|
|
||||||||
B Signaling Pathways
Tumorimmunology Program, German Cancer Research Center, Heidelberg, Germany
| Abstract |
|---|
|
|
|---|
B via overactivation of the p38 and JNK pathways. These events lead to the down-modulation of c-Jun, c-Fos, Egr-1, and NF-
B transcription factors and thereby inhibit production of cytokines, e.g., IL-2, IL-4, IFN-
, and TNF-
, upon TCR stimulation. We also show that UV irradiation can suppress preactivated T cells, indicating that UV irradiation does not only impair T cell function in response to T cell activation, but can also have systemic effects that influence ongoing immune responses. Thus, our data provide an additional mechanism by which UV irradiation directly suppresses immune responses. | Introduction |
|---|
|
|
|---|
Although UV light is known to induce skin cancer, UV light has been used as an immunosuppressive therapy in a variety of diseases, including allograft rejection and graft-vs-host disease. The effects of UV radiation on cells of the immune system have been shown to be dependent on both dose and wavelength. UVC (200280 nm) and UVB (280315) wavelengths are the most potent, with less biological effects observed for UVA (315400 nm) irradiation (7). The most commonly used radiation technique is UVB. However, there were also studies showing that UVC is a more effective wavelength or, at least, is as efficient as UVB irradiation tested for suppression of contact hypersensitivity in animal models (8, 9). In addition, a longer survival of human alloskin grafts was observed in a clinical investigation using UVC techniques (10).
The immunosuppressive effect of UV irradiation was first identified in experiments showing that mice exposed to subcarcinogenic doses of UV irradiation failed to reject highly antigenic grafts of UV-induced skin tumors (4, 11). Although this phenomenon has been known and studied for >25 years, the immunologic mechanisms by which tumor tolerance is induced are still not completely understood. Previous studies have shown that UV irradiation may impair the function of APCs (5, 12). APCs play a pivotal role in starting Ag-specific immune reactions. Therefore, a defect in Ag presentation may account for UV-induced immune depression. Another line of studies showed that UV irradiation may induce formation of suppressor T cells (11, 13, 14), and, more recently, that NK T cells from UV-irradiated donor mice could function as suppressor T cells (14, 15).
Of important note is that UV exposure leads to impaired resistance to infections (3). During infections, Th cells play an orchestrating role in the regulation of effective immune responses by secreting various cytokines. Th1 cells produce IFN-
, IFN-
, and lymphotoxin responsible for cell-mediated immunity. Th2 cells produce IL-4, IL-5, IL-10, and IL-13, and play a major role in Ab-dependent immune responses (humoral immunity). Significant suppression of both humoral and cellular immunity after UV exposure has been shown in experimental animal models (16, 17, 18, 19). Although this phenomenon has been explained by impairment of APCs and induction of suppressor T cells, a direct role of UV irradiation in regulation of T cell functions has not yet been investigated. Therefore, in this study, we asked whether UV irradiation could directly suppress T cell activation and, thereby, suppress cytokine expression in T cells.
It has previously been shown that UV irradiation of mammalian cells causes activation of several transcription factors, including the early growth response factor Egr-1, the proinflammatory factors c-Jun and NF-
B with subsequent effect on transcription of many genes (20, 21, 22). Egr-1, c-Jun, and NF-
B are known to be involved in the activation of several important cytokine genes, including the growth factor IL-2 (23, 24), the Th1 effector cytokines IFN-
(25, 26) and TNF-
(27, 28), and the Th2 effector cytokine IL-4 (29, 30). One would expect that UV irradiation, which induces activation of Egr-1, c-Jun, and NF-
B, would promote expression of those cytokine genes. In this study, we show that UV irradiation of peripheral blood T cells induces certain levels of Egr-1, c-Jun, and NF-
B. However, UV irradiation alone is not sufficient to activate T cells to produce cytokines. Unexpectedly, UV irradiation strongly suppresses activation of Egr-1, c-Jun, and NF-
B through activation of the TCR. In addition, we show that UV irradiation inhibits T cell activation by blocking T cell activation-induced ERK and I
B signaling pathways and, consequently, suppresses cytokine gene expression. Our findings demonstrate a direct role of UV irradiation in the suppression of the T cell response.
| Materials and Methods |
|---|
|
|
|---|
The Jurkat T leukemia cells and the Jurkat T cells bearing an integrated NF-
B-dependent luciferase reporter (kindly provided by T. Wirth, Department of Physiological Chemistry, Ulm University, Ulm, Germany) were cultured in RPMI 1640 medium (Invitrogen Life Technologies) supplemented with 10% FCS, 50 µg/ml gentamicin (Invitrogen Life Technologies), 6 mM HEPES (Invitrogen Life Technologies; 1 M solution), and 2 mM L-glutamine (Invitrogen Life Technologies; 200 mM solution) at 37°C and 5% CO2. For inductions, cells were stimulated by either plate-bound anti-CD3 (OKT3 10 µg/ml) plus anti-CD28 (5 µg/ml) or PMA (10 ng/ml) (Sigma-Aldrich) plus ionomycin (1 µM) (Calbiochem) for indicated time. The p38 and JNK kinase inhibitors SB203580 and SP600125 were purchased from Alexis Biochmicals. The ERK inhibitor PD98059 was purchased from Calbiochem. In the inhibition studies, 1050 µM PD98059, 5 µM SB203580, and 25 µM SP600125 were used.
Abs and immunoblotting
T cells were lysed in ice-cold radioimmunoprecipitation assay buffer (50 mM Tris-HCl, pH 8.0, 120 mM NaCl, 1% Nonidet P-40, 0.5% deoxycholate, 1 mM PMSF, 25 mM NaF, 0.1% SDS, 1 mM DTT, 0.2 mM Na3V04, and 20 µl/ml protease inhibitors) for 20 min at 4°C. Equal amounts of proteins were run on 10% SDS-PAGE gels, transferred onto Hybond-ECL nitrocellulose membrane (Amersham Biosciences). The blot was blocked with 5% milk powder in PBS/0.1% Tween 20 for 1 h at room temperature, washed 3 x 10 min with the PBS/Tween 20 solution, and incubated with Abs overnight at 4°C. The blot was washed 3 x 10 min with PBS/Tween 20 and developed with HRP-coupled Abs in 5% milk powder in PBS/0.1% Tween 20 for 1 h at room temperature, followed by enhanced Chemiluminescence Reagent Plus (PerkinElmer Life Sciences). The following Abs were used: the Abs against NF-
B p65 (A, sc-109), p50 (E-10, sc-8414), I
B
(C21, sc-371), Egr-1 (C-19, sc-189), SP-1 (1 C6, sc-420) Ab from Santa Cruz Biotechnology; the anti-ERK1 and anti-c-Jun mAb from BD Biosciences; and the anti-phospho-ERK (E10) mAb and the anti-phospho-I
B
(Ser32) Ab from Cell Signaling Technology. Anti-active p38 and anti-active JNK Abs were purchased from Promega. For stripping, membranes were incubated for 30 min at 56°C in a buffer containing 62.5 mM Tris-HCl, pH 6.7, 2% SDS, and 100 mM 2-ME.
Purification of T lymphocytes and apoptosis measurement
Human PBMC were prepared from healthy donors by Ficoll-Paque (Pharmacia) density centrifugation. Adherent cells were removed by adherence to plastic culture vessels for 1 h. T cells were isolated from the PBMC by rosetting with 2 amino-ethylisothyo-uronium-bromide-treated SRBC (31). Purity (>95%) was confirmed by FACS staining with anti-CD3 Abs. Apoptotic cell death was assessed by propidium iodide uptake, and cell viability was determined by MTT staining and analyzed by FACS (31).
UV irradiation
UV cross-linker (UV 254 nm and UV 312 nm) model 1800 (Stratagene) was used to irradiate cells. The energy of UV irradiation was precisely controlled by UV cross-linkers. Viability of cells after UV irradiation was checked by propidium iodide uptake and by MTT staining and analyzed by FACS (31).
Determination of IL-4, IL-2, TNF-
, and IFN-
proteins
Supernatants from peripheral blood T cells (1 x 106/ml) stimulated with PMA (10 ng/ml) and ionomycin (1 µM) or with plate-bound anti-CD3 (OKT3 10 µg/ml) and anti-CD28 (5 µg/ml) Abs for 24 h were tested for the presence of IL-4, IL-2, TNF-
, and IFN-
using an ELISA specific for human IL-4, IL-2, TNF-
, and IFN-
proteins (BD Pharmingen), according to the manufacturers instruction.
RNA isolation and RT-PCR
Total cellular RNA was isolated using the RNeasy kit (Qiagen), according to the manufacturers instructions. RNA (1 µg) was reverse transcribed with oligo(dT). PCR amplification was then performed for 3035 cycles with specific primers (Stratagene) for human IL-2 (457-bp PCR product), human IL-4 (456-bp PCR product), human IFN-
(501-bp PCR product), and human
-actin (661-bp PCR product), as previously described (29, 32). The PCR products were then subjected to agarose gel electrophoresis.
Quantitative real-time PCR
The principle of TaqMan quantitative real-time PCR has previously been described in detail (33). The sequence for primers of IL-2, IL-4, IFN-
,
-actin, and fluorescent-labeled probes used in these studies was described previously (32). The primers and probe of IFN-
are forward 5'-GGAGAAGGGTGACCGACTCA-3', reverse 5'-TGCCCAGACTCGGCAAG-3', and probe 5'-CGCTGAGATCAATCGGCCCGACTA-3'. PCR was performed in a 12.5-µl reaction mixture (PCR kit from Eurogentec) that contained 0.08 µg of reverse-transcribed cDNA and proper amount of primers and probe. For each sample, three PCR were performed. The resulting relative increase in reporter fluorescent dye emission was monitored by the TaqMan system (GeneAmp 5700 sequence detection system and software; PerkinElmer). The level of the cytokine mRNA, relative to
-actin, was calculated using the formula: relative mRNA expression = 2(Ct of cytokine Ct of
-actin), where Ct is on the threshold cycle value.
Preparation of nuclear extracts and EMSA
Jurkat or peripheral blood T cells were irradiated with different doses of UV 254 nm, and the UV-irradiated cells were immediately stimulated by PMA (10 ng/ml) and ionomycin (0.5 µM). Two hours later, nuclear proteins were isolated, as described previously (29). 32P-labeled oligonucleotides containing the consensus binding site for Egr-1 (CCCGGCGCGGGGGCGATTTCGAGTCA), AP-1 (SV40) (CGGTTGCTGACTAATTG), NF-
B (TCAGAGGGGACTTTCCGAGAGGCG), and NF-Y (E
) (CACCTTTTAACCAATCAGAAAAAT) were analyzed by EMSA, as described previously (29).
Plasmid constructs and transient transfections
Luciferase reporter constructs containing the IL-4 (269/+11) promoter and the three copies of the AP-1 binding site were constructed previously (29, 30). The multiple copies of NF-
B, Egr-1, and NF-Y luciferase reporter constructs (sequences are same as in EMSA) were generated by ligation of the DNA sequence into the multiple cloning site of pTATA-Luc vector. The luciferase reporter construct containing the human IFN-
(854/+7) promoter was constructed by ligation of the IFN-
promoter sequence generated by PCR into the luciferase reporter vector. All constructs were confirmed by sequencing analysis. The pLuc-Bax promoter reporter plasmid was kindly provided by M. Schmitz (Department for Chemistry and Biochemistry, University of Bern, Bern, Switzerland).
Jurkat T cells were transfected by electroporation, as previously described (32). After overnight recovery, the cells were divided and treated with different doses of UV irradiation and then further cultured in the absence or presence of PMA (10 ng/ml) and ionomycin (1 µM) for 8 h. Luciferase activity was determined using the luciferase assay substrate (Promega) with a Duolumat LB9507 luminometer (Berthold Technologies).
| Results |
|---|
|
|
|---|
As peripheral blood T cells may frequently be exposed to UV irradiation, we first investigated whether UV irradiation directly affects cytokine production in these cells. Freshly isolated peripheral blood T cells from different donors were subjected to a single UV (254 nm) irradiation. The UV-irradiated T cells were immediately stimulated by either cross-linking of TCR-CD3 molecules with anti-CD3 plus a costimulation signal provided by anti-CD28 or with PMA and ionomycin that mimic the antigenic signals. Production of the cytokines IFN-
, TNF-
, IL-2, and IL-4 was determined 24 h later by ELISA. Irradiation of resting T cells by UV alone generally did not induce cytokine production, except a slight increase in the basal level of IL-4 after a high dose (60 J/m2) of UV (254 nm) irradiation in two donors (Fig. 1A). Stimulation of T cells via TCR resulted in high levels of cytokine production (Fig. 1A). However, when T cells were pre-exposed to UV, expression levels of the cytokines tested were dramatically down-regulated in a dose-dependent manner. In PMA/ionomycin-stimulated T cells, the production of the cytokines was higher, and consequently, higher doses of UV irradiation (60 J/m2) were required for complete suppression of cytokine expression (Fig. 1A). Similar results were obtained when UV irradiation was applied immediately after T cell stimulation by anti-CD3/anti-CD28 (data not shown).
|
UV suppresses cytokine transcription in T cells
We next analyzed mRNA expression levels of IFN-
, IL-2, and IL-4 in peripheral blood T cells after exposure to different doses of UV irradiation. Quantitative real-time PCR analysis showed that UV irradiation strongly suppresses cytokine mRNA expression in peripheral blood T cells. Consistent with the protein production data (Fig. 1B),
100 times stronger inhibition of cytokine mRNA expression by UVC (254 nm) was obtained than by UVB (312 nm) (Fig. 2A). Kinetic analysis of mRNA expression of IFN-
and IL-4 in peripheral blood T cells showed that UV 254 nm irradiation completely blocked mRNA expression right at the time of the transcription start point. The depressed mRNA levels were slightly recovered 8 h after PMA/ionomycin stimulation in UV 254 nm irradiated T cells (Fig. 2B). In comparison, the inhibitory effect of UV 312 nm was much weaker than the one of UV 254 nm. Approximate by 70% inhibition of IFN-
and IL-4 mRNA expression by UV 312 nm was observed at the early time point (2 h) of PMA/ionomycin stimulation. However, after 4 h, the depressed mRNA levels were completely recovered in UV 312 nm irradiated T cells stimulated with PMA/ionomycin (Fig. 2C). To further investigate the molecular mechanisms of UV-mediated suppression of cytokine production in T cells, we chose the human leukemic T cell line Jurkat as a model system, because Jurkat T cells produce mRNAs of both Th1 and Th2 cytokines and have often been used for studies of various cytokine genes. The kinetics of mRNA expression of IFN-
, IL-2, and IL-4 in Jurkat T cells was analyzed by RT-PCR. Similar to the results obtained from peripheral blood T cells, UV 254 nm irradiation suppressed mRNA expression of all cytokine genes tested in Jurkat T cells (Fig. 3A). UV-induced suppression of cytokine mRNA expression was not due to fewer surviving cells. As shown in Fig. 3A, the depressed IL-4 and IFN-
mRNA levels were slowly recovered after 8 h and even earlier for IL-2 in Jurkat T cells. Within this time frame, outgrowth of surviving cells could not account for the improved cytokine production.
|
|
, IL-2, and IL-4 gene were subjected to a transient transfection study. Transfected Jurkat T cells were treated with different doses of UV 254 nm radiation and then stimulated by PMA and ionomycin. In agreement with the expression levels of the endogenous mRNAs, exposure of Jurkat T cells to UV radiation resulted in reduction of promoter activities in a dose-dependent manner (Fig. 3B). As a control, the promoter activity of a constitutively expressed noncytokine protein Bax was not significantly influenced by UV irradiation. These experiments demonstrate that UV irradiation may directly inhibit cytokine gene expression at the transcriptional level.
UV inhibits T cell activation-induced c-Jun, Egr-1, and NF-
B expression
Egr-1, c-Jun, and NF-
B transcription factors that can be activated by UV irradiation (20, 21, 22) are thought in turn to activate cytokine genes such as IFN-
, TNF, IL-2, and IL-4. However, we did not detect any increase in cytokine production upon UV exposure (Figs. 1 and 2). Therefore, we asked how UV irradiation could, on the one hand, activate transcription factors involved in cytokine gene activation and, in contrast, suppress transcription of these genes. Thus, we first examined expression levels of Egr-1 and c-Jun in UV-irradiated T cells. Freshly isolated peripheral blood T cells were UV irradiated and then stimulated with anti-CD3/anti-CD28 or PMA/ionomycin. Two hours after stimulation, the expression of endogenous c-Jun and Egr-1 proteins was examined by immunoblotting. High levels of expression of c-Jun and Egr-1 were seen in peripheral blood T cells stimulated by either PMA/ionomycin or anti-CD3/anti-CD28. However, expression of these transcription factors was suppressed upon UV irradiation (Fig. 4A).
|
We next examined nuclear expression levels of c-Jun, c-Fos, Egr-1, and the NF-
B subunit p65 in UV-irradiated T cells. Nuclear extracts were prepared from Jurkat T cells pre-exposed to different doses of UV irradiation and subjected to immunoblotting and EMSA. In agreement with previous studies (20, 21, 22), we observed that UV irradiation alone induced a low nuclear level of Egr-1, c-Jun, and NF-
B. However, stronger induction of these transcription factors was seen after T cell activation, and their expression was reduced upon UV irradiation in a dose-dependent manner (Fig. 5A). UV irradiation is known to cause phosphorylation of c-Jun (22, 34), and, indeed, an increase in phosphorylated forms of c-Jun was observed in UV-irradiated T cells (Fig. 5A, indicated by arrows). EMSA showed that UV-mediated reduction of nuclear fractions of Egr-1, c-Jun, and p65 correlated with reduced DNA-binding activity of these factors (Fig. 5B). As controls, expression levels of the constitutive transcription factors Sp1, YY-1, and NF-Y were not affected by UV irradiation.
|
B, and the constitutive transcription factor NF-Y. As expected, UV irradiation suppressed the transcriptional activities mediated by these elements in a dose-dependent manner, with the exception of AP-1, whose transcriptional activity was slightly enhanced at the low dose (5 J/m2) of UV irradiation (Fig. 5C). This may be explained by the fact that although UV irradiation reduces expression levels of c-Jun, it increases c-Jun activity via phosphorylation. UV irradiation did not influence the protein levels of NF-Y; however, a slight reduction of NF-Y-mediated transcription was observed (Fig. 5C). Similar results were obtained with a plasmid construct containing 5xSP-1 DNA binding sites (data not shown), indicating that UV irradiation might also interfere with the basal transcriptional machinery. The above data demonstrate that UV irradiation may directly suppress transcriptional activation in TCR-stimulated T cells via suppression of several transcription factors such as Egr-1, AP-1, and NF-
B. UV blocks the T cell activation-induced ERK pathway
In T cells, three major groups of MAPK, the ERK, JNK, and the p38 MAPK, were shown to be involved in the T cell immune response (35). The ERK pathway primarily activates mitogenic signals (36) and has been shown to regulate Egr-1 and c-Jun expression in various cell types (27, 28). The JNK pathway increases transcriptional activity of AP-1 by binding to and phosphorylating c-Jun (34). To test whether UV irradiation influences the MAPK pathway initiated after T cell stimulation, UV-irradiated or unirradiated Jurkat T cells were stimulated for 15240 min. The MAPK activities were analyzed by immunoblotting with Abs against phosphorylated ERK (p-ERK),2 p38 (p-p38), and JNK (p-JNK). In correlation with the kinetics of Egr-1 and c-Jun expression in UV-treated Jurkat T cells (Fig. 4B), kinetic analysis of the effect of UV irradiation on ERK activation showed that UV irradiation immediately blocked activation-induced phosphorylation of ERK (Fig. 6A, left panel). UV irradiation alone, at least at the doses used in our experiments, did not induce p-ERK expression. In contrast, UV irradiation rapidly induced phosphorylation of p38 and JNK. In comparison, T cell stimulation led to a very weak induction of JNK in Jurkat T cells (Fig. 6A, left panel). Similar to Jurkat T cells, UV irradiation strongly induced phosphorylation of p38 and JNK in peripheral blood T cells (Fig. 6A, right panel). UV irradiation also further enhanced T cell activation-induced phosphorylation of p38 and JNK and suppressed the T cell activation-induced phosphorylation of ERK in peripheral blood T cells. These experiments demonstrate that UV irradiation especially inhibits the ERK pathway in activated T cells.
|
B pathway
In resting T cells, NF-
B remains in an inactive state sequestered by cytoplasmic I
B proteins. Numerous stimuli including cytokines, phorbol esters (e.g., PMA), and T cell activation lead to phosphorylation, ubiquitinylation, and degradation of I
B proteins with subsequent translocation of the DNA-binding subunits of NF-
B into the nucleus (37). Kinetic analysis of the effect of UV irradiation on I
B phosphorylation showed that pre-exposure to UV resulted in an inhibition of I
B phosphorylation upon T cell activation (Fig. 6B). At the doses used, UV irradiation alone did not induce p-I
B. Inhibition of I
B phosphorylation by UV irradiation corresponded with reduction of I
B degradation. Analysis of the I
B phosphorylation state in peripheral blood T cells showed that UV irradiation significantly inhibited I
B phosphorylation (Fig. 6C). Reduced NF-
B-binding activity was also observed in UV irradiated peripheral blood T cells (Fig. 6D). These results suggest that inhibition of I
B phosphorylation may account for UV-induced suppression of NF-
B activation in response to T cell stimulation.
