| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
* Cambridge Institute for Medical Research, University of Cambridge, and
Department of Medicine, University of Cambridge School of Clinical Medicine, Cambridge, United Kingdom
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionDisclosuresReferences |
|---|
was the key to vaccine success. Recently, a role for IL-10 and regulatory T cells in parasite persistence was demonstrated, prompting re-evaluation of vaccine-induced immunity. We compared DNA/modified vaccinia virus Ankara heterologous prime-boost with Leishmania homolog of the receptor for activated C kinase (LACK) or tryparedoxin peroxidase (TRYP). Both induced low IL-4 and high IFN- prechallenge. Strikingly, high prechallenge CD4 T cell-derived IL-10 predicted vaccine failure using LACK, whereas low IL-10 predicted protection with TRYP. The ratio of IFN-:IL-10 was thus a clear prechallenge indicator of vaccine success. Challenge infection caused further polarization to high IL-10/low IFN- with LACK and low IL-10/high IFN- with TRYP. Ex vivo quantitative RT-PCR and in vitro depletion and suppression experiments demonstrated that Ag-driven CD4+CD25+ T regulatory 1-like cells were the primary source of IL-10 in LACK-vaccinated mice. Anti-IL-10R treatment in vivo demonstrated that IL-10 was functional in determining vaccine failure, rendering LACK protective in the presence of high IFN-/low IL-5 responses. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDisclosuresReferences |
|---|
to activate macrophages to control the parasite. That IFN- is crucial to pathogen clearance is not contested, because IFN- knockout mice (1, 2) fail to clear the parasite. However, what has become clear is that the ability to elicit an IFN- response is not the sole predictor of vaccine success. For example, Peters et al. (3) demonstrated that human volunteers vaccinated with avirulent Leishmania arabica parasites had strong IFN- responses but were not protected against challenge with virulent Leishmania major infection. One of the biggest challenges for development of a leishmanial vaccine is to understand the key immunological correlates of protection.
Studies of L. major infection in inbred mice underpin the Th1/Th2 paradigm (reviewed in Refs. 4 and 5). Primary immunity to L. major in resistant mice requires the induction of a polarized Th1 response (6, 7, 8). In contrast, susceptibility in BALB/c mice is associated with an aberrant Th2 response caused by the early production of IL-4 from a restricted population of V
4V
8 CD4+ T cells (9, 10). These studies supported the hypothesis that immunotherapy that shifts the balance from IL-4 to IFN- would provide the key to vaccine success. However, recent studies demonstrate that IL-10 is the important regulatory cytokine involved in parasite persistence in mice (11), the major source of which is CD4+CD25+ regulatory T cells (Tr)3 (12). Indeed, several studies now demonstrate a role for Tr in modulating both Th1 (12, 13) and Th2 (14, 15) activity in murine L. major infection. This important regulatory role of IL-10 and Tr led us to re-evaluate the key T cells and cytokines that are associated with vaccine failure or success in the susceptible BALB/c L. major infection model. In this study, we compare immune responses and challenge outcome following heterologous DNA/recombinant vaccinia virus Ankara (MVA) prime-boost (16), with the leishmanial Ags Leishmania homolog of the receptor for activated C kinase (LACK; Ref. 17) and tryparedoxin peroxidase (TRYP; Ref. 18). Both vaccines induced low levels of IL-4. Strikingly, however, high prechallenge IL-10 in the presence of high IFN- resulted in vaccine failure following LACK, whereas low IL-10 associated with comparable IFN- resulted in protection following TRYP vaccination. We demonstrate an Ag-driven CD4+CD25+ Tr1-like cell population making IL-10 in LACK-vaccinated mice, and show that IL-10 is the cytokine responsible for vaccine failure by administering anti-IL-10R Ab in vivo. We conclude that IL-10 levels relative to IFN- provide the best prechallenge predictor of vaccine success in this model.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDisclosuresReferences |
|---|
Female 5- to 6-wk-old BALB/c mice were purchased from Charles River Laboratories and were maintained in the Central Biomedical Services (University of Cambridge, Cambridge, U.K.) under pathogen-free conditions. All procedures were conducted under U.K. Government Home Office guidelines.
Plasmid construction and purification
LACK (aa 143–312, as originally defined in Ref. 17) and TRYP (full-length, aa 1–199, as described in Ref. 18) were amplified from cDNA clones lmk5 (accession number W88311) and lmf30 (accession number T67356), respectively, obtained from a L. major substrain LV39 (MRHO/SU/59/P) cDNA library (19). Both genes were inserted downstream of the CMV promoter into a modified version (minus the neomycin resistance gene) of the expression vector pcDNA3 (Invitrogen Life Technologies). Empty pcDNA3 was used as vector control. Plasmid DNA was purified using EndoFree Plasmid Maxi kits (Qiagen) with pyrogen-free material, and the final pellet was resuspended in pyrogen-free PBS.
Construction of rMVA and purification
The viral expression vector pMJ601 (20) was modified by replacing the early 7.5-kDa promoter and lacZ with the early/late 7.5-kDa promoter and the selectable marker gene vaccinia virus K1L, respectively, to generate pMJ601K1L. LACK and TRYP were cloned into the thymidine kinase locus of pMJ601 vector downstream of the synthetic strong promoter. rMVA was obtained by infecting permissive hamster Syrian kidney cells (BHK-21) with wild-type MVA and simultaneously transfecting BHK-21 cells with LACK, TRYP, or vector plasmids using the FuGENE 6 transfection reagent (Roche Diagnostics). After 48 h, infected cells were harvested, and rMVA was selected by plaque assay in nonpermissive rabbit kidney epithelial cells (RK13). Coinsertion of the vaccinia virus K1L gene with the Leishmania Ag confers rMVA the ability to grow in RK13 cells (21). This selection procedure was repeated three times, and the insertion of LACK and TRYP into the viral genome was confirmed by PCR. For vaccinations, semipurified stocks of rMVA grown in RK13 cells were prepared by ultracentrifugation through a sucrose cushion, resuspended in 10 mM Tris-HCl (pH 9), and stored at –80°C until required (22). Expression of protein from MVA-infected culture lysate was demonstrated by Western blotting using sera from DNA-vaccinated mice. The expected protein bands at 
18 kDa for LACK and at 22 kDa for TRYP were observed (data not shown).
Preparation of crude and recombinant Ags
Crude freeze-thawed parasite (FTP) Ag was prepared from stationary-phase promastigotes by resuspension in 10 mM Tris-HCl (pH 8.5), 0.5 M NaCl, 1 mM PMSF, and 50 µg/ml leupeptin, and freeze-thawing three times over liquid nitrogen. Recombinant proteins were prepared by cloning LACK and TRYP into the expression vector pET-15b (Novagen) and transformation into Escherichia coli BL21 (DE3) host cells (18). Recombinant proteins were purified by affinity chromatography after incubation of cleared supernatants with nickel-NTA agarose (Qiagen). Proteins were eluted with 10 mM Tris-HCl (pH 8.5), 0.5 M NaCl, and 200 mM imidazole, dialyzed, and further purified over Detoxi-Gel AffinityPak columns (Perbio Science) to remove endotoxin. Protein estimations were performed using the Bio-Rad protein assay (Bio-Rad Laboratories).
Immunization
Groups of 14 mice were injected s.c. into the shaven rump with two doses of 100 µg of LACK, TRYP, or vector DNA, 3 wk apart. At 5 wk, mice were boosted i.v. with 1 x 106 PFU of Ag-MVA or vector-MVA.
Infectious challenge
L. major substrain LV39 promastigotes were cultured at 26°C in Schneider’s insect medium (Sigma-Aldrich) supplemented with 10% FCS (Invitrogen Life Technologies), 2 mM L-glutamine, 50 U/ml penicillin, and 50 µg/ml streptomycin. BALB/c mice were challenged 2 or 16 wk postboost with 2 x 106 stationary-phase (days 5–6) promastigotes into the hind footpad. Footpad depth was determined by weekly measurement with Vernier calipers. In some experiments, parasite loads were determined in draining lymph nodes (LN) by limiting dilution analysis, usually 40 serial double dilutions of LN cell suspensions in liquid culture medium as above. Counts represented the number of parasite per LN.
In vivo recall
Two weeks postboost, BALB/c mice were injected in both hind footpads with 5 µg of FTP. Forty-eight hours later, mice were sacrificed and bled for serum, and draining LN were removed.
IgG isotype ELISA
Sera for Ab testing were collected from vaccinated mice 48 h after in vivo recall with FTP. Ag-specific Ab subclasses were measured by ELISA using recombinant LACK- or TRYP-coated plates and biotinylated rabbit anti-mouse IgG1 or IgG2a (Zymed Laboratories) detecting Abs. Detection was with streptavidin-HRP (DakoCytomation) and o-phenylenediamine substrate. Plates were read at 492 nm (OPTI-MAX; Molecular Devices).
Cytokine assays
Pooled cells from draining LN were cultured in RPMI 1640 (Invitrogen Life Technologies) at 6 x 105 cells/well in U-bottom 96-well plates and stimulated for 72 h at 37°C in 5% CO2 with or without 10 µg/ml LACK or TRYP recombinant proteins, or 10 µg/ml FTP. For blocking experiments, cells were incubated with 10 µg/ml inhibitory CD4 (H129.19, NA/LE; BD Pharmingen) or CD8 (53-6.7, NA/LE; BD Pharmingen) mAb, or isotype control (R35-95, NA/LE; BD Pharmingen). For in vitro depletion of CD25+ cells, pooled LN cells were incubated with biotinylated anti-CD25 (7D4; BD Pharmingen) followed by BD Imag Streptavidin Particles Plus-DM (BD Pharmingen) according to the manufacturer’s instructions. The positive fraction was removed using a BD IMagnet, and the CD25-depleted cells were plated at 6 x 105 cells/well in U-bottom 96-well plates as described above. Supernatants were removed, and IL-4, IL-5, IL-10, IFN-, or GM-CSF levels were measured by sandwich ELISA using Abs from BD Pharmingen.
In vitro suppression assay
Forty-eight hours after in vivo recall with FTP, draining LN cells from LACK- or TRYP-vaccinated mice were negatively selected for CD4+ T cells using biotinylated mAb to CD8a (53-6.7; BD Pharmingen), CD11b (M1/70; BD Pharmingen), CD45R/B220 (RA3-6B2; BD Pharmingen), and CD49b (DX5; BD Pharmingen) followed by incubation with BD Imag Streptavidin Particles Plus-DM. The positive fraction was removed using a BD IMagnet according to the manufacturer’s instructions, and the CD4+ cells were incubated with biotinylated anti-CD25. CD25+ cells were positively selected using BD Imag Streptavidin Particles Plus-DM and the BD IMagnet. CD4+CD25– cells were plated in a 1:1 mixture with mitomycin C-treated, LACK- or TRYP-pulsed splenocytes at 1.5 x 105 cells/well with or without CD4+CD25+ cells at 1.5 x 104 cells/well in U-bottom 96-well plates and stimulated for 72 h at 37°C in 5% CO2. Supernatants were removed, and GM-CSF levels were measured by sandwich ELISA using Abs from R&D Systems.
In vivo Ab treatment
Twenty-four hours before L. major challenge, mice were injected i.p. with 1 mg of anti-IL-10R mAb (1B1.3a; DNAX) or isotype control (GL113; DNAX).
Quantitative RT-PCR
CD4+CD25+ and CD4+CD25– T cells were isolated from draining LN cells as described above, extracted in TRIzol (Invitrogen Life Technologies), and the RNA pellet was resuspended in RNase-free water. Before reverse transcription, RNA was DNase-treated using DNA-free (Ambion) according to the manufacturer’s instructions, 1.6 µg of oligo(dT)15 was added, and the sample was denatured at 70°C for 10 min. RNA was reverse transcribed using 10 U of SUPER RT (HT Biotechnology) per microgram of total RNA, 1x SUPER RT buffer, 1 mM each deoxynucleotide triphosphate, and 40 U of RNaseOUT (Invitrogen Life Technologies) at 42°C for 40 min. Relative quantitation of specific cDNA species to -actin message was conducted on the ABI 7700 (Applied Biosystems) using TaqMan chemistry in a multiplex PCR and the comparative CT method for IL-10 and -actin (23), and the comparative CT method with separate tubes for Foxp3 and -actin. Sequences for primers and probes were as follows: -actin, forward, CGTGAAAAGATGACCCAGATCA, reverse, TGGTACGACCAGAGGCATACAG, and probe, TCAACACCCCAGCCATGTACGTAGCC; IL-4, forward, GATCATCGGCATTTTGAACGA, reverse, AGGACGTTTGGCACATCCAT, and probe, CACAGGAGAAGGGACGCCATGCA; IL-10, forward, GCCCAGAAATCAAGGAGCATT, reverse, GCTCCACTGCCTTGCTCTTATT, and probe, AGGCGCTGTCATCGATTTCTCCCCT; Foxp3, forward, GGCCCTTCTCCAGGACAGA, reverse, GCTGATCATGGCTGGGTTGT, and probe, ACTTCATGCATCAGCTCTCCAC. Relative quantification of signal per cell was determined by subtracting the CT for the target gene from the CT for -actin. Relative expression levels were compared with an internal control and expressed as 2–
CT.
Statistical analysis
Statistical differences (p < 0.05) between the immunization groups were determined using the unpaired, two-tailed Student t test.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDisclosuresReferences |
|---|
Fig. 1 shows the outcome of challenge infection in BALB/c mice following LACK or TRYP vaccination using heterologous DNA/MVA prime-boost. TRYP vaccination protected mice from disease (Fig. 1B), whereas LACK was not protective in our model (A). Protection from disease with TRYP was long-lived, because challenge infection 16 wk after MVA boost (Fig. 1D) resulted in a similar clinical outcome to that observed at 2 wk postboost (B). LACK-vaccinated mice challenged at 16 wk remained unprotected (Fig. 1C).
|
Previous work demonstrates that IgG2a levels are dependent on IFN-, whereas IgG1 levels correlate with IL-4 (24). IgG2a and IgG1 were therefore used as surrogate markers for Th1 and Th2 responses. LACK vaccination was associated with higher titers of specific IgG1 and low titers of IgG2a (Fig. 2A). TRYP vaccination resulted in equivalent titers of Ag-specific IgG2a and IgG1 (Fig. 2B). Using the ratio IgG2a:IgG1 as a measure of Th1:Th2 balance, TRYP DNA/MVA prime-boost (0.91) was associated with a Th1 bias, whereas the LACK prime-boost ratio (0.04) revealed skewing toward Th2. At the level of Ab responses, Th1:Th2 bias therefore appeared to be predictive of clinical outcome following vaccination.
|
and low IL-4 responses
Draining LN cells isolated following in vivo recall from mice that had received DNA/MVA prime-boost with LACK or TRYP released equivalent amounts of IFN- in response to restimulation with recombinant protein in vitro (Fig. 2C). In both cases, anti-CD4 but not anti-CD8 treatment blocked IFN- release. Neither LACK nor TRYP elicited high levels of IL-4 protein (Fig. 2D), although IL-4 released by CD4+ T cells was more elevated in the LACK-vaccinated group. IL-4 mRNA levels were also significantly higher in CD4+ T cells isolated directly ex vivo from the draining LN of in vivo-recalled LACK-vaccinated mice analyzed directly ex vivo (Fig. 2D, inset). As a measure of Th1:Th2 balance, the ratio of IFN- to IL-4 was 415 ± 48 and 869 ± 73 for LACK- and TRYP-immunized mice, respectively, reflecting IgG2a:IgG1 described above.
CD4 T cell-derived IL-10 predicts vaccine failure
In contrast to the low levels of IL-4 protein released by restimulated LN cells, significant levels of IL-10 were released by CD4+ T cells derived from both LACK- and TRYP-, but not vector-vaccinated mice (Fig. 2E). IL-10 was significantly higher in LACK-vaccinated mice correlating with a ratio of IFN-:IL-10 of 15.5 ± 1.4 for mice receiving LACK and 41.0 ± 2.8 for those administered with TRYP. Thus, IFN-:IL-10 provides a further predictive correlate of vaccine-mediated protection from leishmaniasis.
Challenge infection further polarizes IFN- and IL-10 responses
Draining LN responses were re-evaluated 4 wk postchallenge with L. major LV39. Ag-specific IL-4 levels measured using recombinant protein as stimulus were again low (<90 pg/ml) (Fig. 3C), whereas higher levels of the Th2 cytokine, IL-5, were observed (>280 ng/ml). For both IL-4 and IL-5, the same pattern emerged, with similar levels measured in LACK- and vector-vaccinated mice and lower levels in TRYP-vaccinated mice (Fig. 3C). Hence, a higher Th2 cytokine response is associated with poor clinical outcome in both LACK- and vector-vaccinated mice. In response to the crude Ag FTP, IL-5 but not IL-4 levels were higher in LACK- compared with TRYP-vaccinated mice (Fig. 3D), indicating that high IL-4 responses may not be the sole reason for vaccine failure in LACK-vaccinated mice. However, there was striking polarization of the immune response toward high IL-10/low IFN- in LACK- and low IL-10/high IFN- in TRYP-vaccinated mice in cultures stimulated with both recombinant protein (Fig. 3A) and FTP (B), indicating that IL-10 may provide the key to vaccine outcome. Importantly, low LACK (Fig. 3A)- or FTP (B)-driven IL-10 was made in vector-only mice compared with LACK-vaccinated mice, demonstrating that vaccine priming was necessary to elicit an Ag-specific IL-10 response. High IFN- in response to both recombinant protein and FTP in vector-vaccinated mice is consistent with the prechallenge observation that IFN- levels per se do not correlate with protection.
|
Given the recent association of parasite persistence with IL-10-producing CD4+CD25+ Tr (12), the identity of the LACK-specific IL-10-secreting CD4+ T cell population was further investigated. Interestingly, CD4+CD25+ T cells isolated from the LN of both LACK- and TRYP-vaccinated mice 48 h after in vivo recall with FTP were positive for the Tr-associated transcription factor, forkhead/winged helix transcription factor (Foxp3), as assessed by quantitative RT-PCR (Fig. 4A). All of the IL-10 made following restimulation of LN cell in vitro with recombinant LACK or TRYP protein was made by CD4+CD25+ T cells (Fig. 4B), as evidenced by lack of IL-10 responses in the CD25-depleted compared with the total CD4+ population. As noted before for the total CD4+ T cell population (Fig. 2E), LACK-vaccinated mice made much higher levels of CD4+CD25+ T cell-derived IL-10 than TRYP-vaccinated mice (Fig. 4B). CD25 depletion also demonstrated that, whereas all of the IFN- made by LN cells from TRYP-vaccinated mice restimulated with recombinant protein in vitro derived from the CD4+CD25– population (Fig. 4C), 40% of IFN- for LACK-vaccinated mice was made by CD4+CD25+ T cells. To establish a Tr suppression assay, we therefore determined the ability of purified CD4+CD25+ cells, which made no GM-CSF, to down-regulate the GM-CSF response when added to purified CD4+CD25– Ag-driven effector T cells (Fig. 4D). Tr activity measured in this assay was more pronounced in cells from LACK-vaccinated (50% suppression) compared with TRYP-vaccinated (35% suppression) mice, reflecting the lower level of IL-10-producing CD4+CD25+ cells in TRYP-vaccinated mice and a higher level of a Tr-like activity in CD4+CD25+ cells from LACK-vaccinated mice.
|
|
To demonstrate that IL-10 release determines vaccine failure, LACK-vaccinated mice were administered with IL-10R blocking Ab 24 h before challenge infection. Anti-IL-10R Ab treatment had some prophylactic effect in reducing footpad lesions in vector-only mice (Fig. 6B) when compared with mice receiving LACK or vector alone (A) or vector alone (data not shown). However, the administration of anti-IL-10R to LACK-vaccinated mice dramatically reduced footpad lesions when compared with LACK alone (Fig. 6A) or anti-IL-10R vector-vaccinated mice (B). This was reflected in parasite loads in the draining LN at 4 wk postinfection where a 5- to 10-fold reduction was observed in anti-IL-10R-treated LACK-vaccinated mice compared with either isotype control LACK-vaccinated mice or anti-IL-10R vector-vaccinated mice (p = 0.004) (Fig. 6C). Anti-IL-10R treatment of LACK-vaccinated mice resulted in a 3.5-fold increase in IFN- compared with untreated LACK-vaccinated mice (Fig. 6D), demonstrating that blocking the regulatory activity of IL-10 enhanced the Th1 response. Some influence of regulatory IL-10 on Th2 responses was also indicated by a 2-fold increase (p < 0.05) in IL-5 in anti-IL-10R-treated LACK-vaccinated mice compared with untreated LACK-vaccinated mice (Fig. 6D), but the balance of response was clearly skewed toward Th1 activity and cure from infection. Interestingly, anti-IL-10R-treated, vector-vaccinated mice demonstrated high levels of IFN- and IL-5, resulting in enhanced lesion size following L. major challenge relative to the IL-10R-treated LACK-vaccinated group. These results are consistent with LACK-driven, Ag-specific protection in the absence of a functional IL-10 response, whereas a higher Th2 response in anti-IL-10R-treated vector mice is associated with increased susceptibility to infection.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDisclosuresReferences |
|---|
-producing Th3 cells (reviewed in Refs. 26 and 27). Piccirillo and Shevach (26) conclude that there may be overlap between these Tr subsets, both in terms of phenotype and the cytokines involved. The LACK-driven IL-10-producing Tr that we describe here align most closely with induced CD4+CD25+ Tr1 cells that can be driven by exogenous Ag (27), secrete high levels of IL-10 (27), and can be Foxp3– (28). In our study, we found evidence for CD4+CD25+Foxp3+ Tr in the draining LN of both LACK- and TRYP-vaccinated mice. However, only CD4+CD25+ cells from LACK-vaccinated mice had high levels of mRNA for IL-10 ex vivo and produced high levels of IL-10 protein after restimulation with Ag in vitro. Hence, whereas the CD4+CD25+Foxp3+ population from mice vaccinated with both Ags may represent naturally occurring Tr, the functional population of Tr we describe for LACK-vaccinated mice more closely resemble an induced Ag-driven CD4+CD25+ Tr1-like cell population.
Tr1 cells are capable of suppressing both Th1 and Th2 responses (27). This is consistent with our demonstration here that anti-IL-10R treatment in vivo enhanced both IFN- and IL-5 responses in LACK-vaccinated mice, and with previous studies demonstrating a role for Tr in modulating both Th1 (12, 13) and Th2 (14, 15) activity in murine L. major infection. What appears crucial in determining the clinical outcome of infection is the balance between Th1 and Th2 cytokine responses. Hence, although anti-IL-10R treatment had some efficacy in vector-vaccinated mice, these mice continued to produce higher levels of IL-5 compared with anti-IL-10R-treated LACK-vaccinated mice, with a concomitant failure to display the same level of resolution of footpad size compared with the treated LACK-vaccinated mice. This suggests a role for Th2 cytokines in disease susceptibility, even in the absence of a functional IL-10 response. Alternatively, that neutralization of IL-10 in vivo in LACK-vaccinated mice has allowed a more potent vaccine-induced IFN--secreting Th1 population to mediate clinical cure compared with Th1 cells elicited by infection alone.
These observations call into question the relative contributions of IL-10R-mediated signaling vs classical Th2 IL-4R-mediated signaling in determining vaccine-induced clinical outcome in our model of L. major LV39 infection. RT-PCR conducted on cells ex vivo suggested that IL-4 was present in LACK-vaccinated mice, and Ab subclass data confirmed a bias toward Th2 cytokine responses in LACK-vaccinated compared with TRYP-vaccinated mice. Hence, classical Th2 responses are associated with susceptibility in our model. However, in comparing the roles of IL-10 and IL-4 receptor signaling pathways in L. major-infected mice, Noben-Trauth et al. (29) proposed that IL-10 is as important as IL-4/IL-13 in promoting susceptibility to L. major infection. However, there were important differences between parasite substrains that might relate to our failure here to obtain a protective immune response using the LACK Ag against L. major LV39 compared with previous studies in which protection was observed using LACK DNA vaccination against L. major Friedlin (30) or heterologous LACK DNA/MVA prime-boost vaccination against L. major WHOM/IR/-173 (31). In contrast, successful vaccination with TRYP, also known as thiol-specific antioxidant, is consistent with previous reports of protection against L. major Friedlin using DNA vaccination in mice (32), demonstrating that this Ag is protective independently of parasite strain. In their comparison of parasite substrains, Noben-Trauth et al. (29) proposed that IL-10 was particularly important in determining susceptibility in L. major LV39 infection. They related this to 25- to 500-fold greater concentrations of IFN- needed to achieve a similar efficiency in macrophage-mediated killing compared with IR173-infected macrophages. In our study, higher amounts of IFN- produced in anti-IL-10R-treated LACK-vaccinated mice could explain the enhanced clinical outcome observed compared with anti-IL-10R-treated vector mice. However, absolute levels of IFN- observed in protected TRYP-vaccinated mice postchallenge were substantially lower than levels observed in protected anti-IL-10R-treated LACK vaccinated mice. This suggests that it is the absence of IL-10 (and/or IL-4/13 cytokines) that is crucial in determining clinical outcome, rather than the absolute amounts of IFN- produced.
In relation to future vaccination strategies, the important question that arises from our work is why one Ag drives an IL-10-secreting Tr response whereas another Ag does not? The differentiation of naive CD4+ T cells into Th1, Th2, or Tr effector T cells is controlled by a number of factors, including the APC, the cytokine milieu, the route of immunization, and Ag dose (reviewed in Ref. 27). Previous work has shown that the DNA/MVA vaccine strategy that we used is generally associated with a bias toward CD4+ Th1 and CD8 T cell responses (33), in particular because ligation of TLRs by CpG motifs in the DNA vaccine promotes DC maturation and the differentiation of Th1 cells (34, 35). Ligation of TLRs on immature DC up-regulates MHC class II, CD80, CD86, CD40, and ICAM-I expression, down-regulates CCR5, and leads to DC maturation and promotion of Th1 cells (36). In contrast, certain pathogen-derived molecules, including filamentous hemagglutinin and adenylate cyclase from Bordetella pertussis, and cholera toxin, promote IL-10 and inhibit IL-12 production by DC and/or macrophages, and activate DC into a semi-immature phenotype that results in the induction of Tr1-type responses in vivo (36). In relation to our specific vaccine Ags, LACK protein has been shown previously to elicit IL-10 release from peripheral blood monocytes (37), NK cells (38), and CD45RA–CD4+ memory T cells (39) from naive subjects. Hence, it is possible that translation of LACK protein at the site of inoculation of our vaccines could contribute to a Tr1-promoting microenvironment, either through bystander effects on the cytokine milieu and/or through direct interaction with DC.
Despite the possible role of Th2-derived IL-4 in modulating response to vaccination, failure to adequately measure it in cells restimulated in vitro makes it difficult to use as a surrogate marker of nonprotective immunity. In contrast, we found that absolute levels of IL-10 did predict vaccine success or failure, and in particular that the ratio of IFN-:IL-10 provides a good prechallenge comparative indicator of vaccine success in the BALB/c mouse model. It will be important now to determine whether Tr1-like responses are associated with other nonprotective vaccines, and whether levels of CD4+ T cell-derived IL-10 relative to IFN- could also be used to predict vaccine outcome in clinical trials in humans.
|
Acknowledgments |
|---|
|
Disclosures |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDisclosuresReferences |
|---|
|
Footnotes |
|---|
1 This work was supported by a studentship to U.G.L. from the Elmore Trust and the James Baird Fund, a fellowship to M.T.M.R. from the Addenbrooke’s Hospital Trust, and a program grant to J.M.B. from the British Medical Research Council. A.A. was funded by The Wellcome Trust. 
2 Address correspondence and reprint requests to Dr. Jenefer M. Blackwell, Cambridge Institute for Medical Research, Wellcome Trust/Medical Research Council Building, Addenbrooke’s Hospital, Hills Road, Cambridge CB2 2XY, U.K. E-mail address: jennie.blackwell{at}cimr.cam.ac.uk
3 Abbreviations used in this paper: Tr, regulatory T cell; MVA, modified vaccinia virus Ankara; LACK, Leishmania homolog of the receptor for activated C kinase; TRYP, tryparedoxin peroxidase; FTP, freeze-thawed parasite; LN, lymph node.
Received for publication August 4, 2004. Accepted for publication May 26, 2005.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDisclosuresReferences |
|---|
receptor are susceptible to infection with Leishmania major but mount a polarized T helper cell 1-type CD4+ T cell response. J. Exp. Med. 181: 961-971. -deficient mice infected with Leishmania major. J. Exp. Med. 179: 1367-1371. or interleukin-4 ring the resolution or progression of murine leishmaniasis: evidence for expansion of distinct helper T cell subsets. J. Exp. Med. 169: 59-72. 4 V8 CD4+ T cells instructs Th2 development and susceptibility to Leishmania major in BALB/c mice. Immunity 6: 541-549. [Medline]
and IL-10 in natural killer cells of healthy blood donors. J. Infect. Dis. 182: 570-578. [Medline]
-producing CD45RA+CD8+ and IL-10-producing CD45RA–CD4+ T cells generated in response to LACK in naive subjects never exposed to Leishmania. Eur. J. Immunol. 32: 510-520. [Medline]This article has been cited by other articles:
|
|
 |
|
  M. C. Huaman, L. B. Martin, E. Malkin, D. L. Narum, L. H. Miller, S. Mahanty, and C. A. Long Ex Vivo Cytokine and Memory T Cell Responses to the 42-kDa Fragment of Plasmodium falciparum Merozoite Surface Protein-1 in Vaccinated Volunteers J. Immunol., February 1, 2008; 180(3): 1451 - 1461. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. I. Cazorla, P. D. Becker, F. M. Frank, T. Ebensen, M. J. Sartori, R. S. Corral, E. L. Malchiodi, and C. A. Guzman Oral Vaccination with Salmonella enterica as a Cruzipain-DNA Delivery System Confers Protective Immunity against Trypanosoma cruzi Infect. Immun., January 1, 2008; 76(1): 324 - 333. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. B. Stober, S. Brode, J. K. White, J.-F. Popoff, and J. M. Blackwell Slc11a1, Formerly Nramp1, Is Expressed in Dendritic Cells and Influences Major Histocompatibility Complex Class II Expression and Antigen-Presenting Cell Function Infect. Immun., October 1, 2007; 75(10): 5059 - 5067. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Silvestre, A. Cordeiro-Da-Silva, N. Santarem, B. Vergnes, D. Sereno, and A. Ouaissi SIR2-Deficient Leishmania infantum Induces a Defined IFN-{gamma}/IL-10 Pattern That Correlates with Protection J. Immunol., September 1, 2007; 179(5): 3161 - 3170. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Cassataro, C. A. Velikovsky, L. Bruno, S. M. Estein, S. de la Barrera, R. Bowden, C. A. Fossati, and G. H. Giambartolomei Improved Immunogenicity of a Vaccination Regimen Combining a DNA Vaccine Encoding Brucella melitensis Outer Membrane Protein 31 (Omp31) and Recombinant Omp31 Boosting Clin. Vaccine Immunol., July 1, 2007; 14(7): 869 - 874. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. B. Stober, U. G. Lange, M. T. M. Roberts, A. Alcami, and J. M. Blackwell Heterologous Priming-Boosting with DNA and Modified Vaccinia Virus Ankara Expressing Tryparedoxin Peroxidase Promotes Long-Term Memory against Leishmania major in Susceptible BALB/c Mice Infect. Immun., February 1, 2007; 75(2): 852 - 860. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. T. M. Roberts Current understandings on the immunology of leishmaniasis and recent developments in prevention and treatment Br. Med. Bull., July 17, 2006; 75-76(1): 115 - 130. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. T. M. Roberts, C. B. Stober, A. N McKenzie, and J. M. Blackwell Interleukin-4 (IL-4) and IL-10 Collude in Vaccine Failure for Novel Exacerbatory Antigens in Murine Leishmania major Infection Infect. Immun., November 1, 2005; 73(11): 7620 - 7628. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME |
