2 RNAi and Dyn K44A were not synergistic in blocking Nef-mediated CD4 down-regulation. Both control and AP-2 (µ2) RNAi cells were transfected with 20 µg of Eps15DIII (GFP-tagged) in DIII, 15 µg of Dyn K44A plus 5 µg of GFP in K44A, or 5 µg of GFP in None along with 1 µg of Nef-GFP in None. The percentage was the ratio of FACS data, as described in a.

The synergy between Eps15DIII and the AP-2 RNAi was also analyzed by confocal microscopy (Fig. 5). The expression of Nef-GFP (green) significantly reduced the surface CD4 staining (red) in control and AP-2 RNAi-transfected cells (Fig. 5, a and b), as well as in cells expressing Eps15d32 (Fig. 5, c and d). However, in 14% of the AP-2 RNAi cells that expressed high levels of Eps15DIII, the surface CD4 level was not significantly reduced (Fig. 5f), showing a blockage of Nef-mediated CD4 down-regulation. In contrast, this was not observed in control cells that expressed a similar (high) level of Eps15DIII (Fig. 5e). The fact that only the combination of Eps15DIII and AP-2 RNAi could block Nef-mediated CD4 down-regulation indicates that the down-regulation is AP-2 dependent and probably AP-2/Eps15 complex dependent.

View larger version (27K): [in this window] [in a new window]   FIGURE 5. Subcellular distribution of CD4 in AP-2 RNAi cells. The cotransfection of µ2 siRNA with Eps15d32 (GFP tagged; c and d) or with Eps15DIII (GFP tagged; e and f) was described in Fig. 4. Cells were stained with anti-CD4 mAb (red) and attached to coverslips for confocal microscopy. The f1 (CD4), f2 (GFP), and f3 (merged) are the two nonmerged images and the merged image of the same cells, which were treated in the same way as the cells in f.

SIV Nef also down-regulates CD4. The binding of SIV Nef to the AP-2 µ2 subunit is stronger than that of HIV Nef (14, 28, 34). Two sorting motifs in SIV Nef (Y28Y39 and L194M195) have been implicated in the SIV Nef-mediated CD4 down-regulation (14, 28). However, a reduction in the binding to AP-2 resulting from mutations in SIV Nef did not correlate with CD4 down-regulation (14, 28, 34). Therefore, an obligatory role of AP-2 in SIV Nef-mediated CD4 down-regulation was brought into question. To resolve this issue, we used the above approach for homologous SIV Nef (Fig. 6). A bicistronic expression vector (28) expressing the SIV Nef (239-Nef) and GFP was transfected into CD4 T cells. As with HIV Nef-mediated CD4 down-regulation, SIV Nef-mediated CD4 down-regulation was profoundly blocked by synergistic effect of the overexpression of Eps15DIII and the µ2 RNAi (RNAi+DIII). There was a minor difference, in that overexpression of Eps15DIII alone moderately blocked SIV Nef-mediated CD4 down-regulation (con+DIII). Therefore, SIV Nef-dependent CD4 down-regulation was also AP-2 dependent and likely to be dependent on the AP-2/Eps15 complex.

View larger version (52K): [in this window] [in a new window]   FIGURE 6. AP-2 RNAi and overexpression of Eps15DIII synergistically blocked SIV-Nef-mediated CD4 down-regulation. The procedures were essentially the same as described in Fig. 4, except that SIV Nef replaced HIV Nef-GFP. a, FACS analysis showed that AP-2 RNAi and Eps15DIII synergistically (RNAi+DIII) blocked SIV-Nef-mediated CD4 down-regulation. b, AP-2 RNAi and Dyn K44A were not synergistic in blocking SIV-Nef-mediated CD4 down-regulation.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

It was previously shown that the µ-chain of AP-2 cocrystallized with the peptides containing the tyrosine-sorting motif of TfR and EGFR (35). Another study has shown that synthetic photoreactive peptides containing the dileucine-sorting motif from CD4 and CD3 bound to the -chain of AP-1 (36). In this study we demonstrate that dileucine sorting motif-based endocytosis of CD4 and HIV Nef is AP-2 dependent. The interaction between the dileucine motif and AP-2 could be indirect, being mediated or assisted by other components of the clathrin endocytic machinery, such as AP-2-binding accessory proteins.

Eps15 has previously been shown to be required for the formation of clathrin-coated pits on membranes (37). The endocytosis of TfR and EGFR was blocked by overexpression of Eps15DIII or intracellular microinjection of an anti-Eps15 Ab (29, 32). Both TfR and EGFR contain a tyrosine sorting motif. In this study, we found that Eps15DIII blocked PMA-induced CD4 down-regulation and, in synergy with AP-2 knockdown by µ2 siRNA, blocked HIV/SIV-Nef-mediated CD4 down-regulation. Nef and CD4 both contain a dileucine sorting motif for endocytosis. Our data thus indicate that Eps15 is also involved in dileucine sorting motif-dependent endocytosis, suggesting that Eps15 is an essential component of the clathrin endocytic machinery that interacts with dileucine sorting motif-containing cargo. It is known that Eps15, through its EH domains, binds to epsin, an accessory protein that interacts with phosphotidylinositol 4,5-bisphosphate on the plasma membrane (for a review, see Ref.23). Thus, the Eps15-epsin interaction may be involved in the recruitment of AP-2 to the membrane for the assembly of clathrin-coated pits. Both Eps15DIII and AP-2 RNAi could deplete a functional Eps15/AP-2 complex, exerting synergistically a negative effect on the assembly of clathrin-coated pits.

It has been suggested that Eps15 may also interact with the cargo molecules targeted for down-regulation. Eps15 was originally identified as a substrate of EGFR protein kinase (38). Recent studies show that the ubiquitin-interacting motif in Eps15 links ubiquitinated EGFR to the AP-2/clathrin complex, facilitating the entry of activated EGFR into clathrin-coated pits (39). Future studies are needed to determine whether Eps15 or other accessory proteins assist AP-2 in interacting with the dileucine sorting motif on cargo molecules.

We have previously shown that PMA treatment resulted in serine phosphorylation in the CD4 tail that disrupted the interaction between CD4 and Nef, allowing recycling of CD4 to the cell surface (26), but it was not clear how CD4 was connected to an AP complex during the endocytic pathway change. In the current study we show that both Nef and the phosphorylated CD4 are connected to the AP-2 complex. The expression of Eps15DIII alone or the knockdown of AP-2 alone blocked PMA-induced CD4 down-regulation, but unless combined, they did not block HIV Nef-mediated CD4 down-regulation. This suggests that the affinity of phosphorylated CD4 for AP-2 is lower than that of HIV Nef for AP-2. The difference in affinity also explains how PMA-induced CD4 phosphorylation that blocks Nef-mediated CD4 endocytosis may result in a net gain of surface CD4 in T cells expressing HIV Nef (26).

Recently, a paper published on-line shows that the decrease in the AP-2-dependent endocytosis impaired SIV Nef, but not HIV-induced, CD4 down-regulation (40). Specifically, Rose et al. (40) found that inhibition by the Eps15 DN mutant caused a modest inhibition of HIV Nef-mediated CD4 down-regulation in both Jurkat and HeLa cells, whereas the Eps15 DN mutant caused an almost complete inhibition of SIV Nef-mediated CD4 down-regulation in HeLa cells. SIV Nef-induced, but not HIV Nef-induced, CD4 down-regulation was blocked or reversed by siRNA depletion of AP-2 in HeLa cells. Similarly, we found that inhibition by the Eps15 DN mutant or by siRNA depletion of AP-2 did not significantly affect HIV Nef-mediated CD4 down-regulation in Jurkat T cells (Figs. 4 and 6). However, when combined, these two AP-2 inhibitors profoundly (up to 85%) blocked both HIV and SIV Nef-mediated CD4 down-regulation (Figs. 4–6). In contrast, Dyn K44A and AP-2 depletions did not act synergistically. Our studies suggest that it may be necessary to block AP-2-dependent endocytosis by using the combination of DN Eps15 inhibition and siRNA depletion of AP-2. Without using the combination, we also failed to see clear AP-2 dependence of both HIV and SIV Nef-mediated CD4 down-regulation in T cells, which may be the reason for the discrepancy between our conclusion and that of Rose et al. (40).

Finally, it is worth noting that in the absence of PMA or Nef, the overexpression of Dyn K44A or Eps15DIII alone or combined with AP-2 RNAi did not affect the surface levels of CD4. This suggests either a very slow turnover rate or a noninduced, constitutive CD4 endocytosis that is clathrin/AP-2 independent.

	Acknowledgments

 
We thank Dr. J. Skowronski for plasmids of Nef (pNA7)-GFP (HIV) and 239-Nef/GFP (SIV), Dr. A. Benmerah for plasmids of Eps15DIII-GFP and Eps15d32-GFP, and Dr. S. L. Schmid for plasmids of wt Dyn and Dyn K44A.

	Disclosures

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
The authors have no financial conflict of interest.

	Footnotes

 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

¹ This work was supported in part by National Institutes of Health Grant 7RO1AI17258 (to S.J.B.) and grants (to Y.-J.J.) from the Association for International Cancer Research (United Kingdom) and from a pilot AIDS funding from New York University.

² Address correspondence and reprints requests to Dr. Yong-Jiu Jin, Skirball Institute of Biomedical Research, 540 1st Avenue, Lab 5-1, New York University School of Medicine, New York, NY 10016. E-mail address: jiny{at}saturn.med.nyu.edu

³ Abbreviations used in this paper: wt, wild type; DN, dominant negative; Dyn, dynamin; EGFR, epidermal growth factor receptor; RNAi, RNA interference; siRNA, small interference RNA; TfR, transferrin receptor.

Received for publication March 4, 2005. Accepted for publication June 22, 2005.

	References

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 

1. Pelchen-Matthews, A., J. E. Armes, M. Marsh. 1989. Internalization and recycling of CD4 transfected into HeLa and NIH3T3 cells. EMBO J. 8:3641.-3649. [Medline]
2. Shin, J., C. Doyle, Z. Yang, D. Kappes, J. L. Strominger. 1990. Structural features of the cytoplasmic region of CD4 required for internalization. EMBO J. 9:425.-434. [Medline]
3. Pelchen-Matthews, A., I. J. Parsons, M. Marsh. 1993. Phorbol ester-induced downregulation of CD4 is a multistep process involving dissociation from p56^lck, increased association with clathrin-coated pits, and altered endosomal sorting. J. Exp. Med. 178:1209.-1222. [Abstract/Free Full Text]
4. Garcia, J. V., A. D. Miller. 1991. Serine phosphorylation-independent downregulation of cell-surface CD4 by nef. Nature 350:508.-511. [Medline]
5. Benson, R. E., A. Sanfridson, J. S. Ottinger, C. Doyle, B. R. Cullen. 1993. Downregulation of cell-surface CD4 expression by simian immunodeficiency virus Nef prevents viral super infection. J. Exp. Med. 177:1561.-1566. [Abstract/Free Full Text]
6. Mariani, R., J. Skowronski. 1993. CD4 down-regulation by nef alleles isolated from human immunodeficiency virus type 1-infected individuals. Proc. Natl. Acad. Sci. USA 90:5549.-5553. [Abstract/Free Full Text]
7. Lama, J., A. Mangasarian, D. Trono. 1999. Cell-surface expression of CD4 reduces HIV-1 infectivity by blocking Env incorporation in a Nef- and Vpu-inhibitable manner. Curr. Biol. 9:622.-631. [Medline]
8. Ross, T. M., A. E. Oran, B. R. Cullen. 1999. Inhibition of HIV-1 progeny virion release by cell-surface CD4 is relieved by expression of the viral Nef protein. Curr. Biol. 9:613.-621. [Medline]
9. Glushakova, S., J. Munch, S. Carl, T. C. Greenough, J. L. Sullivan, L. Margolis, F. Kirchhoff. 2001. CD4 down-modulation by human immunodeficiency virus type 1 Nef correlates with the efficiency of viral replication and with CD4⁺ T-cell depletion in human lymphoid tissue ex vivo. J. Virol. 75:10113.-10117. [Abstract/Free Full Text]
10. Cortes, M. J., F. Wong-Staal, J. Lama. 2002. Cell surface CD4 interferes with the infectivity of HIV-1 particles released from T cells. J. Biol. Chem. 277:1770.-1779. [Abstract/Free Full Text]
11. Lundquist, C. A., M. Tobiume, J. Zhou, D. Unutmaz, C. Aiken. 2002. Nef-mediated downregulation of CD4 enhances human immunodeficiency virus type 1 replication in primary T lymphocytes. J. Virol. 76:4625.-4633. [Abstract/Free Full Text]
12. Stoddart, C. A., R. Geleziunas, S. Ferrell, V. Linquist-Stepps, M. E. Moreno, C. Bare, W. Xu, W. Yonemoto, P. A. Bresnahan, J. M. McCune, et al 2003. Human immunodeficiency virus type 1 Nef-mediated downregulation of CD4 correlates with Nef enhancement of viral pathogenesis. J. Virol. 77:2124.-2133. [Abstract/Free Full Text]
13. Greenberg, M., L. DeTulleo, I. Rapoport, J. Skowronski, T. Kirchhausen. 1998. A dileucine motif in HIV-1 Nef is essential for sorting into clathrin-coated pits and for downregulation of CD4. Curr. Biol. 8:1239.-1242. [Medline]
14. Bresnahan, P. A., W. Yonemoto, W. C. Greene. 1999. Cutting edge: SIV Nef protein utilizes both leucine- and tyrosine-based protein sorting pathways for down-regulation of CD4. J. Immunol. 163:2977.-2981. [Abstract/Free Full Text]
15. Craig, H. M., M. W. Pandori, J. C. Guatelli. 1998. Interaction of HIV-1 Nef with the cellular dileucine-based sorting pathway is required for CD4 down-regulation and optimal viral infectivity. Proc. Natl. Acad. Sci. USA 95:11229.-11234. [Abstract/Free Full Text]
16. Arora, V. K., B. L. Fredericksen, J. V. Garcia. 2002. Nef: agent of cell subversion. Microbes Infect. 4:189.-199. [Medline]
17. Greenberg, M. E., S. Bronson, M. Lock, M. Neumann, G. N. Pavlakis, J. Skowronski. 1997. Co-localization of HIV-1 Nef with the AP-2 adaptor protein complex correlates with Nef-induced CD4 down-regulation. EMBO J. 16:6964.-6976. [Medline]
18. Craig, H. M., T. R. Reddy, N. L. Riggs, P. P. Dao, J. C. Guatelli. 2000. Interactions of HIV-1 nef with the µ subunits of adaptor protein complexes 1, 2, and 3: role of the dileucine-based sorting motif. Virology 271:9.-17. [Medline]
19. Janvier, K., Y. Kato, M. Boehm, J. R. Rose, J. A. Martina, B. Y. Kim, S. Venkatesan, J. S. Bonifacino. 2003. Recognition of dileucine-based sorting signals from HIV-1 Nef and LIMP-II by the AP-1 -1 and AP-3 -3 hemicomplexes. J. Cell Biol. 163:1281.-1290. [Abstract/Free Full Text]
20. Bresnahan, P. A., W. Yonemoto, S. Ferrell, D. Williams-Herman, R. Geleziunas, W. C. Greene. 1998. A dileucine motif in HIV-1 Nef acts as an internalization signal for CD4 downregulation and binds the AP-1 clathrin adaptor. Curr. Biol. 8:1235.-1238. [Medline]
21. Kirchhausen, T.. 1999. Adaptors for clathrin-mediated traffic. Annu. Rev. Cell Dev. Biol. 15:705.-732. [Medline]
22. Conner, S. D., S. L. Schmid. 2003. Regulated portals of entry into the cell. Nature 422:37.-44. [Medline]
23. Wendland, B.. 2002. Epsins: adaptors in endocytosis?. Nat. Rev. Mol. Cell. Biol. 3:971.-977. [Medline]
24. Traub, L. M.. 2003. Sorting it out: AP-2 and alternate clathrin adaptors in endocytic cargo selection. J. Cell Biol. 163:203.-208. [Abstract/Free Full Text]
25. Praefcke, G. J., M. G. Ford, E. M. Schmid, L. E. Olesen, J. L. Gallop, S. Y. Peak-Chew, Y. Vallis, M. M. Babu, I. G. Mills, H. T. McMahon. 2004. Evolving nature of the AP2 -appendage hub during clathrin-coated vesicle endocytosis. EMBO J. 23:4371.-4383. [Medline]
26. Jin, Y. J., X. Zhang, J. G. Boursiquot, S. J. Burakoff. 2004. CD4 phosphorylation partially reverses Nef down-regulation of CD4. J. Immunol. 173:5495.-5500. [Abstract/Free Full Text]
27. Fragoso, R., D. Ren, X. Zhang, M. W. Su, S. J. Burakoff, Y. J. Jin. 2003. Lipid raft distribution of CD4 depends on its palmitoylation and association with Lck, and evidence for CD4-induced lipid raft aggregation as an additional mechanism to enhance CD3 signaling. J. Immunol. 170:913.-921. [Abstract/Free Full Text]
28. Lock, M., M. E. Greenberg, A. J. Iafrate, T. Swigut, J. Muench, F. Kirchhoff, N. Shohdy, J. Skowronski. 1999. Two elements target SIV Nef to the AP-2 clathrin adaptor complex, but only one is required for the induction of CD4 endocytosis. EMBO J. 18:2722.-2733. [Medline]
29. Benmerah, A., C. Lamaze, B. Begue, S. L. Schmid, A. Dautry-Varsat, N. Cerf-Bensussan. 1998. AP-2/Eps15 interaction is required for receptor-mediated endocytosis. J. Cell Biol. 140:1055.-1062. [Abstract/Free Full Text]
30. Motley, A., N. A. Bright, M. N. Seaman, M. S. Robinson. 2003. Clathrin-mediated endocytosis in AP-2-depleted cells. J. Cell Biol. 162:909.-918. [Abstract/Free Full Text]
31. Benmerah, A., J. Gagnon, B. Begue, B. Megarbane, A. Dautry-Varsat, N. Cerf-Bensussan. 1995. The tyrosine kinase substrate eps15 is constitutively associated with the plasma membrane adaptor AP-2. J. Cell Biol. 131:1831.-1838. [Abstract/Free Full Text]
32. Carbone, R., S. Fre, G. Iannolo, F. Belleudi, P. Mancini, P. G. Pelicci, M. R. Torrisi, P. P. Di Fiore. 1997. Eps15 and eps15R are essential components of the endocytic pathway. Cancer Res. 57:5498.-5504. [Abstract/Free Full Text]
33. Le Gall, S., F. Buseyne, A. Trocha, B. D. Walker, J. M. Heard, O. Schwartz. 2000. Distinct trafficking pathways mediate Nef-induced and clathrin-dependent major histocompatibility complex class I down-regulation. J. Virol. 74:9256.-9266. [Abstract/Free Full Text]
34. Piguet, V., Y. L. Chen, A. Mangasarian, M. Foti, J. L. Carpentier, D. Trono. 1998. Mechanism of Nef-induced CD4 endocytosis: Nef connects CD4 with the µ chain of adaptor complexes. EMBO J. 17:2472.-2481. [Medline]
35. Owen, D. J., P. R. Evans. 1998. A structural explanation for the recognition of tyrosine-based endocytotic signals. Science 282:1327.-1332. [Abstract/Free Full Text]
36. Rapoport, I., Y. C. Chen, P. Cupers, S. E. Shoelson, T. Kirchhausen. 1998. Dileucine-based sorting signals bind to the chain of AP-1 at a site distinct and regulated differently from the tyrosine-based motif-binding site. EMBO J. 17:2148.-2155. [Medline]
37. Benmerah, A., M. Bayrou, N. Cerf-Bensussan, A. Dautry-Varsat. 1999. Inhibition of clathrin-coated pit assembly by an Eps15 mutant. J Cell Sci. 112:1303.-1311. [Abstract]
38. Fazioli, F., L. Minichiello, B. Matoskova, W. T. Wong, P. P. Di Fiore. 1993. Eps15, a novel tyrosine kinase substrate, exhibits transforming activity. Mol. Cell. Biol. 13:5814.-5828. [Abstract/Free Full Text]
39. de Melker, A. A., G. van der Horst, J. Borst. 2004. c-Cbl directs EGF receptors into an endocytic pathway that involves the ubiquitin-interacting motif of Eps15. J. Cell Sci. 117:5001.-5012. [Abstract/Free Full Text]
40. Rose, J. J., K. Janvier, S. Chandrasekhar, R. P. Sekaly, J. S. Bonifacino, S. Venkatesan. 2004. CD4 downregulation by HIV-1 and SIV Nef proteins involves both internalization and intracellular retention mechanisms. J. Biol. Chem. 280:7413.-7426.

This article has been cited by other articles:

				Y.-J. Jin, C. Y. Cai, X. Zhang, and S. J. Burakoff Lysine 144, a Ubiquitin Attachment Site in HIV-1 Nef, Is Required for Nef-Mediated CD4 Down-Regulation J. Immunol., June 15, 2008; 180(12): 7878 - 7886. [Abstract] [Full Text] [PDF]

				O. W. Lindwasser, W. J. Smith, R. Chaudhuri, P. Yang, J. H. Hurley, and J. S. Bonifacino A Diacidic Motif in Human Immunodeficiency Virus Type 1 Nef Is a Novel Determinant of Binding to AP-2 J. Virol., February 1, 2008; 82(3): 1166 - 1174. [Abstract] [Full Text] [PDF]

				W. Hubner, P. Chen, A. D. Portillo, Y. Liu, R. E. Gordon, and B. K. Chen Sequence of Human Immunodeficiency Virus Type 1 (HIV-1) Gag Localization and Oligomerization Monitored with Live Confocal Imaging of a Replication-Competent, Fluorescently Tagged HIV-1 J. Virol., November 15, 2007; 81(22): 12596 - 12607. [Abstract] [Full Text] [PDF]

				R. Chaudhuri, O. W. Lindwasser, W. J. Smith, J. H. Hurley, and J. S. Bonifacino Downregulation of CD4 by Human Immunodeficiency Virus Type 1 Nef Is Dependent on Clathrin and Involves Direct Interaction of Nef with the AP2 Clathrin Adaptor J. Virol., April 15, 2007; 81(8): 3877 - 3890. [Abstract] [Full Text] [PDF]

				J. S. Loomis, R. J. Courtney, and J. W. Wills Packaging Determinants in the UL11 Tegument Protein of Herpes Simplex Virus Type 1 J. Virol., November 1, 2006; 80(21): 10534 - 10541. [Abstract] [Full Text] [PDF]

				J. F. Roeth and K. L. Collins Human Immunodeficiency Virus Type 1 Nef: Adapting to Intracellular Trafficking Pathways Microbiol. Mol. Biol. Rev., June 1, 2006; 70(2): 548 - 563. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) A correction has been published Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Jin, Y.-J. Articles by Burakoff, S. J. Search for Related Content PubMed PubMed Citation Articles by Jin, Y.-J. Articles by Burakoff, S. J.