UV blocks c-Jun, Egr-1, and NF-
B expression in preactivated T cells
The above-mentioned experiments show that pre-exposure to UV irradiation impairs the T cell response to TCR stimulation. We further investigated whether UV irradiation could suppress expression of Egr-1, c-Fos, and c-Jun in preactivated T cells. Thus, Jurkat T cells were prestimulated for 530 min and then exposed to UV irradiation. Our experiments showed that Egr-1, c-Fos, and c-Jun protein expression in prestimulated T cells was almost completely blocked after UV irradiation (Fig. 7A). Similarly, UV irradiation blocked phosphorylation of I
B
in prestimulated Jurkat T cells (Fig. 7B). To further determine the functional effect of UV irradiation on preactivated T cells, a Jurkat T cell line bearing an integrated NF-
B-dependent luciferase reporter (3x
B-Luc) was used as a test system for NF-
B activity. The 3x
B-Luc Jurkat T cells were prestimulated with PMA/ionomycin for 3060 min and then irradiated with 5 or 15 J/m2 UV 254 nm. Eight hours later, luciferase activities were determined. T cell stimulation strongly induced NF-
B-dependent luciferase expression. Consistent with the phosphorylation states of I
B, UV irradiation inhibited the T cell stimulation-induced NF-
B-dependent transcription (Fig. 7C). Taken together, these data demonstrate that UV irradiation may suppress an ongoing T cell immune response.
|
B pathway
From the above experiments, we noticed that UV irradiation induces a strong activation of p38 and JNK. It has been reported that p38 activity may inhibit I
B
phosphorylation and thereby limit NF-
B activity (38). To investigate whether overactivation of p38 by UV irradiation interferes with NF-
B activity, PMA/ionomycin-stimulated Jurkat T cells were treated with UV irradiation in the presence or absence of the widely used p38 and JNK kinase inhibitors SB203580 and SP600125. In agreement with the previous report (38), immunoblotting analysis showed that inhibition of the p38 activity largely prevented UV-mediated suppression of I
B
phosphorylation (Fig. 8A). To obtain a clearer picture about the role of p38 and JNK in regulation of the NF-
B activity, we examined the levels of the NF-
B subunit p50 and p65 expression in the nucleus of Jurkat cells after UV irradiation in the presence or absence of the p38 and JNK inhibitors. In correlation with the recovering levels of p-I
B
in the presence of the p38 inhibitor, UV-induced reduction in p65 and p50 in the nucleus was significantly recovered (Fig. 8, B and C). Thus, p38 is involved in inhibition of NF-
B activity.
|
B pathway.
The ERK pathway has been shown to activate expression of several transcription factors, including Egr-1 and Jun, in different mammalian cells (27, 28, 39, 40, 41, 42). To investigate the role of the ERK pathway in the activation of Egr-1, AP-1, and NF-
B in T cells, we stimulated Jurkat T cells with PMA/ionomycin in the presence or absence of the ERK-specific inhibitor PD98059. In agreement with other studies (27, 28, 39, 40, 41, 42), immunoblotting analysis showed that inhibition of the ERK activity led to reduced Egr-1 expression in activated T cells (Fig. 8F). The ERK signaling pathway was also shown to be involved in the activation of Fos and Jun in T cells because treatment with the ERK inhibitor significantly down-regulated the expression levels of Fos and Jun (Fig. 8F). In contrast, blocking the ERK pathway did not show any inhibition of T cell activation-induced degradation of I
B. The experiment indicates that UV-mediated suppression of the ERK pathway is responsible for deficient Egr-1 and AP-1 activation.
To further investigate the role of p38/JNK in the UV-mediated suppression of cytokine expression in T cells, p38 and JNK inhibitors were used in ELISA analysis. Freshly isolated blood T cells were UV irradiated in the presence or absence of the p38 and JNK inhibitors SB203580 and SP600125, and cytokine secretion was analyzed 24 h after T cell activation. The experiments showed that inhibition of either p38 or JNK partially restored UV-induced reduction of IL-2 and IFN-
protein production in primary T cells (Fig. 8G). Inhibition of both p38 and JNK activities resulted in an almost complete restoration of IL-2 and IFN-
production. These experiments demonstrate that UV-mediated overactivation of p38 and JNK is the main cause of UV-mediated suppression of cytokine expression.
UVC and UVB synergistically inhibit T cell activation
UVC can largely be absorbed by ozone and oxygen and also does not penetrate the skin layer as well as the UVB and UVA. The question arose on whether a very low dose of UVC could synergize with the longer UV wavelength to suppress T cell activation. To investigate this question, Jurkat T cells were transiently transfected with the luciferase reporter plasmids containing either the IL-2 or the IFN-
promoter, and the transfected cells were treated with combinations of UVB and low doses of UVC (1.255 J/m2). The experiment revealed that UVC at very low doses could significantly enhance the suppressive effect of UVB on the IL-2 and IFN-
promoter activity (Fig. 9, A and B). Immunoblotting analysis showed that the T cell activation-induced expression of Egr-1 and c-Jun was synergistically suppressed by UVB plus low doses of UVC (Fig. 9C). The experiments also revealed that low doses of UVC synergize with UVB to enhance T cell activation-induced phosphorylation of p38. In addition, a tendency in synergic blocking of I
B degradation was also observed in cells treated with combinations of UVB and low doses of UVC. In contrast to UVC, UVB alone does not induce phosphorylation of JNK and c-Jun. Also, UVC and UVB did not show any synergistic effect on the phosphorylation of JNK and c-Jun. These experiments demonstrate that the immunosuppressive effect of UVB could be enhanced by the cotreatment with low doses of UVC.
|
| Discussion |
|---|
|
|
|---|
B signaling pathways initiated by TCR stimulation and thereby down-regulates T cell activation-induced expression of transcription factors Egr-1, c-Jun, c-Fos, and NF-
B, and their target genes (Fig. 10). In particular, IL-2 is an important T cell cytokine driving the proliferation of T lymphoid cells in the periphery (43). In addition, IFN-
was considered to be a key cytokine involved in tumor rejection by T cells (44). Thus, direct suppression of T cell activation by UV radiation may account for the earliest impairment of T cell immune responses.
|
B in prestimulated T cells and consequently inhibit NF-
B-dependent transcription. These data indicate that UV irradiation does not only impair T cell function in response to T cell activation, but may also have systemic effects that influence ongoing immune responses.
Stimulation of T cells leads to activation of a group of MAPK kinase, which, in turn, activates ERK, p38, and JNK kinases (15). We show that UV irradiation strongly induces activation of the p38 and JNK pathway in T cells. Activation of the mitogen-activated protein signaling pathways by UVC has also been observed in other cell types (45, 46). We show that inhibitor that blocks JNK activation restored UV-mediated suppression of T cell activation-induced ERK activity. Therefore, overactivation of JNK pathway may account for UV-mediated suppression of the ERK pathway (Fig. 10). We also show that overactivation of p38 pathway may lead to suppression of I
B
phosphorylation and nuclear translocation of the NF-
B subunits p50 and p65. Thus, p38 activity plays a major role in suppression of T cell activation-induced phosphorylation of I
B
and degradation of I
B
(Fig. 10).
Exposure to UV irradiation has been shown to induce activation of Egr-1, c-Jun, and NF-
B and their target genes (20, 21, 22). In agreement with the previous findings, we also found that UV irradiation alone could increase certain levels of Egr-1, c-Jun, and NF-
B expression in nonstimulated T cells. However, we did not detect substantial elevations of IL-2, IFN-
, TNF-
, and IL-4 in UV-irradiated T cells. With the exception of two donors, a slightly elevated IL-4 production was seen after a higher dose (60 J/m2) of UV 254 nm exposure. However, this was not seen in other donors. In comparison, TCR stimulation induces much higher levels of c-Jun, Egr-1, and NF-
B expression accompanied with high levels of cytokine expression. Apparently, the levels of transcription factors induced by UV irradiation are not high enough to initiate transcription of cytokine genes in T cells, indicating that UV irradiation alone is not able to activate T cells to produce cytokines.
Studies have shown that UV exposure especially inhibits Th1 immune responses, whereas the role of UV irradiation in regulation of Th2 responses is not well documented (16). One study indicates that APCs from internal lymphoid organs of UV-irradiated mice do not present Ag to Th1, but to Th2 cells. However, the exact mechanisms by which the APCs distinguish between Th1 and Th2 are not known (47). It has been speculated that suppression of Th1 responses by UV irradiation might induce a skewing toward Th2 responses, although recent studies in rodents show suppression of the Th2 immune response as well (18, 19, 48). Our experiments demonstrate that exposure of peripheral blood T cells to UV results in an almost equal impairment of Th1 and Th2 cytokine expression at both the protein and the mRNA levels. Therefore, UV exposure leads to a general inhibition of T cell activation.
The most significant wavelength of UV irradiation with respect to skin cancer lies in the range of 200400 nm. The short wavelength UV at 200280 nm can largely be absorbed by ozone and oxygen and does not penetrate the earths atmosphere as well as the longer wavelength (280400). Therefore, the contribution of the short wavelength UV irradiation to the development of skin cancers has often been considered to be less important. However, the continuous reduction of the ozone layer by environmental pollutants (49, 50, 51) implies that exposure to short wavelength UV from thinner ozone layers increases the risk for skin cancer (51, 52). In addition, UVC doses at the 159 mJ/cm2 to 11.88 J/cm2 have been shown to suppress contact hypersensitivity in animal studies (8, 9). Prolongation of survival of human alloskin grafts was observed in a clinical trial using UVC 11 J/cm (10). UVC was also indicated to be a more effective wavelength than UVB (8). Our data show that UVC (254 nm) is
100-fold more potent than UVB (312 nm) in suppressing cytokine expression. A single 5 J/m2 UV 254 nm exposure resulted in a >80% reduction of cytokine expression in peripheral blood T cells. The doses used in our studies are much lower than the doses used in animal and clinical studies. Thus, although only a small amount of UVC may reach the dermis, the biological effects might be significant.
| Acknowledgments |
|---|
B-Luc reporter gene; Dr. M. L. Schmitz for providing the pluc-Bax plasmid; and K. Bourkoula, S. Baumann and R. Arnold for critically evaluating the manuscript. | Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 Address correspondence and reprint requests to Dr. Min Li-Weber, Tumor Immunology Program D030, German Cancer Research Center (Deutches Krebsforschungszentrum), Im Neuenheimer Feld 280, 69120 Heidelberg, Germany. E-mail address: m.li-weber{at}dkfz-heidelberg.de ![]()
2 Abbreviation used in this paper: p, phosphorylated. ![]()
Received for publication December 1, 2004. Accepted for publication May 30, 2005.
| References |
|---|
|
|
|---|
B by UV. EMBO J. 17: 5170-5181. [Medline]
gene promoter is mediated by up-regulation of AP-1 activity. FEBS Lett. 514: 153-158. [Medline]
B and NFAT with the interferon-
promoter. J. Biol. Chem. 272: 30412-30420.
expression by inducing Elk-1 phosphorylation and Egr-1 expression. Blood 98: 1429-1439.
production via Egr-1. Am. J. Physiol. Cell Physiol. 282: C1205-C1211.
B transcription factors. Oncogene 18: 6853-6866. [Medline]
B activity and Fas expression. Oncogene 19: 3003-3012. [Medline]
in tumor transplantation immunity and inhibition of chemical carcinogenesis. Curr. Opin. Immunol. 15: 148-154. [Medline]
This article has been cited by other articles:
![]() |
M. E. Munroe and G. A. Bishop A Costimulatory Function for T Cell CD40 J. Immunol., January 15, 2007; 178(2): 671 - 682. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Shan, A. Hu, H. Veler, S. Fatma, J. S. Grunstein, S. Chuang, and M. M. Grunstein Regulation of Toll-like receptor 4-induced proasthmatic changes in airway smooth muscle function by opposing actions of ERK1/2 and p38 MAPK signaling Am J Physiol Lung Cell Mol Physiol, September 1, 2006; 291(3): L324 - L333. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |