The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gottlieb, A. B.
Right arrow Articles by Krueger, J. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gottlieb, A. B.
Right arrow Articles by Krueger, J. G.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Medline Plus Health Information
*Psoriasis
The Journal of Immunology, 2005, 175: 2721-2729.
Copyright © 2005 by The American Association of Immunologists

TNF Inhibition Rapidly Down-Regulates Multiple Proinflammatory Pathways in Psoriasis Plaques1

Alice B. Gottlieb2,*, Francesca Chamian{dagger}, Salman Masud*, Irma Cardinale{dagger}, Maria Veronica Abello{dagger}, Michelle A. Lowes{dagger}, Fei Chen*, Melissa Magliocco* and James G. Krueger{dagger}

* Clinical Research Center, University of Medicine and Dentistry of New Jersey -Robert Wood Johnson Medical School, New Brunswick, NJ 08901; and {dagger} Laboratory for Investigative Dermatology, Rockefeller University, New York, NY 10021


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The mechanisms of action of marketed TNF-blocking drugs in lesional tissues are still incompletely understood. Because psoriasis plaques are accessible to repeat biopsy, the effect of TNF/lymphotoxin blockade with etanercept (soluble TNFR) was studied in ten psoriasis patients treated for 6 months. Histological response, inflammatory gene expression, and cellular infiltration in psoriasis plaques were evaluated. There was a rapid and complete reduction of IL-1 and IL-8 (immediate/early genes), followed by progressive reductions in many other inflammation-related genes, and finally somewhat slower reductions in infiltrating myeloid cells (CD11c+ cells) and T lymphocytes. The observed decreases in IL-8, IFN-{gamma}-inducible protein-10 (CXCL10), and MIP-3{alpha} (CCL20) mRNA expression may account for decreased infiltration of neutrophils, T cells, and dendritic cells (DCs), respectively. DCs may be less activated with therapy, as suggested by decreased IL-23 mRNA and inducible NO synthase mRNA and protein. Decreases in T cell-inflammatory gene expression (IFN-{gamma}, STAT-1, granzyme B) and T cell numbers may be due to a reduction in DC-mediated T cell activation. Thus, etanercept-induced TNF/lymphotoxin blockade may break the potentially self-sustaining cycle of DC activation and maturation, subsequent T cell activation, and cytokine, growth factor, and chemokine production by multiple cell types including lymphocytes, neutrophils, DCs, and keratinocytes. This results in reversal of the epidermal hyperplasia and cutaneous inflammation characteristic of psoriatic plaques.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The TNF inhibitors are approved for use across a range of inflammatory disorders including rheumatoid arthritis, Crohn’s disease, ankylosing spondylitis, psoriatic arthritis, and psoriasis. Despite the fact that >500,000 patients have been treated with TNF-blocking drugs worldwide, the anti-inflammatory mechanisms of action of these agents in lesional tissue are incompletely understood. Most of the data in rheumatoid arthritis have been generated from studying circulating cells or proteins and inferring what may be happening in the synovium. The paucity of data is in part explained by the relative inaccessibility of the gastrointestinal tract and joints to repeated biopsy. The consequence of this lack of knowledge is that the reasons for the different efficacy and safety spectra of the TNF blockers (infliximab, adalimumab, and etanercept) are not well understood.

TNF has complicated effects on both cell differentiation and expression of inflammatory genes (1, 2, 3, 4). Despite the fact that many data have been generated in various cultured cell types, these in vitro models are not necessarily good models of interacting cell types involved in a tissue-specific autoimmune process. For example, genes induced by TNF are specific to the cell type and state of differentiation of the cell studied. Hence, there may be effects of TNF that are undiscovered in complicated cellular mixes of inflammatory diseases or which cannot be studied well in model systems. The recent approval of etanercept for psoriasis offers an opportunity to study in situ mechanisms of action because the skin is a relatively convenient and accessible tissue to study.

Psoriasis is a life-disabling disorder characterized by the presence of scaly, red, raised cutaneous lesions, which are widespread in ~25% of afflicted patients. Psoriatic plaques are histologically recognized by typical patterns of abnormal epidermal hyperplasia and differentiation, similar to that seen at the edges of acute and nonhealing wounds (regenerative maturation) (5, 6). However, in the past 20 years, it has become clear that these epidermal changes are secondary to robust immune activation within psoriatic plaques characterized by increased numbers and activation of both T lymphocytes and dendritic cells (DCs)3 (professional APCs) (7, 8, 9, 10, 11, 12, 13, 14, 15). Animal models demonstrate a role for T cell activation, local cutaneous T cells, and TNF (16, 17, 18). Clinically, agents that specifically block T cells or TNF clear psoriasis (19, 20, 21, 22, 23, 24). TNF blockade induced by either etanercept, a form of soluble p75 TNF receptor that binds both TNF and lymphotoxin (LT), or infliximab, a chimeric, monoclonal anti-TNF Ab, clears psoriasis. This clinical remission is associated with substantially decreased numbers of intraepidermal T cells and by normalization of epidermal proliferation and differentiation, as measured by decreased epidermal thickness and normalized protein expression of keratin 16 (K16) (20). It is not known whether the clinical and histological remission induced by TNF/LT blockade is due to effects on T cells, DCs, or both. Etanercept is an ideal agent with which to study the effect of TNF blockade on cellular immune regulation in plaques because its actions are thought to be due to neutralization of TNF and not to depletion of cells bearing cell surface TNF.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 Disclosures
 References
 
Patient studies

Adult patients with moderate to severe psoriasis were treated with etanercept monotherapy (25 mg s.c. twice weekly) for 24 wk under a protocol approved by the University of Medicine and Dentistry of New Jersey-Robert Wood Johnson Medical School Institutional Review Board. At the time this study was performed, the 25-mg twice-weekly dose was the only Food and Drug Administration-approved dose of etanercept for adults with psoriasis. Systemic and phototherapies were excluded for 1 mo before dosing, and topical medications were excluded for 2 wk before dosing. Eucerin cream (Beiersdorf) was the standard moisturizer used throughout the study but was not applied before study evaluations. Clinical efficacy was assessed using the Psoriasis Area and Severity Index (PASI) (25). At baseline, biopsies were taken from uninvolved skin and an index psoriasis lesion. Repeat biopsies were taken from the index lesion after 1, 3, and 6 mo of etanercept treatment. Our tissue-based analysis sought to determine the extent to which etanercept improved or reversed disease-defining pathology at different time points, and also how disease improvement correlated with suppression of specific inflammatory leukocyte subsets or inflammatory gene products. Laboratory-based evaluators were blinded to the clinical results until all data were collected.

Immunohistochemistry

Tissue sections were stained with hematoxylin (Fisher) and eosin (Shandon) (H&E) and with mouse anti-human mAbs to elastase (Dako), K16 (Sigma-Aldrich), ICAM-1 (BD Pharmingen), CD3 (BD Biosciences), and CD11c (BD Pharmingen). A secondary biotin-labeled horse anti-mouse Ab (Vector Laboratories) was amplified with the avidin-biotin complex (Vector Laboratories). 3-Amino-9-ethylcarbazole (Sigma-Aldrich) was the chromogen used. Epidermal thickness measures and cell counts (per mm per x10 field) were determined using computer-assisted image analysis (Image Pro-Plus (Media Cybernetics)). K16 and ICAM-1 protein expression were quantitated on a 0–4 scale, with 0 indicating a return to a normal staining pattern. Absence of suprabasal staining for K16 keratin is the normal pattern seen in normal or uninvolved skin and is assigned a score of 0.

Tissue mRNA gene expression

RNA was extracted from skin biopsies frozen in liquid nitrogen using the RNeasy Mini Kit (Qiagen). The RT-PCR was performed using EZ PCR core reagents and primers and probes (Applied Biosystems) as previously published (26). The primer sequences have been published for K16, inducible nitric oxide synthase (iNOS), IL-8, IFN-{gamma}, STAT-1, IL-12/IL-23p40, IL-23p19, monokine induced by IFN-{gamma} (MIG), and human acidic ribosomal protein (HARP) (26). Sequences of the other primers used for this study are: IL-1{beta} forward, GCACGATGCACCTGTACGAT; IL-1{beta} reverse, AGACATCACCAAGCTTTTTTGCT, IL-1{beta} probe, 6FAM-CTGAACTGCACGCTCCGGGACTC-TAMRA (GenBank accession number NM_000576); IL-6 forward, CCAGGAGCCCAGCTATGAAC; IL-6 reverse, CCCAGGGAGAAGGCAACTG, IL-6 probe, 6FAM-CCTTCTCCACAAGCGCCTTCGGT-TAMRA (GenBank accession number NM_000600); MIP-3{alpha} (CCL20) forward, GCTTTGATGTCAGTGCTGCTACTC; MIP 3{alpha} reverse, GTATCCAAGACAGCAGTCAAAGTTG; MIP-3{alpha} probe, 6FAM-TGCGGCGAATCAGAAGCAGCAA-TAMRA (GenBank accession number NM_004591); matrix metalloproteinase (MMP)-12 forward, AGCACTTCTTGGGTCTGAAAGTG; MMP-12 reverse; CGAGGTGCGTGCATCATCT; MMP-12 probe, 6FAM-CCGGGCAACTGGACACATCTACCC-TAMRA (GenBank accession number L23808); IFN-{gamma}-inducible protein-10 (IP-10/CXCL10) forward, TCCACGTGTTGAGATCATTGC; IP-10 reverse, AATTCTTGATGGCCTTCGATTC; IP-10 probe, 6FAM-ACAATGAAAAAGAAGGGTGAGAAGAGATGTCTGAA-TAMRA (GenBank accession number NM_001009191); CD83 forward, TCGACGCCCCCAATGA; CD83 reverse, CCCCGAGTTGCAGCTGG; CD83 probe, 6FAM-AGGCCCTATTCCCTGAAGATCCGAAACA-TAMRA (GenBank accession number NM_004233); granzyme B forward, GAGGCCCTCTTGTGTGTAACAAG; granzyme B reverse, CAGGCTCGTGGAGGCATG; granzyme B probe, 6FAM-CCAGGGCATTGTCTCCTATGGACGAA-TAMRA (GenBank accession number NM_004131); IL-19 forward, CATGCAACTCTATTCCCAGCTACTT; IL-19 reverse, AGGTCAAAGCTGCAGTGAGCCATGATTG; IL-19 probe, 6FAM-GGGTGTCTCAATCTGGCACC-TAMRA (GenBank accession number, AF276915); TNF-{alpha} forward, CCCAGGCAGTCAATCATCTTC; TNF-{alpha} reverse, GCTTGAGGGTTTGCTACAACA; TNF-{alpha} probe 6FAM-CGAACCCCGAGTGACAAGCCTGT-TAMRA (GenBank accession number NM_000594).

Immunofluorescence

Frozen lesional tissue sections from psoriasis patients (n = 4) were fixed in acetone and treated with 10% normal horse serum. For CD11c and iNOS colocalization experiments, sections were initially incubated overnight with purified CD11c (BD Pharmingen) (1/100) and then secondary Ab Alexa fluor 488 goat anti-mouse IgG1 (Molecular Probes) for 30 min (1/250). iNOS (R&D Systems) conjugated with Alexa fluor 546 (Molecular Probes) was then incubated with these CD11c-stained slides for 2 h (1/500). Images were acquired using appropriate filters of a Zeiss Axioplan 2I microscope with Plan Apochromat 20 x0.7NA lens and a Hamamatsu Photonics model C4742 "Orca" ER-cooled charge-coupled device camera, controlled by Universal Imaging MetaVue software.

Statistical analysis

Cell counts and gene expression changes were computed by Student’s t test, and significance was accepted as p < 0.05. U statistics (U score) were developed to rank patient responses by combining percent change in epidermal thickness and the presence or absence of K16 immunostaining into a response score (RS), as previously published (26, 27). This mathematical model describes psoriasis disease activity across the range of complete disease resolution to highly active disease present and stratifies patient responses from best (lowest score) to worst (highest score). Changes in inflammatory cells or genes, either singly or in combinations, were ranked by a similar U score stratification method, and comparison of multiples of up to three genes at a time was designated a pathway score. We ordered changes in individual patients by U scores, because nonparametric statistical methods make the fewest assumptions about quantitative cause/effect relationships. Correlations between the RS and lesional cell counts, gene expression, or the pathway score were then determined, and the r score is indicated for the given comparisons.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 Disclosures
 References
 
Clinical and histological responses

In this study of 10 patients with moderate to severe psoriasis vulgaris, etanercept decreased the PASI by a mean of 29% (range, 5–80% decrease) after 1 month treatment (p < 0.02), and 57% (range, 24–94% decrease) after 3 mo of treatment (p < 0.01). At 3 mo of treatment, 6 of 10 patients attained a PASI 50 response, whereas at 6 mo of treatment 6 of 10 patients attained a PASI 75 response. The time course and extent of improvement seen in patients in this trial are thus similar to outcomes seen in larger, blinded clinical trials (22, 24).

The effects of etanercept on disease histopathology, expression of K16 (immunohistochemistry and quantitative mRNA measures), and ICAM-1 expression in epidermal keratinocytes are illustrated in Fig. 1. In general, progressive reversal of epidermal acanthosis and psoriasiform rete elongation was seen during 6 mo of treatment, although near maximal improvement was noted in a few cases after 3 mo of treatment. After 6 mo of treatment, thinning of the epidermis and normalization of keratinocyte differentiation occurred in 9 of 10 subjects, and absence of K16 in suprabasal keratinocytes was noted in 8 of 10 cases. Likewise, expression of ICAM-1 by epidermal keratinocytes was eliminated in 8 of 10 cases after 6 mo of treatment. We consider that histological remission of psoriasis was attained in these 8 patients. The progression in disease improvement during 6 mo of treatment can be appreciated from the overall histopathology and from quantitative measures of epidermal thickness and K16 mRNA in biopsy specimens (Fig. 1).



View larger version (70K):
[in this window]
[in a new window]
  		FIGURE 1. Response to etanercept treatment. A, Decreased epidermal thickness, K16 mRNA (normalized to HARP), K16 protein, keratinocyte ICAM-1 at baseline nonlesional (BL NL), baseline lesional (BL LS), 1, 3, and 6 mo of treatment. K16 and ICAM-1 protein staining quantitated on a 0–4 scale. B, Representative photomicrographs of H&E- and K16-stained frozen skin sections from a responding, etanercept-treated patient showing gradual reversal of psoriasis features (x10). K16 mRNA value (normalized to HARP) for this patient is indicated at the bottom of the photomicrograph, showing direct relationship to protein immunostaining. There is progressive reduction in K16 mRNA in association with a decrease in K16 protein in this individual patient. Comparison of results in treatment groups to lesional results, p value indicated.

 
Etanercept decreases myeloid DCs and T cells in plaques

CD11c is a marker for a group of DCs with very large increases in the epidermis and dermis of psoriasis lesions (26, 28, 29). Both CD11c+ DCs and CD3+ T cells were highly increased in pretreatment plaques compared with uninvolved skin (Fig. 2). Etanercept treatment resulted in progressive decreases in total CD3+ and CD11c+ cell populations (Fig. 2) as well as pathological epidermal thickness (Fig. 1). However, for both DCs and T cells, decreases in intraepidermal cell numbers were more marked than in dermal cell numbers. For example, the mean decrease in epidermal CD11c+ cells was 95% at 6 mo vs 60% for dermal CD11c+ cells. Additionally, the decrease in intraepidermal DCs was greater than that of intraepidermal T cells (95% vs 74%, respectively).



View larger version (81K):
[in this window]
[in a new window]
  		FIGURE 2. Decreased cellular infiltration in epidermis and dermis of psoriasis plaques in response to etanercept treatment. CD3+ cells (A) and CD11c+ cells (B) at baseline nonlesional (BL NL), baseline lesional (BL LS), and 1, 3, and 6 mo of treatment. C, Representative photomicrographs of CD3+ and CD11c+ immunostained frozen skin sections from a patient responding to etanercept, showing gradual reversal of CD3+ and CD11c+ cells infiltrating psoriasis lesions (x10). Comparison of results in treatment groups to lesional results, p value indicated.

 
To describe overall improvement in psoriasis at the various analysis time points, we used a new multivariate tool that generates a RS by integrating epidermal thickness, K16 mRNA levels, and K16 protein in suprabasal keratinocytes (27). This mathematical model describes psoriasis disease activity across the range of complete disease resolution to highly active disease present, and stratifies patient responses from best (lowest score) to worst (highest score). The RS, which is a multivariate U score, can then be used to establish the extent to which a given degree of improvement is related to modulation of inflammatory cell types or inflammatory gene products in that biopsy. Overall, we found that reversal of epidermal hyperplasia (quantified as the RS) was more highly correlated with reductions in CD11c+ cells than T cells, especially for infiltration of the epidermis by these cell subsets (Fig. 3). Taken together, these observations suggest that inflammatory leukocytes may act locally in the epidermis to produce the psoriatic phenotype and that DCs may play a larger role than previously suspected.



View larger version (21K):
[in this window]
[in a new window]
  		FIGURE 3. Correlation of RS with decreased numbers of CD3+ cells or CD11c+ cells at 1 mo of treatment. RS describes psoriasis disease activity across the range of complete disease resolution to highly active disease present, and stratifies patient responses from best (lowest score) to worst (highest score). This score is then correlated with change in epidermal and total CD3+ and CD11c+ cells at 1 mo (positive value is least change/reduction, negative value is highest change/reduction), with r value for each comparison indicated.

 
Effects on expression of inflammation-related genes

Table I lists numerous inflammation-related gene products that are increased in psoriasis lesions and that were assessed by real time RT-PCR during etanercept-induced disease improvement (30, 31, 32, 33, 34, 35). These products include early genes induced by TNF in model systems (Il-1{beta}, IL-8, MIP-3{alpha}, IL-6), type 1 pathway genes broadly related to IFN-regulated responses (IL-23, STAT-1, MIG, iNOS, IP-10, IL-8) (36, 37), and genes typically activated in myeloid cells (iNOS, IL-19, MMP-12, IL-23, CD83) vs lymphocytes (granzyme B, IFN-{gamma}). In previous work, we have proposed this type 1 pathway of gene activation, which may control pathogenic inflammation in psoriasis lesions. According to this model, several upstream cytokines (including IL-23, IFN-{gamma}, TNF) induce expression of end stage inflammatory genes such as iNOS or IL-8 (36). These gene groups are not mutually exclusive, e.g.: IL-8 is an early response gene but can also be a secondary product of the type 1 pathway; iNOS is produced by myeloid DCs but is also a product of the type 1 pathway.


View this table:
[in this window]
[in a new window]
  		Table I. Functional significance of genes evaluated during etanercept treatment of psoriasis patients, and correlation of mRNA level and RS at 1 mo

 
Fig. 4 illustrates expression of each of these gene products (normalized to HARP) in uninvolved skin vs psoriatic skin lesions at baseline and after 1, 3, and 6 mo of etanercept treatment. Two basic patterns of gene regulation by etanercept are seen. IL-1 and IL-8, which are considered to be immediate response genes to induction by TNF, are strongly suppressed at all analysis time points, and the suppression appears to be maximal by 1 mo of treatment. In contrast, most other gene products show more gradual reductions and, in general, they are most strongly suppressed after 6 mo of continuous etanercept treatment. At the 1-mo time point, the degree to which late genes were suppressed by etanercept was highly variable in different patients, but the suppression was much more consistent at later time points (the p values reflect this response trend).



View larger version (33K):
[in this window]
[in a new window]
  		FIGURE 4. Reduced inflammatory gene expression in response to etanercept treatment. Results of RT-PCR for a panel of genes increased in psoriasis and the effect of etanercept treatment on their expression (normalized to HARP) at baseline nonlesional (BL NL), baseline lesional (BL LS), and after 1, 3, and 6 mo of treatment. Comparison of results in treatment groups to lesional results, p value indicated. Bottom right panel indicates the correlation at 1 mo between RS and pathway score (comprising change in expression of a combination of IL-1, STAT-1, IL-12p40), with r value indicated.

 
The relationship between individual gene expression at 1 mo of etanercept treatment and psoriatic disease phenotype (as measured by the RS) is demonstrated in Table I (r score). This time point was chosen because this is when the largest range of responses were evident. Psoriasis disease improvement at 1 mo was highly related to IL-1, MMP-12, and several type 1 pathway products (STAT-1, IL-23, MIG, IL-8, and iNOS). However, changes in gene expression should be considered in the context of reduced numbers of infiltrating leukocytes during the analysis period. The correlations between disease improvement and iNOS mRNA levels (r = 0.83; Table I) and CD11c+ DCs (r = 0.70; Fig. 3) are interrelated events, because iNOS production is restricted to this cell subset (see analysis below). Similarly, reductions in T cells in tissue could explain part of the reduction in gene expression linked to T cells, e.g., IFN-{gamma} or granzyme B mRNAs. Additionally, total plaque neutrophil counts decreased from a mean of 485 ± 368 in pretreatment plaques to 170 ± 343 (p = 0.03) after only 1 mo of etanercept treatment (as quantitated by neutrophil elastase). Reductions in total neutrophil counts correlated with decreased IL-8 gene expression (data not shown). Even so, the suppression of lineage-associated inflammatory genes occurs more quickly and to a larger extent than overall reductions in associated leukocyte subsets. The observed decreases in IL-8, IP-10, and MIP-3{alpha} mRNA expression may account for decreased infiltration of neutrophils, T cells, and DCs, respectively.

Because inflammatory gene sets may be additive or interactive for producing pathogenic inflammation, we also used a novel method to assess which combination of genes was most highly correlated with the RS at different analysis time points (27). At 1 mo, there was a high correlation (r = 0.91, p < 0.001) between the combined expression of IL-1, STAT-1, and IL-23/IL-12 p40 mRNAs, as illustrated in the bottom right panel of Fig. 4. However, the final degree of disease improvement seen at 6 mo was associated with a different set of inflammatory gene products, with the combined expression of IFN-{gamma}, granzyme B, and IL-19 mRNAs most correlated (r = 0.93) with the RS (data not shown). Thus, the disease-resolution response to etanercept is a rapid and complete reduction in IL-1 and IL-8 (immediate/early genes), followed by progressive reductions in many other inflammation-related genes, and finally somewhat slower reductions in infiltrating myeloid cells and T lymphocytes.

Etanercept causes a decrease in iNOS protein in DCs

In general, expression of inflammatory genes was decreased to a greater extent than infiltrating DCs or T cells. This was particularly true for the earlier time points and suggests that etanercept reduces expression of inflammatory genes produced by infiltrating leukocytes, rather than just reducing trafficking of leukocytes and constitutive gene products. Recently, we have determined that iNOS-producing myeloid (CD11c+) DCs are tremendously increased in psoriasis lesions (29). Because iNOS mRNA is jointly regulated by NF{kappa}B and STAT-1 (TNF- and IFN-induced transcription factors, respectively), we examined the production of iNOS protein in CD11c+ cells in lesions using two-color immunofluorescence microscopy (Fig. 5). We consistently observed that before etanercept treatment, there were abundant CD11c+/iNOS+ cells. However, in etanercept-treated biopsies, there were numerous CD11c+ cells with little or no detectable iNOS protein expression.



View larger version (45K):
[in this window]
[in a new window]
  		FIGURE 5. Reduction in iNOS protein expression in CD11c+ cells after 1 mo of etanercept treatment. A, Psoriasis lesional skin showing numerous epidermal and dermal CD11c, iNOS double-positive cells (yellow cells in right panel). B, Substantial reduction with etanercept treatment for 1 mo.

 
Because iNOS expression by DCs can be viewed as a TNF-mediated activation-related response, we also studied expression of other activation or maturation-related DC products. The IL-23p19 mRNA, which is induced in monocyte-derived DCs in response to a TNF-containing maturation stimulus, was significantly down-regulated in 3- and 6-mo biopsies (Fig. 4). Another marker of mature/activated DCs is CD83. We observed virtual elimination of CD83 immunoreactivity in several etanercept-treated cases (data not shown) and in agreement with reduced CD83 mRNA expression by 3 mo (Fig. 4). Limited availability of biopsy sections prevented quantitative analysis of CD83 expression in etanercept-treated lesions from all patients; thus a formal correlation between response and CD83 protein expression could not be attained.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
Disclosures
 References
 
Past studies of therapeutic mechanism(s) with TNF antagonists have been conducted in patients with rheumatoid arthritis and psoriatic arthritis. Several studies support the general view that TNF antagonists reduce expression of vascular adhesion molecules (selectins, VCAM, ICAM-1) with attendant reductions in trafficking of leukocytes to inflamed synovium. However, much of this analysis has been focused on circulating cytokines, soluble fragments of cell adhesion molecules, and properties of peripheral leukocytes, because access to the affected tissue is difficult (38, 39, 40, 41, 42, 43, 44, 45, 46). Analyses conducted on inflamed synovium have shown reduced infiltration by CD68+ myeloid cells (most likely tissue macrophages), but reductions in infiltrating T cells have been measured less consistently (47, 48). Reduced expression of mRNA for several cytokines that regulate angiogenesis has been measured in synovial tissue after infliximab treatment (48), but comparable data for inflammatory cytokines do not exist and a time course of cellular/molecular inflammatory events is difficult to construct.

In contrast, the accessibility of diseased skin tissue in psoriasis has made it possible to study sequential alterations in inflammatory leukocytes and numerous inflammation-associated gene products during etanercept treatment. Although it may be predictable that inflammatory genes and infiltrating cells are decreased by this therapy, it is important to perform a detailed characterization and time course of these events to develop insights into such issues as why patients respond, the molecular and cellular mechanisms of action, and developing new applications for biological therapies.

We have developed methods to quantify the extent of disease burden via cellular and genomic measures of epidermal hyperplasia (the response score or RS) and methods to quantify infiltrating leukocytes and numerous inflammation-associated genes within a single biopsy specimen. Our analysis of the therapeutic mechanism of etanercept has also been greatly aided by a series of recent genomic studies of psoriasis vulgaris that point to a series of inflammatory genes (type 1 genes), which can act in a sequential manner or a cascade to produce numerous cellular features of this disease (36, 49). The view of therapeutic action of etanercept obtained in this study is much more detailed than any previous study of a TNF inhibitor in human disease, and it is conceptually different from most models of TNF inhibition in arthritis.

The genomic approach to study inflammatory gene expression after etanercept treatment is based on the idea that genes induced by TNF or LT will be suppressed by cytokine blockade. However, expression of TNF or LT mRNA in producing cells may not be affected by blocking the protein product, because they are likely to regulated by other stimuli. Hence, we have not concentrated on these gene products (TNF and LT) in the downstream analysis of inflammatory gene expression.

In this study, the most consistent cellular effects of etanercept were 1) reductions in keratinocyte hyperplasia (reflected in epidermal thickness measures, K16 expression, and the integrated RS) and 2) reductions in CD11c+ myeloid cells, which are best classified as myeloid DCs (26). Virtually all CD11c+ DCs synthesize iNOS at high levels, and we found that reduced expression of iNOS mRNA as a single gene product was highly correlated with etanercept-induced therapeutic improvement (Table I), whereas expression of iNOS protein was clearly reduced in CD11c+ cells (Fig. 5). The enzyme iNOS produces NO from arginine and NO is a molecule with both cell-damaging properties and the ability to dilate small blood vessels. In psoriasis, NO may be a trigger for keratinocyte hyperplasia and a factor accounting for skin erythema, through its vasoactive effects (50, 51). Up-regulation of iNOS mRNA in DCs may also be a general sentinel of activation occurring in this cell type. Past studies in mice have found critical roles of TNF and LT in the generation of DCs (52, 53, 54, 55), so a central effect of TNF/LT blockade in psoriatic lesions may be related to blocked in situ differentiation of these cells from circulating or resident precursors. The reduced expression of IL-23, previously traced to myeloid DCs in psoriasis lesions (56) and reduced expression of CD83 (a marker of mature DCs in humans), also suggest a major impact of etanercept on DCs in psoriasis. Changes in T cell infiltrates and reduced expression of IFN-{gamma} and granzyme B may all be secondary to reduced stimulation of T cells in situ by activated DCs. We note, however, that reduced synthesis of IFN-{gamma} by T cells might also be directly attributed to TNF inhibition (57). Gradual reductions in T cells and DCs in psoriasis skin lesions may also be produced by reductions in IP-10 and MIP-3{alpha}, respectively (30, 58). Rapid reductions in neutrophils may be produced by reductions in IL-8 (59). ICAM-1 expression by dermal blood vessels did not appear to be reduced by etanercept (data not shown). Accordingly, a reduced chemokine stimulus for cell migration into skin seems more likely as a mechanism to explain decreased migration of leukocytes into the dermis. In contrast, ICAM-1 expression by keratinocytes is down-regulated during etanercept treatment; thus, migration of leukocytes from the dermis into the epidermis could be blocked by direct modulation of adhesion molecules (60, 61).

The direct activation of epidermal keratinocytes by TNF or LT may also be an important pathogenic mechanism in psoriasis. A recent study using gene arrays has identified >70 genes that are up-regulated in human keratinocytes after TNF exposure (1). A large number of TNF-induced genes encode chemokines, cytokines, and other proinflammatory molecules that would be expected to enhance leukocyte recruitment into the skin and subsequent cellular activation. IL-1{beta}, IL-8, and IP-10 were identified as TNF-regulated products in keratinocytes using gene arrays, and all of these genes were strongly suppressed in psoriasis lesions during etanercept treatment. ICAM-1 mRNA was induced in keratinocytes after TNF treatment, and our data show decreased expression of ICAM-1 protein in keratinocytes after etanercept treatment. TNF also induces cytokines that stimulate proliferation of resident cells in the skin. TGF-{alpha}, nerve growth factor, endothelial cell growth factor, and vascular endothelial cell growth factor are increased in keratinocytes after TNF treatment. These factors were not studied in cutaneous lesions during etanercept treatment, but several angiogenic cytokines are decreased in synovium from psoriatic arthritis after TNF blockade. Accordingly, it seems likely that etanercept exerts major therapeutic actions in psoriasis skin lesions by down-regulating expression of proinflammatory and proproliferative genes that are induced in keratinocytes (as well as other skin-resident cell types) by local synthesis of TNF.

The inflammatory response to TNF could be self-sustaining, because activated DCs are a major source of TNF in psoriasis lesions (18) and because TNF mRNA is induced in keratinocytes after TNF exposure (1). Treatment with etanercept could provide the means to break this self-amplifying inflammatory cascade, but etanercept produces relatively slow down-regulation of some proinflammatory genes in psoriasis lesions. The progressive down-regulation of genes like IP-10 or iNOS during 6 mo of treatment with etanercept contrasts sharply with the rapid induction of these genes in cultured cells after treatment with TNF (1) and also with rapid cellular responses to TNF in sepsis. The most likely explanation for this apparent discrepancy is that proinflammatory genes like IP-10 and iNOS are controlled by multiple transcription factors induced by different classes of inflammatory cytokines (62). Hence, in chronic inflammatory diseases, TNF might broadly tune levels of proinflammatory gene expression, rather than act as a strict on/off switch for inflammatory responses. The expression of TNF and/or LT in cutaneous inflammatory sites may also promote in situ activation/maturation of myeloid DCs, such that therapeutic inhibition of these cytokines gradually collapses organized T/DC infiltrates that sustain inflammation in the skin (36). Accordingly, TNF/LT cytokines can effectively bridge innate and acquired immune responses by inducing early inflammatory genes and also supporting the development of other cellular and cytokine networks that lead to long range enhancement of T cell-mediated responses.


   Disclosures
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
References
 
Three of the authors are connected with Amgen: A. B. Gottlieb is an investigator, consultant, and speaker; J. G. Krueger receives research funding; and M. Magliocco has partial research funding and a Clinical Immunology Fellowship.


   Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported in part by an investigator-initiated study (to A.B.G.) funded by Amgen, by general support to the Psoriasis Center of Excellence by Beiersdorf (to A.B.G.), by a grant from the David Ju Foundation (to A.B.G.), and by a General Clinical Research Center Grant (M01-RR00102) from the National Center for Research Resources at the National Institutes of Health, and by National Institutes of Health Grants R01 AI-49572 and AI-49832 (to J.G.K.). Back

2 Address correspondence and reprint requests to Dr. Alice Bendix Gottlieb, Clinical Research Center, University of Medicine and Dentistry of New Jersey-Robert Wood Johnson Medical School, 51 French Street, New Brunswick, NJ 08901-0019. E-mail address: alice.gottlieb{at}umdnj.edu Back

3 Abbreviations used in this paper: DC, dendritic cell; IP-10 (CXCL10), interferon-{gamma}-inducible protein-10; iNOS, inducible nitric oxide synthase; K16, keratin 16; LT, lymphotoxin; MMP, matrix metalloproteinase; MIG, monokine induced by IFN-{gamma}; PASI, Psoriasis Area and Severity Index; RS, response score; HARP, human acidic ribosomal protein. Back

Received for publication February 25, 2005. Accepted for publication June 6, 2005.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Banno, T., A. Gazel, M. Blumenberg. 2004. Effects of tumor necrosis factor-{alpha} (TNF{alpha}) in epidermal keratinocytes revealed using global transcriptional profiling. J. Biol. Chem. 279: 32633-32642. [Abstract/Free Full Text]
  2. Norris, D. A.. 1990. Cytokine modulation of adhesion molecules in the regulation of immunologic cytotoxicity of epidermal targets. J. Invest. Dermatol. 95: 111S-120S. [Medline]
  3. Old, L. J.. 1985. Tumor necrosis factor (TNF). Science 230: 630-632. [Free Full Text]
  4. Zhou, A., S. Scoggin, R. Gaynor, N. S. Williams. 2003. Identification of NF{kappa}B-regulated genes induced by TNF{alpha} utilizing expression profiling and RNA interference. Oncogene 22: 2054-2064. [Medline]
  5. Mansbridge, J. N., A. M. Knapp. 1987. Changes in keratinocyte maturation during wound healing. J. Invest. Dermatol. 89: 253-263. [Medline]
  6. Gottlieb, A. B., R. M. Grossman, L. Khandke, D. M. Carter, P. B. Sehgal, S. M. Fu, A. Granelli-Piperno, M. Rivas, L. Barazani, J. G. Krueger. 1992. Studies of the effect of cyclosporine in psoriasis in vivo: combined effects on activated T lymphocytes and epidermal regenerative maturation. J. Invest. Dermatol. 98: 302-309. [Medline]
  7. Gottlieb, A. B., B. Lifshitz, S. M. Fu, L. Staiano-Coico, C. Y. Wang, D. M. Carter. 1986. Expression of HLA-DR molecules by keratinocytes and presence of Langerhans cells in the dermal infiltrate of active psoriatic plaques. J. Exp. Med. 164: 1013-1028. [Abstract/Free Full Text]
  8. Gottlieb, A. B., J. G. Krueger. 1990. HLA region genes and immune activation in the pathogenesis of psoriasis. Arch. Dermatol. 126: 1083-1091. [Abstract/Free Full Text]
  9. Gottlieb, A. B., J. G. Krueger, L. Khandke, R. M. Grossman, J. Krane, D. M. Carter. 1991. Role of T cell activation in the pathogenesis of psoriasis. Ann. NY Acad. Sci. 636: 377-379. [Medline]
  10. Gottlieb, S. L., P. Gilleaudeau, R. Johnson, L. Estes, T. G. Woodworth, A. B. Gottlieb, J. G. Krueger. 1995. Response of psoriasis to a lymphocyte-selective toxin (DAB389IL-2) suggests a primary immune, but not keratinocyte, pathogenic basis. Nat. Med. 1: 442-447. [Medline]
  11. Krueger, J.. 2002. The immunologic basis for the treatment of psoriasis with new biologic agents. J. Am. Acad. Dermatol. 46: 1-26. [Medline]
  12. Nestle, F., L. Turka, B. Nickoloff. 1994. Characterization of dermal dendritic cells in psoriasis: autostimulation of T lymphocytes and induction of Th1 type cytokines. J. Clin. Invest. 94: 202-209.
  13. Nickoloff, B. J., C. E. M. Griffiths. 1990. Lymphocyte trafficking in psoriasis: a new perspective emphasizing the dermal dendrocyte with active dermal recruitment mediated via endothelial cells followed by intra-epidermal T-cell activation. J. Invest. Dermatol. 95: 35S-37S. [Medline]
  14. Baker, B. S., A. F. Swain, C. E. M. Griffiths, J. N. Leonard, L. Fry, H. Valdimarsson. 1985. Epidermal T lymphocytes and dendritic cells in chronic plaque psoriasis: the effects of PUVA treatment. Clin. Exp. Immunol. 61: 526-534. [Medline]
  15. Bos, J. D., I. D. VanGarderen, S. R. Krieg, L. W. Poulter. 1986. Different in situ distribution patterns of dendritic cells haveing Langerhans (T6) and interdigitating (RFD+) cell immunophenotype in psoriasis, atopic dermatitis, and other inflammatory dermatoses. J. Invest. Dermatol. 87: 358-361. [Medline]
  16. Wrone-Smith, T., B. J. Nickoloff. 1996. Dermal injection of immunocytes induces psoriasis. J. Clin. lnvest. 98: 1878-1887. [Medline]
  17. Gilhar, A., M. David, Y. Ullmann, T. Berkutski, R. S. Kalish. 1997. T-lymphocyte dependence of psoriatic pathology in human psoriatic skin grafted to SCID mice. J. Invest. Dermatol. 109: 283-288. [Medline]
  18. Boyman, O., H. P. Hefti, C. Conrad, B. Nickoloff, M. Suter, F. O. Nestle. 2004. Spontaneous development of psoriasis in a new animal model shows an essential role for resident T cells and tumor necrosis factor {alpha}. J. Exp. Med. 199: 731-736. [Abstract/Free Full Text]
  19. Chaudhari, U., P. Romano, L. D. Mulcahy, L. T. Dooley, D. G. Baker, A. B. Gottlieb. 2001. Efficacy and safety of infliximab monotherapy for plaque-type psoriasis: a randomised trial. Lancet 357: 1842-1847. [Medline]
  20. Gottlieb, A. B., S. Masud, R. Ramamurthi, A. Abdulshani, P. Romano, U. Chaudhari, L. T. Dooley, A. A. Fasanmade, C. Wagner. 2003. Pharmacodynamic and pharmacokinetic response to anti-tumor necrosis factor-{alpha} monoclonal antibody (infliximab) treatment of moderate to severe psoriasis vulgaris. J. Am. Acad. Dermatol. 48: 68-75. [Medline]
  21. Gottlieb, A. B.. 2003. Clinical research helps elucidate the role of tumor necrosis factor-{alpha} (TNF-{alpha}) in the pathogenesis of T1 mediated immune disorders: use of targeted immunotherapeutics as pathogenic probes. Lupus 12: 192-194.
  22. Gottlieb, A. B., R. T. Matheson, N. Low, G. G. Krueger, S. Kang, B. S. Goffe, A. A. Gaspari, M. Ling, G. D. Weinstein, A. Nayak, K. B. Gordon, R. Zitnik. 2003. A randomized trial of etanercept as monotherapy for psoriasis. Arch. Dermatol. 139: 1627-1632. [Abstract/Free Full Text]
  23. Gottlieb, A. B.. 2004. Etanercept for the treatment of psoriasis and psoriatic arthritis. Dermatol. Ther. 17: 401-408. [Medline]
  24. Leonardi, C. L., J. L. Powers, R. T. Matheson, B. Goffe, R. Zitnik, A. Wang, A. B. Gottlieb. 2003. Etanercept as monotherapy in patients with psoriasis. N. Engl. J. Med. 349: 2014-2022. [Abstract/Free Full Text]
  25. Frederiksson, T., U. Pettersson. 1978. Severe psoriasis oral therapy with a new retinoid. Dermatologica 157: 238-244. [Medline]
  26. Chamian, F., M. A. Lowes, S.-L. Lin, E. Lee, T. Kijuchi, P. Gilleaudeau, M. Sullivan-Whalen, I. Cardinale, A. Khatcherian, I. Novitskaya, K. M. Wittkowski, J. G. Krueger. 2005. Alefacept reduces infiltrating T cells, activated dendritic cells and inflammatory genes in psoriasis vulgaris. Proc. Natl. Acad. Soc. USA 102: 2075-2080. [Abstract/Free Full Text]
  27. Wittkowski, K. M., E. Lee, R. Nussbaum, F. Chamian, J. G. Krueger. 2004. Combining several ordinal measures in clinical studies. Stat. Med. 23: 1579-1592. [Medline]
  28. Wollenberg, A., M. Wagner, S. Gunther, A. Towarowski, E. Tuma, M. Moderer, S. Rothenfusser, S. Wetzel, S. Endres, G. Hartmann. 2002. Plasmacytoid dendritic cells: a new cutaneous dendritic cell subset with distinct role in inflammatory skin diseases. J. Invest. Dermatol. 119: 1096-1102. [Medline]
  29. Chamian, F., S. Lin, I. Novitskaya, H. Carbonaro, I. Cardinale, T. Kikuchi, P. Gilleaudeau, K. Wittkowski, K. Papp, M. R. Garovoy, W. Dummer, J. G. Krueger. 2004. Presence of "inflammatory" dendritic cells in psoriasis vulgaris lesions and modulation by efalizumab (anti-CD11a). J. Invest. Dermatol. 122: A41
  30. Gottlieb, A. B., A. D. Luster, D. N. Posnett, D. M. Carter. 1988. Detection of a {gamma}-interferon-induced protein (IP-10) in psoriatic plaques. J. Exp. Med. 168: 941-948. [Abstract/Free Full Text]
  31. Grossman, R. M., J. Krueger, D. Yourish, A. Granelli-Piperno, D. P. Murphy, L. T. May, T. S. Kupper, P. B. Sehgal, A. B. Gottlieb. 1989. Interleukin-6 (IL-6) is expressed in high levels in psoriatic skin and stimulates proliferation of cultured human keratinocytes. Proc. Natl. Acad. Sci. USA 86: 6367-6371. [Abstract/Free Full Text]
  32. Austin, L., M. Ozawa, T. Kikuchi, I. Walters, J. Krueger. 1999. The majority of epidermal T cells in psoriasis vulgaris lesions can produce type 1 cytokines, interferon-{gamma}, interleukin-2, and tumor necrosis factor-{alpha}, defining TC1 (cytotoxic T lymphocyte) and Th1 effector populations: a type 1 differentiation bias is also measured in circulating blood T cells in psoriatic patients. J. Invest. Dermatol. 113: 752-759. [Medline]
  33. Lee, E., W. Trepicchio, J. Oestreicher, D. Pittman, F. Wang, F. Chamian, M. Dhodapkar, J. G. Krueger. 2004. Increased expression of interleukin 23 p19 and p40 in lesional skin of patients with psoriasis vulgaris. J. Exp. Med. 199: 125-130. [Abstract/Free Full Text]
  34. Oestreicher, J. L., B. I. Walters, T. Kikuchi, P. Gilleaudeau, J. Surette, U. Schwertschlag, A. J. Dorner, J. G. Krueger, W. L. Trepicchio. 2001. Molecular classification of psoriasis disease-associated genes through pharmacodynamic expression profiling. Pharmacogenomics J. 1: 272-287. [Medline]
  35. Suomela, S., A. L. Kariniemi, E. Snellman, U. Saarialho-Kere. 2001. Metalloelastase (MMP-12) and 92-kDa gelatinase (MMP-9) as well as their inhibitors, TIMP-1 and -3, are expressed in psoriatic lesions. Exp. Dermatol. 10: 175-183. [Medline]
  36. Lew, W., A. M. Bowcock, J.G. Krueger. 2004. Psoriasis vulgaris: cutaneous lymphoid tissue supports T-cell activation and "type 1" inflammatory gene expression. Trends Immunol. 25: 295-305. [Medline]
  37. Lew, W., E. Lee, J. G. Krueger. 2004. Psoriasis genomics: analysis of proinflammatory (type 1) gene expression in large plaque (Western) and small plaque (Asian) psoriasis vulgaris. Br. J. Dermatol. 150: 668-676. [Medline]
  38. Paleolog, E. M., M. Hunt, M. J. Elliott, M. Feldmann, R. N. Maini, J. N. Woody. 1996. Deactivation of vascular endothelium by monoclonal anti-tumor necrosis factor-{alpha} antibody in rheumatoid arthritis. Arthritis Rheum. 39: 1082-1091. [Medline]
  39. Schuerwegh, A. J., J. F. Van Offel, W. J. Stevens, C. H. Bridts, L. S. De Clerck. 2003. Influence of therapy with chimeric monoclonal tumour necrosis factor-{alpha} antibodies on intracellular cytokine profiles of T lymphocytes and monocytes in rheumatoid arthritis patients. Rheumatology 42: 541-548. [Abstract/Free Full Text]
  40. Schotte, H., B. Schluter, P. Willeke, E. Mickholz, M. Schorat, V. Domschke, M. Gaubitz. 2004. Long-term treatment with etanercept significantly reduces the number of proinflammatory cytokine-secreting peripheral blood mononuclear cells in patients with rheumatoid arthritis. Rheumatology 43: 960-964. [Abstract/Free Full Text]
  41. Catrina, A. I., J. Lampa, S. Ernestam, E. af Klint, J. Bratt, L. Klareskog, A. K. Ulfgren. 2002. Anti-tumour necrosis factor (TNF)-{alpha} therapy (etanercept) down-regulates serum matrix metalloproteinase (MMP)-3 and MMP-1 in rheumatoid arthritis. Rheumatology 41: 484-489. [Abstract/Free Full Text]
  42. Brennan, F. M., K. A. Browne, P. A. Green, J.-M. Jaspar, R. N. Maini, M. Feldmann. 1997. Reduction of serum matrix metalloproteinase 1 and matrix metalloproteinase 3 in rheumatoid arthritis patients following anti-tumour necrosis factor-{alpha} (cA2) therapy. Br. J. Rheum. 36: 643-650. [Abstract/Free Full Text]
  43. Klimiuk, P., S. Sierakowski, I. Domyslawaska, J. Chwiecko. 2004. Effect of repeated infliximab therapy on serum matrix metalloproteinases and tissue inhibitors of metalloproteinases in patients with rheumatoid arthritis. J. Rheumatol. 31: 238-240. [Abstract/Free Full Text]
  44. Drynda, S., C. Kuhne, J. Kekow. 2002. Soluble tumour necrosis factor receptor treatment does not affect raised transforming growth factor {beta} levels in rheumatoid arthritis. Ann. Rheum. Dis. 61: 254-256. [Abstract/Free Full Text]
  45. Tokayer, A., S. Carsons, B. Chokshi, F. Santiago-Schwarz. 2004. High levels of interleukin 13 in rheumatoid arthritis sera are modulated by tumor necrosis factor antagonist therapy: associated with dendritic cell growth activity. J. Rheumatol. 29: 454-461.
  46. Agnholt, J., J. F. Dahlerup, K. Kaltoft. 2003. The effect of etanercept and infliximab on the production of tumour necrosis factor {alpha}, interferon-{gamma} and GM-CSF in in vivo activated intestinal T lymphocyte cultures. Cytokines 23: 76-85.
  47. Tak, P.-P., P. C. Taylor, F. C. Breedveld, T. Smeets, M. R. Daha, P. M. Kluin, A. E. Meinders, R. N. Maini. 1996. Decrease in cellularity and expression of adhesion molecules by anti-tumor necrosis factor {alpha} monoclonal antibody treatment in patients with rheumatoid arthritis. Arthritis Rheum. 39: 1077-1081. [Medline]
  48. Canete, J. D., J. L. Pablos, R. Sanmarti, C. Mallofre, S. Marsal, J. Maymo, J. Gratacos, J. Mezquita, C. Mezquita, M. C. Cid. 2004. Antiangiogenic effects of anti-tumor necrosis factor {alpha} therapy with infliximab in psoriatic arthritis. Arthritis. Rheum. 50: 1636-1641. [Medline]
  49. Zhou, X., J. G. Krueger, M.-C. J. Kao, E. Lee, F. Du, A. Menter, M. D. W. H. Wong, A. M. Bowcock. 2003. Novel mechanisms of T-cell and dendritic cell activation revealed by profiling of psoriasis on the 63,100-element oligonucleotide array. Physiol. Genomics 13: 69-78. [Abstract/Free Full Text]
  50. Bogdan, C.. 2001. Nitric oxide and the immune response. Nat. Immunol. 2: 907-916. [Medline]
  51. Morhenn, V. B.. 1997. Langerhans cells may trigger the psoriatic disease process via production of nitric oxide. Immunol. Today 18: 433-436. [Medline]
  52. van Lieshout, A. W. T., P. Barrerera, R. L. Smeets, G. J. Pesman, P. L. C. M. van Riel, W. B. vanden Berg, T. R. D. J. Radstake. 2005. Inhibition of TNF-{alpha} during maturation of dendritic cells results in the development of semi-mature DC: a potential mechanism for the beneficial effects of TNF{alpha} blockade in rheumatoid arthritis. Ann. Rheum. Dis. 64: 408-414. [Abstract/Free Full Text]
  53. Ritter, U., A. Meissner, J. Ott, H. Korner. 2003. Analysis of the maturation process of dendritic cells deficient for TNF and lymphotoxin-{alpha} reveals an essential role for TNF. J. Leukocyte Biol. 74: 216-222. [Abstract/Free Full Text]
  54. Abe, K., F. O. Yarovinsky, T. Murakami, A. N. Shakhov, A. V. Tumanov, D. Ito, L. N. Drutskaya, K. Pfeffer, D. V. Kuprash, K. L. Kornschlies, S. A. Nedospasov. 2003. Distinct contributions of TNF and LT cytokines to the development of dendritic cells in vitro and their recruitment in vivo. Blood 101: 1477-1483. [Abstract/Free Full Text]
  55. Fukaya, H., W. Xiao, K. Inaba, Y. Suzuki, M. Hirokawa, Y. Hawabata, A. Komatsuda, T. Endo, H. Kishimotok, G. Tadada, K. Sawada. 2004. Codevelopment of dendritic cells along with erythroid differentiation from human CD34+ cells by tumor necrosis factor {alpha}. Exp. Hematol. 32: 450-460. [Medline]
  56. Gottlieb, A. B., R. Evans, S. Li, L. T. Dooley, C. Guzzo, A. D. Baker, M. Bala, C. W. Marano, A. Menter. 2004. Infliximab induction therapy for patients with severe plaque-type psoriasis: a randomized, double-blind, placebo-controlled trial. J. Am. Acad. Dermatol. 51: 534-542. [Medline]
  57. Agnholt, J., K. Kaltoft. 2001. Infliximab downregulates interferon-{gamma} production in activated gut T-lymphocytes from patients with Crohn’s disease. Cytokines 15: 212-222.
  58. Homey, B., M. Dieu-Nosjean, A. Wiesenborn, C. Massacrier, J. Pin, E. Oldham, D. Catron, M. Buchanan, A. Muller, R. de Waal Malfyt, G. Deng, R. Orozco, T. Ruzicka, P. Lehmann, S. Lebecque, C. Caux, A. Zlotnik. 2000. Up-regulation of macrophage inflammatory protein-3 {alpha}/CCL20 and CC chemokine receptor 6 in psoriasis. J. Immunol. 164: 6621-6632. [Abstract/Free Full Text]
  59. Barker, J. N., M. L. Jones, R. S. Mitra, E. Crockett-Torabe, J. C. Fantone, S. L. Kunkel, J. S. Warren, V. M. Dixit, B. J. Nickoloff. 1991. Modulation of keratinocyte-derived interleukin-8 which is chemotactic for neutrophils and T lymphocytes. Am. J. Pathol. 139: 869-876. [Abstract]
  60. Rothlein, R., M. Czajkowski, M. M. O’Neill, S. D. Marlin, E. Mainolfi, V. J. Merluzzi. 1988. Induction of intercellular adhesion molecule 1 on primary and continuous cell lines by pro-inflammatory cytokines: regulation by pharmacologic agents and neutralizing antibodies. J. Immunol. 141: 1665-1669. [Abstract]
  61. Singer, K. H., D. T. Tuck, H. A. Sampson, R. P. Hall. 1989. Epidermal keratinocytes express the adhesion molecule intercellular adhesion molecule-1 in inflammatory dermatoses. J. Invest. Dermatol. 92: 746-750. [Medline]
  62. Pine, R.. 1997. Convergence of TNF{alpha} and IFN{gamma} signalling pathways through synergistic induction of IRF-1/ISGF-2 is mediated by a composite GAS/{kappa}B promoter element. Nucleic Acids Res. 25: 4346-4354. [Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 J. Immunol.Home page
H. Wang, T. Syrovets, D. Kess, B. Buchele, H. Hainzl, O. Lunov, J. M. Weiss, K. Scharffetter-Kochanek, and T. Simmet
Targeting NF-{kappa}B with a Natural Triterpenoid Alleviates Skin Inflammation in a Mouse Model of Psoriasis
J. Immunol., October 1, 2009; 183(7): 4755 - 4763.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
A. S. Haider, M. A. Lowes, M. Suarez-Farinas, L. C. Zaba, I. Cardinale, A. Khatcherian, I. Novitskaya, K. M. Wittkowski, and J. G. Krueger
Identification of Cellular Pathways of "Type 1," Th17 T Cells, and TNF- and Inducible Nitric Oxide Synthase-Producing Dendritic Cells in Autoimmune Inflammation through Pharmacogenomic Study of Cyclosporine A in Psoriasis
J. Immunol., February 1, 2008; 180(3): 1913 - 1920.
[Abstract] [Full Text] [PDF]

Home page
 JEMHome page
L. C. Zaba, I. Cardinale, P. Gilleaudeau, M. Sullivan-Whalen, M. Suarez-Farinas, J. Fuentes-Duculan, I. Novitskaya, A. Khatcherian, M. J. Bluth, M. A. Lowes, et al.
Amelioration of epidermal hyperplasia by TNF inhibition is associated with reduced Th17 responses
J. Exp. Med., December 24, 2007; 204(13): 3183 - 3194.
[Abstract] [Full Text] [PDF]

Home page
 J. Leukoc. Biol.Home page
M. Facco, I. Baesso, M. Miorin, M. Bortoli, A. Cabrelle, E. Boscaro, C. Gurrieri, L. Trentin, R. Zambello, F. Calabrese, et al.
Expression and role of CCR6/CCL20 chemokine axis in pulmonary sarcoidosis
J. Leukoc. Biol., October 1, 2007; 82(4): 946 - 955.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
S. Iwamoto, S.-i. Iwai, K. Tsujiyama, C. Kurahashi, K. Takeshita, M. Naoe, A. Masunaga, Y. Ogawa, K. Oguchi, and A. Miyazaki
TNF-{alpha} Drives Human CD14+ Monocytes to Differentiate into CD70+ Dendritic Cells Evoking Th1 and Th17 Responses
J. Immunol., August 1, 2007; 179(3): 1449 - 1457.
[Abstract] [Full Text] [PDF]

Home page
 Ann Rheum DisHome page
A Kavanaugh, G G Krueger, A Beutler, C Guzzo, B Zhou, L T Dooley, P J Mease, D D Gladman, K de Vlam, P P Geusens, et al.
Infliximab maintains a high degree of clinical response in patients with active psoriatic arthritis through 1 year of treatment: results from the IMPACT 2 trial
Ann Rheum Dis, April 1, 2007; 66(4): 498 - 505.
[Abstract] [Full Text] [PDF]

Home page
 JEMHome page
J. R. Chan, W. Blumenschein, E. Murphy, C. Diveu, M. Wiekowski, S. Abbondanzo, L. Lucian, R. Geissler, S. Brodie, A. B. Kimball, et al.
IL-23 stimulates epidermal hyperplasia via TNF and IL-20R2-dependent mechanisms with implications for psoriasis pathogenesis
J. Exp. Med., November 27, 2006; 203(12): 2577 - 2587.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
M. Melikoglu, S. Uysal, J. G. Krueger, G. Kaplan, F. Gogus, H. Yazici, and S. Oliver
Characterization of the Divergent Wound-Healing Responses Occurring in the Pathergy Reaction and Normal Healthy Volunteers
J. Immunol., November 1, 2006; 177(9): 6415 - 6421.
[Abstract] [Full Text] [PDF]

Home page
 JEMHome page
C. Sutton, C. Brereton, B. Keogh, K. H.G. Mills, and E. C. Lavelle
A crucial role for interleukin (IL)-1 in the induction of IL-17-producing T cells that mediate autoimmune encephalomyelitis
J. Exp. Med., July 10, 2006; 203(7): 1685 - 1691.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gottlieb, A. B.
Right arrow Articles by Krueger, J. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gottlieb, A. B.
Right arrow Articles by Krueger, J. G.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Medline Plus Health Information
*Psoriasis

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS