|
|
||||||||
Enhancer Is Dispensable for the Expression of Rearranged TCR
Genes in Thymic DN2/DN3 Populations but Not at Later Stages
Department of Cellular Immunology, Max-Planck-Institute of Immunobiology, Freiburg, Germany
| Abstract |
|---|
|
|
|---|
enhancer has been shown to be dispensable for germline transcription of nonrearranged TCR
segments but appears to be required for TCR
V to DJ rearrangement. E
dependency of the subsequent expression of VDJ-rearranged TCR
genes in thymic subpopulations has so far not been analyzed. We generated transgenic mice, using a V
8.2D
1J
1.3-rearranged TCR
bacterial artificial chromosome, which lacked E
, and monitored transgene expression by flow cytometry using V
-specific mAbs and an IRES-eGFP reporter. Transgene expression was found in double negative (DN)2 and DN3 but not at later stages of thymopoesis. There was no toxicity associated with the transgene given that apoptosis in DN3, DN4 was not increased, and the number of DN4 cells generated from DN3 cells in reaggregate thymic organ cultures was not diminished. The transgenic TCR
gave rise to a pre-TCR, as suggested by its ability to suppress endogenous TCR
rearrangement, to facilitate
-selection on a TCR
-deficient background and to inhibit 
T cell lineage development. The results suggest that the V
8.2 promoter is sufficient to drive expression of rearranged TCR
VDJ genes E
independently in DN2/DN3 but not at later stages. | Introduction |
|---|
|
|
|---|
,
, and
loci start in DN2 and are completed in DN3 (2). To survive in the DN4 and mature to the DP stage, 
T cells are subjected to
-selection, a process that is critically depended upon signaling by the pre-TCR and ensures that only cells with a functionally rearranged TCR
gene proceed in development (3). T cell development in animals with deficiencies in pre-TCR signaling is blocked at the DN3 stage (4, 5, 6, 7, 8). Cross-linking CD3
via anti-CD3
Abs (9) can overcome the block in pre-TCR-deficient animals and produce a single wave of DP cells. Development of 
T cells does not depend on a pre-TCR, and the 
TCR is expressed only after the cells have reached the DN4 stage (6, 10, 11, 12).
At least two types of regulatory elements are involved in the control of transcription and accessibility for recombination of the TCR
locus. V
promoters initiate germline transcription of the individual V
segments, but their role in V
D
J
rearrangements remains controversial. Experiments using transgenic (tg) mice carrying a TCR
minilocus in which the decamer sequence of the V
8.3 promoter was mutated (13) suggested that the promoter is necessary for the expression but not for the rearrangement of V
segments. However, this study could not exclude the possibility that the promoter of the upstream V
5.2 segment had facilitated the accessibility to the recombination machinery. A more recent report (14) showed that the knockout of the V
13.1 promoter reduced the usage of the V
13.1 segment in V
D
J
rearrangements 5- to 10-fold but lead to complete lack of V
13.1+ T cells in the periphery. Unexpectedly, these knockout mice showed germline transcripts of V
13.1, which were initiated by previously uncharacterized sequences upstream of the deleted promoter region. Taken together, both studies show that the V
promoter is crucial for expression of rearranged TCR
genes, but the requirement for the promoter and promoter-depended germline transcription in V
D
J
rearrangements remains uncertain.
The element that has been studied best is the E
enhancer, a 0.5-kB segment that is located 6 kb 3' of C
2 exon 4 (15, 16). Absence of E
results in hypermethylation and histone H3 hypoacetylation of the D
J
1/D
J
2 region and a lack of D
J
1/D
J
2 germline transcripts (17). These changes seem to be confined to the DJC region of the TCR
locus because the same study could not detect alterations in epigenetic modifications or in germline transcription of the V
5.2 and V
14.1 segments. Recently, it has been shown for the germline promoter pD
1 that the basal transcriptional machinery is still recruited in the absence of E
but that E
is required for subtle changes in the chromatin structure that seem to be required for activation of transcription (18). E
is capable of mediating tissue and developmental stage-specific V
D
J
rearrangements of a TCR
minilocus in vivo (19, 20). E
/ mice do not show V
D
J
rearrangements (21, 22) and present a phenotype similar to that of TCR
/ animals (23). Several studies have addressed the question of germline transcription of V
genes in the presence (24, 25) and absence (17, 26, 27) of E
. Using Rag/ and anti-CD3
-induced Rag/ mice as a source of DN and DP cells, respectively, these reports showed that V
germline transcription is independent of E
, prominent in the DN population, and down-regulated to a certain extend (4- to 5-fold with the exception of V
14.1 (25)) upon induction of DP cells. No experiments have so far been done to characterize the role of E
in the expression of rearranged TCR
genes in thymic subpopulations.
In the present study, we used a bacterial artificial chromosome (BAC), encoding a functionally rearranged TCR
gene plus reporter (V
8.2D
1J
1.3C
1-IRES-eGFP) in the genomic context of a TCR
locus lacking the E
enhancer. We show that expression of the TCR
transgene is confined to the DN2/DN3 populations but nevertheless induces all developmental effects ascribed to a functional pre-TCR (
-selection, TCR
allelic exclusion, inhibition of 
T cell development).
| Materials and Methods |
|---|
|
|
|---|
The construction of the initial TCR
BAC encoding the HY-TCR
-chain has been described elsewhere (28). Insertion of a 10.2-kb DNA fragment encoding for D
1J
1.3-C
1-IRES-eGFP-D
2-J
2.3 into this TCR
BAC was done via the pSV1 shuttle vector system as described in Ref.29 . The IRES-eGFP cassette was a gift from Dr. R. Ketteler (Max-Planck-Institute of Immunobiology, Freiburg, Germany). PstI restriction digest and Southern blotting were used to confirm correct integration. PFGE was performed using the CHEF Mapper XA system (Bio-Rad) with the following parameters: buffer, 0.5x Tris-borate EDTA; temperature, 14°C; gel, 0.8% NEEO agarose (Roth); electrophoresis, 6 V/cm, 120° included angle, 17:32 h running time, switch interval 0.315.51 s, linear ramping. TOPO Shotgun Subcloning kit (Invitrogen Life Technologies) was used to subclone the BAC. Subclones (384) were sequenced, yielding 63% coverage of the BAC. The following primers were used to detect either the wild-type (WT) or the
E
locus: CACTTTAAGAACCACGCCTGC (common 5'), TTACAGTGCTTGATAGTTATTACC (WT 3'), and AGGCACATAAGAGGATGCTGG (
E
3').
Mice and transgenesis
The BAC was linearized by NotI digestion before injection. PFGE was used to confirm that the DNA was not degraded. Pronuclear injections were performed in the transgenic facility of the Max-Planck-Institute. Unless otherwise mentioned, experiments were done with mice on a FVB/N background. The mice used in the TCR
null experiment had been backcrossed to C57BL/6 for four generations (N4). Mice were genotyped by PCR, using the following primers for eGFP (BAC transgene) or TCR
WT and null (30) allele: CGGCATCAAGGCCAACTTCAAGAG (GFP 5'), CTTGTACAGCTCGTCCATGCCGAG (GFP 3'), AGGGACCAGGCTTTTGGTAATAGG (J
1.2), GGCTTCCTTCTCCAAAA TAGAGCG (J
1.3), and GCCTTCTATCGCCTTCTTGACGAG (Neo 3' end). Primers used for TCR
WT/KO genotyping were specific for the respective alleles and did not recognize the transgene. All mice were housed in a conventional unit of the Max-Planck-Institute animal facility and were used at 57 wk of age.
FACS stainings
Blocking of FcRs was done by incubating single-cell suspensions with 2.4G2 hybridoma supernatant before the staining procedure. The following mAbs were used for flow cytometry (all from BD Pharmingen): anti-CD4-biotin (H129.19), anti-CD4-PerCP (RM4-5), anti-CD8-biotin (53-6.7), anti-CD25-biotin (7D4), anti-CD25-PE-Cy7 (PC61), anti-CD44-biotin (IM7), anti-CD161c-biotin (PK136), anti-TCR
-APC (H57-597), anti-TCR
-PE (GL3), anti-V
4-PE (KT4), and anti-V
8.1/2-PE (MR5-2). The Alexa647 (Molecular Probes) labeled anti-V
8.2 (F23.2) mAb was a kind gift from Dr. J. Kirberg (Max-Planck-Institute of Immunobiology). Second-step staining of biotinylated mAbs was done using streptavidin-PerCP or streptavidin-APC-Cy7 (BD Pharmingen). Apoptosis was measured with the annexin V-FITC Apoptosis Detection Kit I (BD Pharmingen). For intracellular (i.c.) staining, cells were fixed with 1% paraformaldehyde (3 h at 4°C) and permeabilized with 0.25% saponin (20 min). After permeabilization, all subsequent steps were done in PBS/FCS (2%) containing 0.1% saponin. To rule out unspecific binding of fluorophore-conjugated mAbs to i.c. structures, controls were incubated with 5 µg of purified H57-597 or GL3 mAb during permeabilization. Cells were analyzed on a FACSCalibur or LSRII (BD Biosciences) flow cytometer and the data was evaluated using CellQuest, FACSDiVa (BD Biosciences) or FlowJo (Tree Star). For sorting of DN thymocytes, cell suspensions were first depleted of CD4+ and CD8+ cells by MACS (Miltenyi Biotec) and afterward sorted on a MoFlo cell sorter (DakoCytomation).
Reaggregated thymic organs cultures (RTOCs)
RTOCs were done according to Ref.31 . Briefly, fetal thymic lobes were taken from E15.5 BALB/c embryos and treated with 1.35 mM deoxyguanosine (Sigma-Aldrich) for 6 days. Lobes were then disaggregated with trypsin/EDTA (PAA). A total of 1 x 106 thymic stroma cells was mixed with thymocytes from tg mice and reaggregated on polycarbonate filters (Nuclepore 0.8 µm; Whatman), floating on IMDM + FCS (10%) + L-glutamine (4 mM) + kanamycin (100 µg/ml) + 2-ME (35 µM). RTOCs were cultured for the indicated time periods at 37°C and 7% CO2.
VDJ rearrangement PCR
Genomic DNA from 1 x 105 sorted thymocytes was prepared by proteinase K digestion of the cells followed by isopropanol precipitation. The amount of DNA used in the experiments was adjusted according to serial dilution PCR using insulin-specific primers. The VDJ rearrangement PCRs were done using the following primers: AGCTGTCTCCTACTATCGATTTCC (3' of J
2.6), GATATGCGAACAGTATCTAGGCCA (V
4), and TGTA CTGGTACCGACAGGATTCAG (V
6). The following program was used for amplification: 94°C/2 h; (94°C/30 min; 68°C/40 min; 72°C/2 h) x 40; 72°C/7 h.
RT-PCR analysis
RNA from sorted thymocytes was isolated using TRI Reagent (Sigma-Aldrich) and afterward subjected to DNase treatment (DNA-Free; Ambion). Reverse transcription with oligo(dT) primers used SuperScriptII RNaseH (Invitrogen Life Technologies). The following primers were used to amplify the full length V
8.2 cDNA: ATGGGCTCCAGGCTCTTCTTCGTG (V
8.2 exon 1) and GATCTGGCTTCATGAATTCTTTCTTTTGAC (C
1 exon 4 + linker). The purification and cloning of the PCR product was done using the TOPO-XL PCR cloning kit (Invitrogen Life Technologies).
| Results |
|---|
|
|
|---|
BAC lacking the E
enhancer
To assess the
-selection potential of different V
D
J
joints we created a BAC coding for the HY-TCR
-chain in the genomic context of the TCR
locus (Fig. 1a). An exact description of the BAC has been published elsewhere (28). By homologous recombination, the existing V
8.2D
2J
2.3 joint was replaced by a 10.2-kb fragment containing the following elements: the joint to be tested (V
8.2D
1J
1.3), J
1.4-C
1, an IRES-eGFP reporter placed directly behind the stop codon of C
1 exon 4, D
2, and J
2.1-J
2.3. PFGE of a BAC clone in which the targeting procedure had been successful suggested that a deletion had occurred because the NotI-linearized BAC was
50 kb shorter than expected. Additional digests (Fig. 1b) confirmed this and hinted that a deletion had occurred in the 3' region of the BAC. Shotgun sequencing of 384 clones derived from this BAC yielded 3 clones spanning a deletion, starting at 4.8 kb 3' of the C
2 stop codon (1.1 kb 5' of the E
HpaI site) and extending 44.6 kb downstream. PCR using a pair of primers, which were located 5' and 3' of the deletion, yielded a product when the
E
BAC was used as template but not with a BAC containing the 3' part of the germline TCR
locus. Conversely, a PCR in which the 3' primer was replaced with a primer located in the very 5' part of the deletion yielded a product with the germline but not with the
E
BAC used as a template (Fig. 1c).
|
transgene during thymic development and in the periphery (28). Realizing that our
E
BAC should enable us to monitor TCR
tg expression driven by the V
8.2 promoter alone, we decided to generate mice that carried this BAC as a transgene. For pronuclei injections, we used the FVB/N mouse strain because it carries the TCR
a allele (32), which contains a large deletion in the V
region, encompassingamong other V
sV
8. Two founder animals were obtained whose offspring showed very similar phenotypes. Therefore, the results of only one of the lines are shown below. RT-PCR analysis of DN3 thymocytes of tg mice revealed a full-length V
8.2-C
1 transcript (Fig. 1d). Cloning of the PCR product and sequencing of four of these clones confirmed the specificity of the PCR and did not reveal any consistent mutations at the cDNA level (data not shown).
Thymic expression pattern of the
E
BAC transgene
When compared with WT littermates, tg animals showed a
4-fold decrease in thymic cellularity with a slight increase in the percentage of DP thymocytes (Tab 1). The absolute number of CD4 SP thymocytes was decreased
10-fold. Although the percentage of CD8 SP thymocytes was not changed significantly, their absolute number was also
4-fold decreased. Cells accumulated in the TCR
lowCD69 stage, while the number of CD69+ thymocytes was reduced substantially. The percentage of TCR
high thymocytes was significantly reduced (3-fold) in comparison to WT animals. These results are consistent with an incomplete block in the DP population somewhat before positive selection. As some of the CD8 SP cells belong to the immature SP (ISP) subset, a less pronounced reduction than that of CD4 cells is in agreement with this hypothesis.
|
8 genes, we could use anti-V
8.1/8.2 or anti-V
8.2 mAbs to specifically stain the TCR
-chain encoded by the transgene. In the thymi of tg mice, we were unable to detect any cells, which expressed V
8.1/8.2 on the cell surface (Table I). The pre-TCR is expressed in the DN and the CD8 ISP stages of T cell development and occurs in very low abundance on the cell surface (33). Thus, because expression of the V
8.2 transgene in the context of the pre-TCR would have escaped the detection by surface staining, we used i.c. stainings. By this means, we detected transgene expression in the majority of DN2 cells and in some DN3 cells but not in DN4 cells and further developed thymocytes of tg mice (Fig. 2, a and b). Over 85% of the gated V
8.1/8.2ic+eGFP+ population were found to be CD4CD8CD161cCD25+, consistent with transgene expression predominantly in DN2/DN3 (Fig. 2c). TCR
ic+V
8.1/8.2ic cells, i.e., cells expressing endogenous TCR
-chains, were detected in DN3 and DN4 cells, in
10% of DP cells, and in
50% of SP cells (Fig. 2, a and b). Intriguingly, the vast majority of DP cells and
50% of SP cells (predominantly CD4 SP cells; data not shown) expressed no i.c. TCR
-chains at all (Fig. 2a). These results suggested that the TCR
tg, while being expressed only in DN2/DN3, inhibited the generation of cells expressing endogenous TCR
-chains but nevertheless permitted a certain degree maturation of thymocytes that did not express TCR
.
|
transgenes have been shown to inhibit 
T cell lineage development, in part due to inhibition of endogenous TCR
gene rearrangements (12, 34). To analyze whether this effect was also associated with a TCR
tg whose expression is restricted to DN2/DN3, we analyzed i.c. TCR
vs TCR
proteins in the DN4 population of tg and WT mice (Fig. 2d). The percentage of TCR
ic+ cells was severely (>15-fold) reduced in comparison to WT littermates. The results suggest that the TCR
tg, despite its restricted expression in DN2/DN3, is capable of inhibiting 
T cell lineage development.
Down-regulation of the TCR
transgene during the DN3 stage in tg mice
The DN2/DN3 restricted expression pattern could be due either to down-regulation of transgene expression or to death of transgene expressing cells in DN3. To distinguish between these possibilities, we sorted GFP+ and GFP DN3 cells of tg mice and placed them into reaggregate thymic organ cultures (RTOCs). Approximately 50% of the input GFP+ DN3 cells were V
8.1/8.2ic+ (data not shown; see Fig. 2c). Analyses of cultures of GFP+ cells showed that already at day 2 the percentage of V
8.1/8.2ic+ DN3 cells had dropped to 12%, indicating that >70% of the V
8.1/8.2ic+ DN3 cells had stopped transgene expression (Fig. 3). This became even more obvious at days 4 and 7, when only
1.7 and 1%, respectively, of all DN3/DN4 cells where still V
8.1/8.2ic+. The data also show that the TCR
tg is down-regulated before CD25, i.e., while the cells are still in DN3. In contrast to the GFP+ cells, progeny of the GFP cells expressed the transgene neither at day 2 nor at day 7. Importantly, the proportions of DN4 cells derived from GFP and from GFP+ DN3 cells were similar, suggesting that transgene expression is not toxic for the cells. The greater total cell number derived from GFP DN3 cells appears to be due to a more efficient production of DP cells.
|
To further address the putative toxicity of the transgene, we analyzed the proportions of apoptotic cells in DN3 and DN4 cells of tg and WT mice. Apoptosis of thymocytes that fail to pass
-selection takes place in DN4 (11). Because we found a substantial increase of TCR
icTCR
ic cells in this population of tg mice (Fig. 2c), it was possible that these cells, due to down-regulation of the transgene, could have failed
-selection and become apoptotic. To address this question, we used annexin V/propidium iodide (PI) double stainings, allowing to distinguish early apoptotic (annexin V+PI from late apoptotic (annexin V+PI+) and necrotic (annexin VPI+) cells (Fig. 4). Because we had to use FITC-conjugated annexin, the annexin signal of the viable DN3 population of tg animals includes the GFP fluorescence and is therefore brighter than that of WT DN3 cells. In DN4 cells, this effect is less pronounced, in line with the shutdown of transgene expression in this population. Nevertheless, annexin V+ early apoptotic cells could be clearly distinguished from annexin V viable cells. In agreement with our previous observations (11), only negligible numbers of apoptotic cells were seen in the DN3 subsets of both tg and WT mice, whereas the DN4 subsets of both types of mice contained significant numbers of apoptotic cells. No significant difference in the percentages of early apoptotic cells were seen in DN4, whereas the percentage of late apoptotic cells was lower in tg mice than in WT animals (20.4 vs 36.1%), a phenomenon that could be attributed to the enlarged population of
-selected DN4 cells in tg animals (see Discussion). The results suggest that transgene expression is not associated with an increase of apoptotic cells in the DN3/DN4 populations of tg mice.
|
locus rearrangements in tg mice
TCR
transgenes usually inhibit endogenous TCR
rearrangements, a phenomenon reflecting TCR
locus allelic exclusion. We determined endogenous TCR
rearrangements at the DNA and protein levels. For DNA analyses, V
8.1/8.2ic+ and V
8.1/8.2ic DN3 cells of tg mice were sorted, and TCR
VDJ rearrangements were assayed by semiquantitative PCR using primers for V
4.1 and V
6.1, which are located 5' and 3', respectively, of the deletion in the TCR
a allele (32) (Fig. 5a). Sorted DN3 cells of WT littermates and splenocytes of Rag-2/ mice were used as controls. This experiment showed clearly that rearrangements of the endogenous loci were drastically, albeit not completely, suppressed in the DN3 population of tg mice. Of note, no differences were seen in the extent of inhibition of rearrangements between V
8.1/8.2ic+ and V
8.1/8.2ic cells, indicating that the latter subset had passed through a phase of transgene expression as well. For analyses at the protein level, we monitored expression of V
8.2 and V
4.1 in DN3 and DN4 by FACS analysis (Fig. 5b). Although
10% of all TCR
ic+ DN3 and DN4 cells in WT mice are V
4.1ic+, no V
4.1ic+ DN3 cells and only a few V
4.1ic+ DN4 cells (
5% of WT) could be detected in tg animals. Nevertheless, we observed a population of TCR
ic+V
8.1/8.2ic cells in the DN4 subset, obviously expressing endogenous TCR
rearrangements. This population is
5-fold reduced compared with WT mice, which is consistent with the assumption that a small number of endogenous TCR
genes rearrange in DN3 and are expanded by
-selection in DN4. Taken together, these experiments show that the
E
transgene is capable of mediating allelic exclusion, similar to other TCR
transgenes (35).
|
-Selection on a TCR
-deficient background
Several of the experiments described above indicated that the DN2/DN3-restricted TCR
tg was nevertheless capable of inducing
-selection. For example, the TCR
icTCR
ic subset of DN4, usually containing apoptotic cells that had failed
-selection (11), was drastically increased in tg mice without showing increased numbers of apoptotic cells (see Figs. 2b and 5). Moreover, as shown in Fig. 2b, the CD25 expression pattern in the tg mice revealed a large population with intermediate expression, which was not seen in WT mice. This population could represent DN3 cells that prematurely down-regulated CD25 as a result of
-selection by the TCR
tg. To definitively clarify this point, we crossed the TCR
tg mice with TCR
knockout mice. In comparison with TCR
/tg mice, TCR
/tg+ animals presented an
3-fold increase in the number of total thymocytes (Fig. 6). FACS analysis showed that this increase was mainly due to an expansion of the DP population (76 vs 11%), corresponding to a >20-fold increase in absolute numbers of DP cells. In addition, increased numbers of both types of SP cells were observed. The results suggest that the TCR
tg was capable of partially restoring the generation of DP cells, which is severely compromised in TCR
/tg animals. Interestingly, as in all previous experiments, no significant expression of V
8.1/8.2 (<1% of the cells) could be detected beyond the DN3 stage (data not shown). These data suggest that the transgene in fact is able to mediate
-selection and perhaps some further maturation as well.
|
| Discussion |
|---|
|
|
|---|
E
TCR
BAC tg mouse that shows a DN2/DN3-restricted expression pattern of the transgene. The restricted expression is likely due to the lack of E
, although the deletion in the BAC is more extended so that a possible contribution of other control elements is not excluded. We observed similar phenotypes in two independent tg lines, thus excluding effects caused by the integration site. The TCR
joint encoded by the transgene was cloned from the TCR
sf+ DN4 population. Although previous studies failed to confirm the existence of nonfunctional TCR
-chains (Ref.36 ; A. Rolink, unpublished observations), we considered the possibility that the TCR
tg does not support 
T cell development. However, the product of the transgene exhibited all three major hallmarks of a TCR
-chain that can give rise to a functional pre-TCR. First, it was capable of mediating allelic exclusion of endogenous TCR
loci (35) as shown on the DNA and protein levels. Second, it is capable of facilitating
-selection because its introduction onto a TCR
/ background alleviated the developmental block in the production of DP cells in these knockout mice (5). Third, it suppressed 
T cell development (34), a phenomenon that has been shown to be at least in part caused by suppression of TCR
rearrangements due to early expression of a pre-TCR in DN3 (12).
We also considered the possibility that transgene expressing cells did not survive, either due to toxicity of one of the products of the transgene or to negative selection by a putative superantigen. Toxicity was ruled out by two types of experiments. First, annexin V/PI stainings revealed no significant increase of apoptotic cells in the tg DN3 population and a decrease rather than an increase in apoptotic cells in the tg DN4 population. Second, GFP+ DN3 cells developed into V
8.1/8.2ic DN3 and subsequently into V
8.1/8.2ic DN4 cells in RTOCs, showing that transgene expressing cells do not die but rather shutdown expression of the transgene. Finally, transgene expressing cells are
-selected in vivo as they give rise to DP cells on a TCR
/ background. Superantigen deletion had to be considered because the FVB mouse strain lacks an endogenous V
8.2 segment. Therefore, it was conceivable that a retrovirally derived superantigen could mediate a strong interaction between the tg V
8.2 chain and the endogenous H-2q MHC molecules, resulting in deletion of the transgene-expressing cells. However, as superantigen-mediated deletions take place at the DP and not at the DN3 stage, it is unlikely that the loss of V
8.2+ cells is caused by this mechanism. In addition, loss of transgene expression was also seen in RTOCs using BALB/c-derived thymic stroma, which expresses MHC molecules of the H-2d haplotype and supports development of V
8.2+ T cells.
What is the origin of the GFP DN3 population? As transgene expression starts in DN2 and GFPDN3 cells do not give rise to V
8.1/8.2ic+ cells in RTOCs, it is likely that these cells may have previously expressed the transgene and have already down-regulated it, placing them at a later developmental stage than the GFP+ DN3 cells. On the other hand, while being in a similar developmental stage as the GFP+ cells, GFP DN3 cells may never express the transgene due to mechanisms such as position effect variegation. We favor the first mechanism because of the suppression of endogenous TCR
VDJ rearrangements, which is equally pronounced in both the V
8+ and V
8 DN3 cells of tg mice. In case of the second mechanism, the GFP cell population, which accounts for a majority of DN3 cells, should not show allelic exclusion of the endogenous TCR
loci. This assumption is not at variance with the small number of DN3 cells that show endogenous TCR
V
DJ rearrangements. TCR
transgenes never cause complete suppression of endogenous TCR
rearrangements, presumably because tg expression in DN2 does not give rise to a pre-TCR due to lack of CD3
expression in this population (10).
We envisage thymocyte development in the
E
tg mice as consisting of two tiers, one driven by the TCR
tg and the other by endogenous TCR
-chains. The tg TCR
is expressed in most of the DN2 cells and gives rise to the formation of a pre-TCR as soon as CD3 components are expressed in early DN3 (10), thus suppressing endogenous TCR
and TCR
rearrangements. Signals through the pre-TCR initiate
-selection of a large proportion of this population, driving development though the pre-TCR-dependent checkpoint into the DN4 and DP stages. Transgene expression is terminated in DN3, resulting in lack of intracellular TCR
in most DN4 and DP cells, as well as in premature termination of proliferation and reduced numbers of DP cells. The DP stage is the end point of most TCR
icTCR
ic cells, but a minority may even proceed to the SP stage, as indicated by the TCR
ic SP subset. In parallel, a few DN3 cells produce in-frame rearrangements of endogenous TCR
loci, express these TCR
-chains, and develop into TCR
ic+TCR
ic DN4, DP, and SP cells, in line with the
5-fold decrease in the positively selected CD69+ population. Because of pre-TCR and TCR expression in this population, the TCR
ic+ cells proliferate and undergo positive selection normally, finally giving rise to
50% of all SP cells.
Unexpectedly, tg mice showed an
3-fold drop in the ratio of CD4:CD8 SP cells. This phenotype is reminiscent of the one seen in WT/TCR
/ mixed bone marrow chimeras (37), which contain two cell populations: one that is competent of developing into the SP and one that is arrested in the DP stage. This study also reported a decreased CD4:CD8 ratio, suggesting to the investigators that the selection of CD8 SP cells in normal mice may be limited by the amount of available MHC class I molecules, whereas selection of CD4 SP cells may be limited by the generation of MHC class II-restricted TCR. This effect may also be responsible for our observations because also in
E
tg mice only a minor proportion of DP cells are capable of maturing to the SP stage. In addition, the less pronounced reduction in CD8 SP cells may be due to ISP cells in this population.
Our study shows that E
is dispensable for transcription of a rearranged TCR
tg in the DN2/DN3 population but not at later stages of thymopoesis. In normal mice, some TCR
genes that rearrange in DN2 and early DN3 cells may indeed be expressed E
independently, but most rearrangements likely take place after E
-dependent expression commences in DN3. Previous reports (17, 26, 27) described germline V
transcripts in the thymi of anti-CD3
-induced, E
-deficient Rag/ mice and interpreted this observation as E
-independent transcription in the DP population. However, these studies did not use purified DP cells so that the results could be due to the DN cells that are still present in anti-CD3
-induced Rag/ thymi. Alternatively, induction of Rag/ thymocytes with anti-CD3
may represent too brief a stimulus that is sufficient to drive the cells over the
-selection checkpoint but insufficient to induce E
dependence of germline transcription, a process that might require prolonged pre-TCR signaling. As a third possibility, transcription of rearranged TCR
genes may have different regulatory requirements than germline transcription. We have shown previously that transcription of rearranged TCR
genes in DN3 is subject to regulation by signaling through the CD3 complex, whereas this is not the case for later developmental stages (38, 39). These results agree with the present data in suggesting that a drastic change takes place in the regulation of the expression of TCR
genes during the DN3 stage.
| Acknowledgments |
|---|
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 Current address: Division of Cellular Biochemistry, Institute of Molecular Physiology and Developmental Biology, University of Bonn, Karlrobert-Kreiten-Strasse 13, 53115 Bonn, Germany. ![]()
2 Address correspondence and reprint requests to Dr. Klaus Eichmann, Max-Planck-Institute of Immunobiology, Stübeweg 51, 79108 Freiburg, Germany. E-mail address: eichmann{at}immunbio.mpg.de ![]()
3 Abbreviations used in this paper: DN, double negative; DP, double positive; SP, single positive; tg, transgenic; BAC, bacterial artificial chromosome; PFGE, pulsed field gel electrophoresis; WT, wild type; i.c., intracellular; RTOC, reaggregated thymic organs culture; ISP, immature SP; PI, propidium iodide. ![]()
Received for publication November 19, 2004. Accepted for publication June 23, 2005.
| References |
|---|
|
|
|---|
,
, and
rearrangements during adult thymic development: T cell receptor rearrangements are present in CD44+CD25+ pro-T thymocytes. Proc. Natl. Acad. Sci. USA 95:12522.-12527.
chain genes in thymocytes: a critical role for the
chain in development. Cell 73:513.-519. [Medline]
and
block thymocyte development at different stages. Nature 360:225.-231. [Medline]
gene in development of 
but not 
T cells. Nature 375:795.-798. [Medline]
gene. EMBO J. 14:4641.-4653. [Medline]

T cell development is abolished in mice lacking both Lck and Fyn protein tyrosine kinases. Immunity 5:429.-436. [Medline]
-chain-deficient mutant mice by transmembrane signaling through CD3
. Proc. Natl. Acad. Sci. USA 90:11401.-11405.
and TCR
proteins during adult thymus development. Int. Immunol. 11:1641.-1650.
and/or TCR
proteins die by apoptotic cell death in the CD44CD25 (DN4) subset. Eur. J. Immunol. 31:3308.-3317. [Medline]
1.1/V
2
TCR in 
/
lineage choice in the thymus. J. Immunol. 173:25.-32.
-chain minilocus occurs in the absence of a functional promoter. J. Immunol. 155:1191.-1202. [Abstract]
variable gene promoter is required for efficient V
rearrangement but not allelic exclusion. Mol. Cell. Biol. 24:7015.-7023.
2 in the T cell receptor
locus. Science 241:205.-208.
-chain genes is controlled by a downstream regulatory element. EMBO J. 7:745.-750. [Medline]
gene enhancer during early T cell development: implications for the control of TCR-
locus recombination. J. Exp. Med. 192:625.-636.
and TCR
gene enhancers confer tissue- and stage-specificity on V(D)J recombination events. EMBO J. 12:4335.-4346. [Medline]
variable region gene segments in B and T lineage cells. J. Exp. Med. 180:261.-272.
-chain enhancer: the role of enhancer elements in controlling V(D)J recombination accessibility. Proc. Natl. Acad. Sci. USA 93:7871.-7876.
gene enhancer blocks 
T cell development. Proc. Natl. Acad. Sci. USA 93:7877.-7881.
enhancer-deleted mice: implications for 
T cell lineage commitment and differentiation. J. Immunol. 165:1364.-1373.
segments before gene rearrangement. J. Immunol. 166:1771.-1780.
germline transcription in RAG-deficient mice by the CD3
-mediated signals: implication of V
transcriptional regulation in TCR
allelic exclusion. Int. Immunol. 10:553.-560.
)-to-J(
) recombination in CD4+CD8+ thymocyte: implications for a new aspect in the regulation of TCR
gene recombination. Int. Immunol. 13:1405.-1414.
gene enhancer in regulating coding joint formation during V(D)J recombination. J. Biol. Chem. 278:18101.-18109.
gene rearrangement using homologous recombination of two non-overlapping bacterial artificial chromosomes. J. Immunol. Methods. In press.
-subunit locus in mouse embryonic stem cells by gene targeting. Proc. Natl. Acad. Sci. USA 88:3084.-3087.
gene segments. Immunogenetics 49:851.-859. [Medline]

T cell lineage commitment. Curr. Biol. 9:559.-568. [Medline]
-chain transgene suppresses rearrangement of the V
4 gene segment. Proc. Natl. Acad. Sci. USA 85:9729.-9732.
gene prevents expression of endogenous
genes. Cell 52:831.-841. [Medline]

versus 
T lineage commitment. Immunity 9:649.-655. [Medline]
VDJ genes in early thymic development. J. Exp. Med. 188:1669.-1678.
gene expression by CD3 complex signaling in immature thymocytes: implications for TCR
allelic exclusion. Proc. Natl. Acad. Sci. USA 96:3882.-3887. This article has been cited by other articles:
![]() |
T. Egawa, R. E. Tillman, Y. Naoe, I. Taniuchi, and D. R. Littman The role of the Runx transcription factors in thymocyte differentiation and in homeostasis of naive T cells J. Exp. Med., August 6, 2007; 204(8): 1945 - 1957. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||