The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Li-Weber, M.
Right arrow Articles by Krammer, P. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li-Weber, M.
Right arrow Articles by Krammer, P. H.
The Journal of Immunology, 2005, 175: 2132-2143.
Copyright © 2005 by The American Association of Immunologists

Ultraviolet Irradiation Suppresses T Cell Activation via Blocking TCR-Mediated ERK and NF-{kappa}B Signaling Pathways

Min Li-Weber1, Monika K. Treiber, Marco Giaisi, Katalin Palfi, Nadja Stephan, Simone Parg and Peter H. Krammer

Tumorimmunology Program, German Cancer Research Center, Heidelberg, Germany


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
UV irradiation is carcinogenic and immunosuppressive. Previous studies indicate that UV-mediated alteration of APCs and induction of suppressor T cells play a critical role in UV-induced immune suppression. In this study, we show that UV irradiation can directly (independently of APCs and suppressor T cells) inhibit T cell activation by blocking TCR-mediated phosphorylation of ERK and I{kappa}B via overactivation of the p38 and JNK pathways. These events lead to the down-modulation of c-Jun, c-Fos, Egr-1, and NF-{kappa}B transcription factors and thereby inhibit production of cytokines, e.g., IL-2, IL-4, IFN-{gamma}, and TNF-{alpha}, upon TCR stimulation. We also show that UV irradiation can suppress preactivated T cells, indicating that UV irradiation does not only impair T cell function in response to T cell activation, but can also have systemic effects that influence ongoing immune responses. Thus, our data provide an additional mechanism by which UV irradiation directly suppresses immune responses.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Ultraviolet irradiation is one of the most prominent natural carcinogens, largely affecting human health, e.g., by inducing skin cancer. UV exposure causes DNA damage that, if not repaired, generates mutations, particularly in the tumor suppressor gene p53 (1, 2). Strong evidence has also shown that exposure to UV irradiation significantly impairs resistance to various infectious agents such as bacteria, parasites, viruses, and fungi (3). Importantly, the immunosuppressive effect of UV irradiation is not restricted to skin-associated infections, but is also apparent in systemic (non-skin-associated) infections (3). Down-modulation of immune responses by UV irradiation has been considered to be a major risk factor for carcinogenesis (4, 5, 6).

Although UV light is known to induce skin cancer, UV light has been used as an immunosuppressive therapy in a variety of diseases, including allograft rejection and graft-vs-host disease. The effects of UV radiation on cells of the immune system have been shown to be dependent on both dose and wavelength. UVC (200–280 nm) and UVB (280–315) wavelengths are the most potent, with less biological effects observed for UVA (315–400 nm) irradiation (7). The most commonly used radiation technique is UVB. However, there were also studies showing that UVC is a more effective wavelength or, at least, is as efficient as UVB irradiation tested for suppression of contact hypersensitivity in animal models (8, 9). In addition, a longer survival of human alloskin grafts was observed in a clinical investigation using UVC techniques (10).

The immunosuppressive effect of UV irradiation was first identified in experiments showing that mice exposed to subcarcinogenic doses of UV irradiation failed to reject highly antigenic grafts of UV-induced skin tumors (4, 11). Although this phenomenon has been known and studied for >25 years, the immunologic mechanisms by which tumor tolerance is induced are still not completely understood. Previous studies have shown that UV irradiation may impair the function of APCs (5, 12). APCs play a pivotal role in starting Ag-specific immune reactions. Therefore, a defect in Ag presentation may account for UV-induced immune depression. Another line of studies showed that UV irradiation may induce formation of suppressor T cells (11, 13, 14), and, more recently, that NK T cells from UV-irradiated donor mice could function as suppressor T cells (14, 15).

Of important note is that UV exposure leads to impaired resistance to infections (3). During infections, Th cells play an orchestrating role in the regulation of effective immune responses by secreting various cytokines. Th1 cells produce IFN-{gamma}, IFN-{alpha}, and lymphotoxin responsible for cell-mediated immunity. Th2 cells produce IL-4, IL-5, IL-10, and IL-13, and play a major role in Ab-dependent immune responses (humoral immunity). Significant suppression of both humoral and cellular immunity after UV exposure has been shown in experimental animal models (16, 17, 18, 19). Although this phenomenon has been explained by impairment of APCs and induction of suppressor T cells, a direct role of UV irradiation in regulation of T cell functions has not yet been investigated. Therefore, in this study, we asked whether UV irradiation could directly suppress T cell activation and, thereby, suppress cytokine expression in T cells.

It has previously been shown that UV irradiation of mammalian cells causes activation of several transcription factors, including the early growth response factor Egr-1, the proinflammatory factors c-Jun and NF-{kappa}B with subsequent effect on transcription of many genes (20, 21, 22). Egr-1, c-Jun, and NF-{kappa}B are known to be involved in the activation of several important cytokine genes, including the growth factor IL-2 (23, 24), the Th1 effector cytokines IFN-{gamma} (25, 26) and TNF-{alpha} (27, 28), and the Th2 effector cytokine IL-4 (29, 30). One would expect that UV irradiation, which induces activation of Egr-1, c-Jun, and NF-{kappa}B, would promote expression of those cytokine genes. In this study, we show that UV irradiation of peripheral blood T cells induces certain levels of Egr-1, c-Jun, and NF-{kappa}B. However, UV irradiation alone is not sufficient to activate T cells to produce cytokines. Unexpectedly, UV irradiation strongly suppresses activation of Egr-1, c-Jun, and NF-{kappa}B through activation of the TCR. In addition, we show that UV irradiation inhibits T cell activation by blocking T cell activation-induced ERK and I{kappa}B signaling pathways and, consequently, suppresses cytokine gene expression. Our findings demonstrate a direct role of UV irradiation in the suppression of the T cell response.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Cell lines and cell culture

The Jurkat T leukemia cells and the Jurkat T cells bearing an integrated NF-{kappa}B-dependent luciferase reporter (kindly provided by T. Wirth, Department of Physiological Chemistry, Ulm University, Ulm, Germany) were cultured in RPMI 1640 medium (Invitrogen Life Technologies) supplemented with 10% FCS, 50 µg/ml gentamicin (Invitrogen Life Technologies), 6 mM HEPES (Invitrogen Life Technologies; 1 M solution), and 2 mM L-glutamine (Invitrogen Life Technologies; 200 mM solution) at 37°C and 5% CO2. For inductions, cells were stimulated by either plate-bound anti-CD3 (OKT3 10 µg/ml) plus anti-CD28 (5 µg/ml) or PMA (10 ng/ml) (Sigma-Aldrich) plus ionomycin (1 µM) (Calbiochem) for indicated time. The p38 and JNK kinase inhibitors SB203580 and SP600125 were purchased from Alexis Biochmicals. The ERK inhibitor PD98059 was purchased from Calbiochem. In the inhibition studies, 10–50 µM PD98059, 5 µM SB203580, and 25 µM SP600125 were used.

Abs and immunoblotting

T cells were lysed in ice-cold radioimmunoprecipitation assay buffer (50 mM Tris-HCl, pH 8.0, 120 mM NaCl, 1% Nonidet P-40, 0.5% deoxycholate, 1 mM PMSF, 25 mM NaF, 0.1% SDS, 1 mM DTT, 0.2 mM Na3V04, and 20 µl/ml protease inhibitors) for 20 min at 4°C. Equal amounts of proteins were run on 10% SDS-PAGE gels, transferred onto Hybond-ECL nitrocellulose membrane (Amersham Biosciences). The blot was blocked with 5% milk powder in PBS/0.1% Tween 20 for 1 h at room temperature, washed 3 x 10 min with the PBS/Tween 20 solution, and incubated with Abs overnight at 4°C. The blot was washed 3 x 10 min with PBS/Tween 20 and developed with HRP-coupled Abs in 5% milk powder in PBS/0.1% Tween 20 for 1 h at room temperature, followed by enhanced Chemiluminescence Reagent Plus (PerkinElmer Life Sciences). The following Abs were used: the Abs against NF-{kappa}B p65 (A, sc-109), p50 (E-10, sc-8414), I{kappa}B{alpha} (C21, sc-371), Egr-1 (C-19, sc-189), SP-1 (1 C6, sc-420) Ab from Santa Cruz Biotechnology; the anti-ERK1 and anti-c-Jun mAb from BD Biosciences; and the anti-phospho-ERK (E10) mAb and the anti-phospho-I{kappa}B{alpha} (Ser32) Ab from Cell Signaling Technology. Anti-active p38 and anti-active JNK Abs were purchased from Promega. For stripping, membranes were incubated for 30 min at 56°C in a buffer containing 62.5 mM Tris-HCl, pH 6.7, 2% SDS, and 100 mM 2-ME.

Purification of T lymphocytes and apoptosis measurement

Human PBMC were prepared from healthy donors by Ficoll-Paque (Pharmacia) density centrifugation. Adherent cells were removed by adherence to plastic culture vessels for 1 h. T cells were isolated from the PBMC by rosetting with 2 amino-ethylisothyo-uronium-bromide-treated SRBC (31). Purity (>95%) was confirmed by FACS staining with anti-CD3 Abs. Apoptotic cell death was assessed by propidium iodide uptake, and cell viability was determined by MTT staining and analyzed by FACS (31).

UV irradiation

UV cross-linker (UV 254 nm and UV 312 nm) model 1800 (Stratagene) was used to irradiate cells. The energy of UV irradiation was precisely controlled by UV cross-linkers. Viability of cells after UV irradiation was checked by propidium iodide uptake and by MTT staining and analyzed by FACS (31).

Determination of IL-4, IL-2, TNF-{alpha}, and IFN-{gamma} proteins

Supernatants from peripheral blood T cells (1 x 106/ml) stimulated with PMA (10 ng/ml) and ionomycin (1 µM) or with plate-bound anti-CD3 (OKT3 10 µg/ml) and anti-CD28 (5 µg/ml) Abs for 24 h were tested for the presence of IL-4, IL-2, TNF-{alpha}, and IFN-{gamma} using an ELISA specific for human IL-4, IL-2, TNF-{alpha}, and IFN-{gamma} proteins (BD Pharmingen), according to the manufacturer’s instruction.

RNA isolation and RT-PCR

Total cellular RNA was isolated using the RNeasy kit (Qiagen), according to the manufacturer’s instructions. RNA (1 µg) was reverse transcribed with oligo(dT). PCR amplification was then performed for 30–35 cycles with specific primers (Stratagene) for human IL-2 (457-bp PCR product), human IL-4 (456-bp PCR product), human IFN-{gamma} (501-bp PCR product), and human {beta}-actin (661-bp PCR product), as previously described (29, 32). The PCR products were then subjected to agarose gel electrophoresis.

Quantitative real-time PCR

The principle of TaqMan quantitative real-time PCR has previously been described in detail (33). The sequence for primers of IL-2, IL-4, IFN-{gamma}, {beta}-actin, and fluorescent-labeled probes used in these studies was described previously (32). The primers and probe of IFN-{alpha} are forward 5'-GGAGAAGGGTGACCGACTCA-3', reverse 5'-TGCCCAGACTCGGCAAG-3', and probe 5'-CGCTGAGATCAATCGGCCCGACTA-3'. PCR was performed in a 12.5-µl reaction mixture (PCR kit from Eurogentec) that contained 0.08 µg of reverse-transcribed cDNA and proper amount of primers and probe. For each sample, three PCR were performed. The resulting relative increase in reporter fluorescent dye emission was monitored by the TaqMan system (GeneAmp 5700 sequence detection system and software; PerkinElmer). The level of the cytokine mRNA, relative to {beta}-actin, was calculated using the formula: relative mRNA expression = 2–(Ct of cytokine – Ct of {beta}-actin), where Ct is on the threshold cycle value.

Preparation of nuclear extracts and EMSA

Jurkat or peripheral blood T cells were irradiated with different doses of UV 254 nm, and the UV-irradiated cells were immediately stimulated by PMA (10 ng/ml) and ionomycin (0.5 µM). Two hours later, nuclear proteins were isolated, as described previously (29). 32P-labeled oligonucleotides containing the consensus binding site for Egr-1 (CCCGGCGCGGGGGCGATTTCGAGTCA), AP-1 (SV40) (CGGTTGCTGACTAATTG), NF-{kappa}B (TCAGAGGGGACTTTCCGAGAGGCG), and NF-Y (E{alpha}) (CACCTTTTAACCAATCAGAAAAAT) were analyzed by EMSA, as described previously (29).

Plasmid constructs and transient transfections

Luciferase reporter constructs containing the IL-4 (–269/+11) promoter and the three copies of the AP-1 binding site were constructed previously (29, 30). The multiple copies of NF-{kappa}B, Egr-1, and NF-Y luciferase reporter constructs (sequences are same as in EMSA) were generated by ligation of the DNA sequence into the multiple cloning site of pTATA-Luc vector. The luciferase reporter construct containing the human IFN-{gamma} (–854/+7) promoter was constructed by ligation of the IFN-{gamma} promoter sequence generated by PCR into the luciferase reporter vector. All constructs were confirmed by sequencing analysis. The pLuc-Bax promoter reporter plasmid was kindly provided by M. Schmitz (Department for Chemistry and Biochemistry, University of Bern, Bern, Switzerland).

Jurkat T cells were transfected by electroporation, as previously described (32). After overnight recovery, the cells were divided and treated with different doses of UV irradiation and then further cultured in the absence or presence of PMA (10 ng/ml) and ionomycin (1 µM) for 8 h. Luciferase activity was determined using the luciferase assay substrate (Promega) with a Duolumat LB9507 luminometer (Berthold Technologies).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
UV directly inhibits cytokine production by T cells

As peripheral blood T cells may frequently be exposed to UV irradiation, we first investigated whether UV irradiation directly affects cytokine production in these cells. Freshly isolated peripheral blood T cells from different donors were subjected to a single UV (254 nm) irradiation. The UV-irradiated T cells were immediately stimulated by either cross-linking of TCR-CD3 molecules with anti-CD3 plus a costimulation signal provided by anti-CD28 or with PMA and ionomycin that mimic the antigenic signals. Production of the cytokines IFN-{gamma}, TNF-{alpha}, IL-2, and IL-4 was determined 24 h later by ELISA. Irradiation of resting T cells by UV alone generally did not induce cytokine production, except a slight increase in the basal level of IL-4 after a high dose (60 J/m2) of UV (254 nm) irradiation in two donors (Fig. 1A). Stimulation of T cells via TCR resulted in high levels of cytokine production (Fig. 1A). However, when T cells were pre-exposed to UV, expression levels of the cytokines tested were dramatically down-regulated in a dose-dependent manner. In PMA/ionomycin-stimulated T cells, the production of the cytokines was higher, and consequently, higher doses of UV irradiation (60 J/m2) were required for complete suppression of cytokine expression (Fig. 1A). Similar results were obtained when UV irradiation was applied immediately after T cell stimulation by anti-CD3/anti-CD28 (data not shown).



View larger version (40K):
[in this window]
[in a new window]
 
FIGURE 1. UV irradiation inhibits cytokine production in peripheral blood human T cells. A, Freshly isolated human peripheral blood T cells were exposed to different doses of UV (254 nm) irradiation, and subsequently stimulated with anti-CD3/anti-CD28 Abs or with PMA/ionomycin, as indicated. After 24-h stimulation, the supernatants were analyzed for cytokine production by ELISA. Non-ind., Indicates noninduction. Data are representative of six separate experiments with T cells from different donors. B, Freshly isolated peripheral blood T cells were treated with either UV 254 nm or UV 312 nm and then stimulated with anti-CD3/anti-CD28. After 24-h stimulation, the supernatants were analyzed for cytokine production by ELISA. Data are representative of two separated experiments. C, Freshly isolated peripheral blood T cells were exposed to different doses of UV 254 nm irradiation. After 24 h, the percentage of surviving cells was determined by MTT assay. The results represent the average of two irradiation assays. D, The cells from B were collected for analysis of apoptotic cell death by FACS for DNA fragmentation.

 
UV radiation in sunlight may be subdivided into UVC (200–280 nm), UVB (280–315 nm), and UVA (315–400 nm). UVC can be largely absorbed by ozone and oxygen. We, therefore, also examined the effect of UV light on cytokine production with UV 312 nm (UVB). In comparison, an approximate 100 times higher dose of UV 312 nm irradiation was required to achieve a similar reduction of cytokine production than by UV 254 nm (Fig. 1B). Although UV irradiation at high doses may cause death of mammalian cells, at the dose of UV used in our experiments, no significant cell death was seen determined by the MTT assay (Fig. 1C) and by DNA fragmentation (Fig. 1D). Slight inhibition of the cell cycle (G2/M arrest) was observed when the cells were irradiated with UV 312 nm higher than 200 J/m2 and UV 254 nm higher than 20 J/m2 (Fig. 1D). These experiments indicate that UV irradiation can directly (independently of APCs) suppress T cell activation.

UV suppresses cytokine transcription in T cells

We next analyzed mRNA expression levels of IFN-{gamma}, IL-2, and IL-4 in peripheral blood T cells after exposure to different doses of UV irradiation. Quantitative real-time PCR analysis showed that UV irradiation strongly suppresses cytokine mRNA expression in peripheral blood T cells. Consistent with the protein production data (Fig. 1B), ~100 times stronger inhibition of cytokine mRNA expression by UVC (254 nm) was obtained than by UVB (312 nm) (Fig. 2A). Kinetic analysis of mRNA expression of IFN-{gamma} and IL-4 in peripheral blood T cells showed that UV 254 nm irradiation completely blocked mRNA expression right at the time of the transcription start point. The depressed mRNA levels were slightly recovered 8 h after PMA/ionomycin stimulation in UV 254 nm irradiated T cells (Fig. 2B). In comparison, the inhibitory effect of UV 312 nm was much weaker than the one of UV 254 nm. Approximate by 70% inhibition of IFN-{gamma} and IL-4 mRNA expression by UV 312 nm was observed at the early time point (2 h) of PMA/ionomycin stimulation. However, after 4 h, the depressed mRNA levels were completely recovered in UV 312 nm irradiated T cells stimulated with PMA/ionomycin (Fig. 2C). To further investigate the molecular mechanisms of UV-mediated suppression of cytokine production in T cells, we chose the human leukemic T cell line Jurkat as a model system, because Jurkat T cells produce mRNAs of both Th1 and Th2 cytokines and have often been used for studies of various cytokine genes. The kinetics of mRNA expression of IFN-{gamma}, IL-2, and IL-4 in Jurkat T cells was analyzed by RT-PCR. Similar to the results obtained from peripheral blood T cells, UV 254 nm irradiation suppressed mRNA expression of all cytokine genes tested in Jurkat T cells (Fig. 3A). UV-induced suppression of cytokine mRNA expression was not due to fewer surviving cells. As shown in Fig. 3A, the depressed IL-4 and IFN-{gamma} mRNA levels were slowly recovered after 8 h and even earlier for IL-2 in Jurkat T cells. Within this time frame, outgrowth of surviving cells could not account for the improved cytokine production.



View larger version (33K):
[in this window]
[in a new window]
 
FIGURE 2. UV irradiation inhibits cytokine mRNA expression in activated T cells. A, Freshly isolated peripheral blood T cells from healthy donors were irradiated with different doses of UV 254 nm or UV 312 nm and immediately stimulated with anti-CD3/anti-CD28 Abs. After 4-h stimulation, total RNA was prepared and analyzed for cytokine mRNA expression levels by real-time PCR. Results were internally confirmed by the comparative cycle count (Ct) against {beta}-actin as the standard gene. B, Peripheral blood T cells were pre-exposed to a single dose (30 J/m2) of UV 254 nm irradiation and then stimulated with PMA/ionomycin for different times. The mRNA expression levels of IFN-{gamma} and IL-4 were analyzed by real-time PCR. C, The IL-4 and IFN-{gamma} mRNA expression levels were analyzed from peripheral blood T cells pre-exposed to a single dose (250 J/m2) of UV 312 nm irradiation.

 


View larger version (44K):
[in this window]
[in a new window]
 
FIGURE 3. UV irradiation inhibits cytokine mRNA expression in Jurkat T cells. A, Jurkat T cells were non (–)- or pre-exposed (+) to a single dose (30 J/m2) of UV 254 nm irradiation and then stimulated with PMA/ionomycin for different times. Total RNA was prepared and analyzed for cytokine mRNA expression levels by RT-PCR. {beta}-actin mRNA expression levels were analyzed as controls. Data are representative of two separate experiments. B, Jurkat T cells were transiently transfected with a pLuc-IL-2, a pLuc-IL-4, a pLuc-IFN-{gamma}, or a pLuc-Bax promoter luciferase construct. After overnight recovery, the transfected cells were split and treated with different doses of UV 254 nm irradiation and then stimulated with PMA and ionomycin. Luciferase activity was determined after 8-h stimulation. Results represent the average of three independent transfection experiments.

 
To further investigate whether the UV-mediated suppression of mRNA expression occurred at the transcriptional level, luciferase reporter plasmids containing promoters of the human IFN-{gamma}, IL-2, and IL-4 gene were subjected to a transient transfection study. Transfected Jurkat T cells were treated with different doses of UV 254 nm radiation and then stimulated by PMA and ionomycin. In agreement with the expression levels of the endogenous mRNAs, exposure of Jurkat T cells to UV radiation resulted in reduction of promoter activities in a dose-dependent manner (Fig. 3B). As a control, the promoter activity of a constitutively expressed noncytokine protein Bax was not significantly influenced by UV irradiation. These experiments demonstrate that UV irradiation may directly inhibit cytokine gene expression at the transcriptional level.

UV inhibits T cell activation-induced c-Jun, Egr-1, and NF-{kappa}B expression

Egr-1, c-Jun, and NF-{kappa}B transcription factors that can be activated by UV irradiation (20, 21, 22) are thought in turn to activate cytokine genes such as IFN-{gamma}, TNF, IL-2, and IL-4. However, we did not detect any increase in cytokine production upon UV exposure (Figs. 1 and 2). Therefore, we asked how UV irradiation could, on the one hand, activate transcription factors involved in cytokine gene activation and, in contrast, suppress transcription of these genes. Thus, we first examined expression levels of Egr-1 and c-Jun in UV-irradiated T cells. Freshly isolated peripheral blood T cells were UV irradiated and then stimulated with anti-CD3/anti-CD28 or PMA/ionomycin. Two hours after stimulation, the expression of endogenous c-Jun and Egr-1 proteins was examined by immunoblotting. High levels of expression of c-Jun and Egr-1 were seen in peripheral blood T cells stimulated by either PMA/ionomycin or anti-CD3/anti-CD28. However, expression of these transcription factors was suppressed upon UV irradiation (Fig. 4A).



View larger version (73K):
[in this window]
[in a new window]
 
FIGURE 4. UV irradiation blocks T cell activation-induced expression of c-Jun and Egr-1. A, Freshly isolated peripheral blood T cells were treated with different doses of UV 254 nm irradiation and then stimulated with PMA/ionomycin or anti-CD3/anti-CD28 for 2 h. Total cell lysates were immunoblotted with Abs against c-Jun, p-c-Jun, Egr-1, and tubulin. Data are representative of two separate experiments. B, UV-treated (30 J/m2, 254 nm) or untreated Jurkat T cells were stimulated by PMA/ionomycin for 15–240 min; total cell lysates were immunoblotted with Abs against c-Jun, p-c-Jun, and Egr-1, and then stripped for blotting of SP-1 and tubulin. Data are representative of three separate experiments. p-c-Jun was indicated by arrows.

 
Therefore, we further investigated the kinetics of UV-mediated suppression of c-Jun and Egr-1 expression. Stimulation of Jurkat T cells led to a rapid expression of c-Jun and Egr-1. UV-induced phosphorylation of c-Jun was also seen at a later time point (120 min after UV exposure) (Fig. 4B). Interestingly, we found that T cell activation-induced expression of Egr-1 and c-Jun was immediately blocked upon UV irradiation. In controls, we showed that UV irradiation did not influence protein levels of tubulin or the constitutively expressed transcription factor SP-1 (Fig. 4B). Therefore, UV irradiation impairs expression of Egr-1 and c-Jun upon T cell activation.

We next examined nuclear expression levels of c-Jun, c-Fos, Egr-1, and the NF-{kappa}B subunit p65 in UV-irradiated T cells. Nuclear extracts were prepared from Jurkat T cells pre-exposed to different doses of UV irradiation and subjected to immunoblotting and EMSA. In agreement with previous studies (20, 21, 22), we observed that UV irradiation alone induced a low nuclear level of Egr-1, c-Jun, and NF-{kappa}B. However, stronger induction of these transcription factors was seen after T cell activation, and their expression was reduced upon UV irradiation in a dose-dependent manner (Fig. 5A). UV irradiation is known to cause phosphorylation of c-Jun (22, 34), and, indeed, an increase in phosphorylated forms of c-Jun was observed in UV-irradiated T cells (Fig. 5A, indicated by arrows). EMSA showed that UV-mediated reduction of nuclear fractions of Egr-1, c-Jun, and p65 correlated with reduced DNA-binding activity of these factors (Fig. 5B). As controls, expression levels of the constitutive transcription factors Sp1, YY-1, and NF-Y were not affected by UV irradiation.



View larger version (42K):
[in this window]
[in a new window]
 
FIGURE 5. UV irradiation inhibits DNA-binding and transcriptional activity of AP-1, Egr-1, and NF-{kappa}B. A, Nuclear extracts were prepared from PMA/ionomycin-stimulated (+) or unstimulated (–) Jurkat T cells pretreated with different doses of UV 254 nm radiation. The extracts were then immunoblotted with anti-c-Jun, stripped, and immunoblotted with anti-p-c-Jun, anti-Fos, anti-Egr-1, anti-p65, anti-SP-1, and anti-YY-1 sequentially. Data are representative of three separate experiments. p-c-Jun was indicated by arrows. B, The nuclear extracts were subjected to EMSA analysis with 32P-labeled oligonucleotides containing the consensus binding sites for AP-1, Egr-1, NF-{kappa}B, and NF-Y. Data are representative of two separate experiments. C, Jurkat T cells were transiently transfected with the luciferase reporter constructs containing multiple copies of the consensus DNA-binding sequences for AP-1, Egr-1, NF-{kappa}B, and NF-Y. The transfected cells were split and stimulated with PMA and ionomycin in the absence or presence of UV 254 nm treatment. Results represent the average of three independent transfection experiments.

 
To further confirm that inhibition of Egr-1, c-Jun, and p65 by UV irradiation would lead to suppression of transcriptional activity of these factors in activated T cells, we performed transfection studies with luciferase reporter constructs containing multiple copies of the consensus DNA-binding elements for Egr-1, AP-1, NF-{kappa}B, and the constitutive transcription factor NF-Y. As expected, UV irradiation suppressed the transcriptional activities mediated by these elements in a dose-dependent manner, with the exception of AP-1, whose transcriptional activity was slightly enhanced at the low dose (5 J/m2) of UV irradiation (Fig. 5C). This may be explained by the fact that although UV irradiation reduces expression levels of c-Jun, it increases c-Jun activity via phosphorylation. UV irradiation did not influence the protein levels of NF-Y; however, a slight reduction of NF-Y-mediated transcription was observed (Fig. 5C). Similar results were obtained with a plasmid construct containing 5xSP-1 DNA binding sites (data not shown), indicating that UV irradiation might also interfere with the basal transcriptional machinery. The above data demonstrate that UV irradiation may directly suppress transcriptional activation in TCR-stimulated T cells via suppression of several transcription factors such as Egr-1, AP-1, and NF-{kappa}B.

UV blocks the T cell activation-induced ERK pathway

In T cells, three major groups of MAPK, the ERK, JNK, and the p38 MAPK, were shown to be involved in the T cell immune response (35). The ERK pathway primarily activates mitogenic signals (36) and has been shown to regulate Egr-1 and c-Jun expression in various cell types (27, 28). The JNK pathway increases transcriptional activity of AP-1 by binding to and phosphorylating c-Jun (34). To test whether UV irradiation influences the MAPK pathway initiated after T cell stimulation, UV-irradiated or unirradiated Jurkat T cells were stimulated for 15–240 min. The MAPK activities were analyzed by immunoblotting with Abs against phosphorylated ERK (p-ERK),2 p38 (p-p38), and JNK (p-JNK). In correlation with the kinetics of Egr-1 and c-Jun expression in UV-treated Jurkat T cells (Fig. 4B), kinetic analysis of the effect of UV irradiation on ERK activation showed that UV irradiation immediately blocked activation-induced phosphorylation of ERK (Fig. 6A, left panel). UV irradiation alone, at least at the doses used in our experiments, did not induce p-ERK expression. In contrast, UV irradiation rapidly induced phosphorylation of p38 and JNK. In comparison, T cell stimulation led to a very weak induction of JNK in Jurkat T cells (Fig. 6A, left panel). Similar to Jurkat T cells, UV irradiation strongly induced phosphorylation of p38 and JNK in peripheral blood T cells (Fig. 6A, right panel). UV irradiation also further enhanced T cell activation-induced phosphorylation of p38 and JNK and suppressed the T cell activation-induced phosphorylation of ERK in peripheral blood T cells. These experiments demonstrate that UV irradiation especially inhibits the ERK pathway in activated T cells.



View larger version (68K):
[in this window]
[in a new window]
 
FIGURE 6. UV irradiation blocks T cell activation-induced phosphorylation of ERK and I{kappa}B. A, UV-treated (30 J/m2, 254 nm) or untreated Jurkat T cells (left panel) and peripheral blood T cells (right panel) were stimulated with PMA/ionomycin for 15–240 min, as indicated. Total cell lysates were immunoblotted with Abs against p-ERK, ERK-1, p-p38, p38, p-JNK, and JNK-1. Similar results were obtained in three separate experiments. B, UV-treated (30 J/m2, 254 nm) or untreated Jurkat T cells were stimulated as in A for different times, as indicated. Total cell lysates were immunoblotted with Abs to p-I{kappa}B{alpha}, I{kappa}B{alpha}, and tubulin sequentially. Similar data were obtained in three separate experiments. C, Freshly isolated blood T cells were irradiated with different doses of UV 254 nm and then stimulated with plate-bound anti-CD3 and anti-CD28 Abs for 2 h. Total cell lysates were immunoblotted with Ab to p-I{kappa}B{alpha} and then stripped for immunoblot to anti-I{kappa}B{alpha}. Data are representative of two separate experiments with two different donors. D, Nuclear proteins of peripheral blood T cells treated with different doses of UV 254 nm were subjected to EMSA analysis with a 32P-labeled NF-{kappa}B-binding DNA fragment. NF-Y-binding activity was taken as equal loading control.

 
UV blocks the T cell activation-induced NF-{kappa}B pathway

In resting T cells, NF-{kappa}B remains in an inactive state sequestered by cytoplasmic I{kappa}B proteins. Numerous stimuli including cytokines, phorbol esters (e.g., PMA), and T cell activation lead to phosphorylation, ubiquitinylation, and degradation of I{kappa}B proteins with subsequent translocation of the DNA-binding subunits of NF-{kappa}B into the nucleus (37). Kinetic analysis of the effect of UV irradiation on I{kappa}B phosphorylation showed that pre-exposure to UV resulted in an inhibition of I{kappa}B phosphorylation upon T cell activation (Fig. 6B). At the doses used, UV irradiation alone did not induce p-I{kappa}B. Inhibition of I{kappa}B phosphorylation by UV irradiation corresponded with reduction of I{kappa}B degradation. Analysis of the I{kappa}B phosphorylation state in peripheral blood T cells showed that UV irradiation significantly inhibited I{kappa}B phosphorylation (Fig. 6C). Reduced NF-{kappa}B-binding activity was also observed in UV irradiated peripheral blood T cells (Fig. 6D). These results suggest that inhibition of I{kappa}B phosphorylation may account for UV-induced suppression of NF-{kappa}B activation in response to T cell stimulation.

UV blocks c-Jun, Egr-1, and NF-{kappa}B expression in preactivated T cells

The above-mentioned experiments show that pre-exposure to UV irradiation impairs the T cell response to TCR stimulation. We further investigated whether UV irradiation could suppress expression of Egr-1, c-Fos, and c-Jun in preactivated T cells. Thus, Jurkat T cells were prestimulated for 5–30 min and then exposed to UV irradiation. Our experiments showed that Egr-1, c-Fos, and c-Jun protein expression in prestimulated T cells was almost completely blocked after UV irradiation (Fig. 7A). Similarly, UV irradiation blocked phosphorylation of I{kappa}B{alpha} in prestimulated Jurkat T cells (Fig. 7B). To further determine the functional effect of UV irradiation on preactivated T cells, a Jurkat T cell line bearing an integrated NF-{kappa}B-dependent luciferase reporter (3x{kappa}B-Luc) was used as a test system for NF-{kappa}B activity. The 3x{kappa}B-Luc Jurkat T cells were prestimulated with PMA/ionomycin for 30–60 min and then irradiated with 5 or 15 J/m2 UV 254 nm. Eight hours later, luciferase activities were determined. T cell stimulation strongly induced NF-{kappa}B-dependent luciferase expression. Consistent with the phosphorylation states of I{kappa}B, UV irradiation inhibited the T cell stimulation-induced NF-{kappa}B-dependent transcription (Fig. 7C). Taken together, these data demonstrate that UV irradiation may suppress an ongoing T cell immune response.



View larger version (50K):
[in this window]
[in a new window]
 
FIGURE 7. UV irradiation suppresses c-Jun and Egr-1 expression and NF-{kappa}B activity in preactivated T cells. A, Jurkat T cells were first stimulated for 5–30 min and then treated with different doses of UV 254 nm irradiation. At 1.5 h after UV exposure, total cell lysates were sequentially immunoblotted with Abs against c-Jun, p-c-Jun, c-Fos, Egr-1, and tubulin. Data are representative of three independent experiments. B, Jurkat T cells were prestimulated as above and then irradiated with 30 J/m2 UV 254 nm. Total cell lysates were immunoblotted with anti-p-I{kappa}B{alpha} and stripped for immunoblot to anti-I{kappa}B{alpha}. Data are representative of two independent experiments. C, Jurkat T cells bearing integrated 3xNF-{kappa}B-luciferase were stimulated with PMA/ionomycin. Thirty and 60 min later, the cells were irradiated with different doses of UV 254 nm, and 8 h later, cells were harvested for luciferase assays. Results represent the average of three separate experiments.

 
UV-induced overactivation of p38 and JNK suppresses ERK and NF-{kappa}B pathway

From the above experiments, we noticed that UV irradiation induces a strong activation of p38 and JNK. It has been reported that p38 activity may inhibit I{kappa}B{alpha} phosphorylation and thereby limit NF-{kappa}B activity (38). To investigate whether overactivation of p38 by UV irradiation interferes with NF-{kappa}B activity, PMA/ionomycin-stimulated Jurkat T cells were treated with UV irradiation in the presence or absence of the widely used p38 and JNK kinase inhibitors SB203580 and SP600125. In agreement with the previous report (38), immunoblotting analysis showed that inhibition of the p38 activity largely prevented UV-mediated suppression of I{kappa}B{alpha} phosphorylation (Fig. 8A). To obtain a clearer picture about the role of p38 and JNK in regulation of the NF-{kappa}B activity, we examined the levels of the NF-{kappa}B subunit p50 and p65 expression in the nucleus of Jurkat cells after UV irradiation in the presence or absence of the p38 and JNK inhibitors. In correlation with the recovering levels of p-I{kappa}B{alpha} in the presence of the p38 inhibitor, UV-induced reduction in p65 and p50 in the nucleus was significantly recovered (Fig. 8, B and C). Thus, p38 is involved in inhibition of NF-{kappa}B activity.



View larger version (58K):
[in this window]
[in a new window]
 
FIGURE 8. Inhibition of p38 and JNK activity prevented UV-mediated suppression of T cell activation-induced activation of NF-{kappa}B and ERK. A, Jurkat T cells were preincubated with the p38 and JNK kinase inhibitors SB203580 (SB, 5 µM) and SP600125 (SP, 25 µM) for 1 h, subsequently irradiated with 30 J/m2 (UV 254), and stimulated with PMA and ionomycin (+) for 30 min. Cell lysates were immunoblotted with the anti-p-P38 Ab and stripped for blotting to p38, p-I{kappa}B{alpha}, I{kappa}B{alpha}, and tubulin sequentially. B, Nuclear proteins were prepared from UV-irradiated Jurkat T cells in the presence or absence of either the p38 (SB) or the JNK (SP) inhibitor and immunoblotted to the anto-p65 Ab and stripped for blotting to p50, YY1, and tubulin sequentially. C, Nuclear proteins from UV-irradiated Jurkat T cells in the presence of both inhibitors and subjected to immunoblotting to p65, p50, and YY1 sequentially. Results are representative of two independent experiments. D, Jurkat T cells were UV (30 J/m2 254 nm) irradiated in the presence or absence of the p38 and JNK kinase inhibitors SB203580 (SB) and SP600125 (SP) and stimulated with PMA and ionomycin for 30 min. Cell lysates were immunoblotted with the anti-p-P38 Ab and stripped for blotting to p38, p-JNK, JNK1, p-ERK, ERK-1, and tubulin sequentially. E, Jurkat T cells were UV irradiated in the presence or absence of single or combined inhibitors and stimulated, as above. Cell lysates were immunoblotted with p-ERK, ERK-1, and tubulin sequentially. Results are representative of two independent experiments. F, Jurkat T cells were preincubated with the ERK-specific inhibitor PD98059 (10 and 50 µM) for 30 min and subsequently stimulated with PMA and ionomycin (+) for 1 h. Cell lysates were immunoblotted with Abs indicated. G, Peripheral blood T cells were irradiated with a single dose of UV 254 nm (20 J/m2) in the presence (added 30 min before irradiation) or absence of SB203580 (5 µM) and SP600125 (5 µM). The irradiated cells were immediately stimulated with PMA/ionomycin. After 24-h stimulation, the supernatants were analyzed for IL-2 and IFN-{gamma} production by ELISA. Data are representative of two separate experiments with T cells from two different donors.

 
JNK, p38, and ERK are activated by distinct sets of MAPK kinase (15). We wondered whether overactivation of p38 and JNK pathway would lead to the attenuation of the ERK pathway. To investigate this, experiments were performed with the p38 and JNK inhibitors. As already observed, UV irradiation strongly induces phosphorylation of p38 and JNK. In comparison, stimulation of Jurkat T cells with PMA/ionomycin led to a much weaker activation of p38 and JNK, which could only be seen after a longer time exposure of the blot (Fig. 8D, and data not shown). Higher levels of p38 and JNK activation were associated with lower levels of ERK activity (Fig. 8D). Inhibition of both p38 and JNK activities strongly restored UV-induced reduction of PMA/ionomycin-induced ERK activation (Fig. 8D). Additional experiments using single inhibitor showed that JNK, but not p38, prevents ERK activation (Fig. 8E). The experiments demonstrate that UV-induced overactivation of p38 and JNK pathway may account for the UV-mediated suppression of the ERK and NF-{kappa}B pathway.

The ERK pathway has been shown to activate expression of several transcription factors, including Egr-1 and Jun, in different mammalian cells (27, 28, 39, 40, 41, 42). To investigate the role of the ERK pathway in the activation of Egr-1, AP-1, and NF-{kappa}B in T cells, we stimulated Jurkat T cells with PMA/ionomycin in the presence or absence of the ERK-specific inhibitor PD98059. In agreement with other studies (27, 28, 39, 40, 41, 42), immunoblotting analysis showed that inhibition of the ERK activity led to reduced Egr-1 expression in activated T cells (Fig. 8F). The ERK signaling pathway was also shown to be involved in the activation of Fos and Jun in T cells because treatment with the ERK inhibitor significantly down-regulated the expression levels of Fos and Jun (Fig. 8F). In contrast, blocking the ERK pathway did not show any inhibition of T cell activation-induced degradation of I{kappa}B. The experiment indicates that UV-mediated suppression of the ERK pathway is responsible for deficient Egr-1 and AP-1 activation.

To further investigate the role of p38/JNK in the UV-mediated suppression of cytokine expression in T cells, p38 and JNK inhibitors were used in ELISA analysis. Freshly isolated blood T cells were UV irradiated in the presence or absence of the p38 and JNK inhibitors SB203580 and SP600125, and cytokine secretion was analyzed 24 h after T cell activation. The experiments showed that inhibition of either p38 or JNK partially restored UV-induced reduction of IL-2 and IFN-{gamma} protein production in primary T cells (Fig. 8G). Inhibition of both p38 and JNK activities resulted in an almost complete restoration of IL-2 and IFN-{gamma} production. These experiments demonstrate that UV-mediated overactivation of p38 and JNK is the main cause of UV-mediated suppression of cytokine expression.

UVC and UVB synergistically inhibit T cell activation

UVC can largely be absorbed by ozone and oxygen and also does not penetrate the skin layer as well as the UVB and UVA. The question arose on whether a very low dose of UVC could synergize with the longer UV wavelength to suppress T cell activation. To investigate this question, Jurkat T cells were transiently transfected with the luciferase reporter plasmids containing either the IL-2 or the IFN-{gamma} promoter, and the transfected cells were treated with combinations of UVB and low doses of UVC (1.25–5 J/m2). The experiment revealed that UVC at very low doses could significantly enhance the suppressive effect of UVB on the IL-2 and IFN-{gamma} promoter activity (Fig. 9, A and B). Immunoblotting analysis showed that the T cell activation-induced expression of Egr-1 and c-Jun was synergistically suppressed by UVB plus low doses of UVC (Fig. 9C). The experiments also revealed that low doses of UVC synergize with UVB to enhance T cell activation-induced phosphorylation of p38. In addition, a tendency in synergic blocking of I{kappa}B degradation was also observed in cells treated with combinations of UVB and low doses of UVC. In contrast to UVC, UVB alone does not induce phosphorylation of JNK and c-Jun. Also, UVC and UVB did not show any synergistic effect on the phosphorylation of JNK and c-Jun. These experiments demonstrate that the immunosuppressive effect of UVB could be enhanced by the cotreatment with low doses of UVC.



View larger version (68K):
[in this window]
[in a new window]
 
FIGURE 9. Suppressive effects of UVB can be enhanced by low doses of UVC. A and B, Jurkat T cells were transiently transfected with the pLuc-IL-2 promoter luciferase reporter plasmid. After overnight recovery, the transfected cells were split and exposed to different doses of UV 254 nm and UV 312 irradiation, as indicated. Luciferase activity was determined after 8-h PMA and ionomycin stimulation. C, Jurkat T cells were treated with UV 254 nm and UV 312 irradiation, as in A. The total cell lysates were immunoblotted with the Abs indicated. Data are representative of two separate experiments.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The UV-induced suppression of the adaptive immune responses may be responsible for certain infectious diseases, and is also a major risk factor for skin cancer. Previous research indicates that alterations in APC function (5, 12) and induction of suppressor T cells (11, 14, 15) play a critical role in UV-mediated immune suppression. In this study, we provide another mechanism by which UV irradiation directly down-modulates T cell immune responses. We show that UV irradiation suppresses the ERK and I{kappa}B signaling pathways initiated by TCR stimulation and thereby down-regulates T cell activation-induced expression of transcription factors Egr-1, c-Jun, c-Fos, and NF-{kappa}B, and their target genes (Fig. 10). In particular, IL-2 is an important T cell cytokine driving the proliferation of T lymphoid cells in the periphery (43). In addition, IFN-{gamma} was considered to be a key cytokine involved in tumor rejection by T cells (44). Thus, direct suppression of T cell activation by UV radiation may account for the earliest impairment of T cell immune responses.



View larger version (33K):
[in this window]
[in a new window]
 
FIGURE 10. Effects of UV irradiation on TCR signaling cascades. TCR signaling leads to the activation of phosphatidylinositol-specific phospholipase C (PLC)-{gamma}, and subsequently results in the hydrolysis of phosphatidylinositol 4,5-bisphosphate to inositol 3,4,5-triphosphate (IP3) and diacylglycerol (DAG). IP3 production leads to an increase of intracellular free Ca2+ levels and consequently to the activation of the Ca2+-dependent serine/threonine phosphatase calcineurin, which is involved in the dephosphorylation and nuclear translocation of NF-AT. In parallel, DAG activates protein kinase C{theta} (PKC{theta}) and MAPK. PKC-{theta} activates I{kappa}B kinase, leading to the phosphorylation and degradation of the I{kappa}B and the nuclear translocation of NF-{kappa}B (p65/p50). The MAPK signaling pathway involves three major groups of MAPK: the ERK, the p38 MAPK, and the JNK. The ERK pathway can be activated by Ras via the Raf group of MAPK kinases. In contrast, the p38 and JNK MAPK are activated by Rho family GTPases, including Rac. Expression of Egr-1, Jun, and Fos is shown to be regulated by the ERK pathway in T cells. The transcriptional activity of Jun can be further enhanced via phosphorylation by JNK. UVC irradiation leads to strong activation of the p38/JNK pathway. In contrast to UVC, UVB activates p38, but not JNK pathway. Overactivation of p38 and JNK pathways results in suppression of TCR-activated ERK and NF-{kappa}B pathway, respectively.

 
Our experiments demonstrate that UV irradiation could block c-Jun, c-Fos, and Egr-1 protein expression, and hence suppress AP-1- and Egr-1-dependent transcription in preactivated T cells. UV irradiation also strongly induces phosphorylation of c-Jun by activation of JNK. Because the activities of c-Jun can be enhanced by phosphorylation, irradiation by a low dose of UV may increase c-Jun-dependent transcription. In contrast, higher doses of UV irradiation led to suppression of c-Jun-mediated transcription due to limited amounts of c-Jun proteins. We also show that UV irradiation can block phosphorylation of I{kappa}B in prestimulated T cells and consequently inhibit NF-{kappa}B-dependent transcription. These data indicate that UV irradiation does not only impair T cell function in response to T cell activation, but may also have systemic effects that influence ongoing immune responses.

Stimulation of T cells leads to activation of a group of MAPK kinase, which, in turn, activates ERK, p38, and JNK kinases (15). We show that UV irradiation strongly induces activation of the p38 and JNK pathway in T cells. Activation of the mitogen-activated protein signaling pathways by UVC has also been observed in other cell types (45, 46). We show that inhibitor that blocks JNK activation restored UV-mediated suppression of T cell activation-induced ERK activity. Therefore, overactivation of JNK pathway may account for UV-mediated suppression of the ERK pathway (Fig. 10). We also show that overactivation of p38 pathway may lead to suppression of I{kappa}B{alpha} phosphorylation and nuclear translocation of the NF-{kappa}B subunits p50 and p65. Thus, p38 activity plays a major role in suppression of T cell activation-induced phosphorylation of I{kappa}B{alpha} and degradation of I{kappa}B{alpha} (Fig. 10).

Exposure to UV irradiation has been shown to induce activation of Egr-1, c-Jun, and NF-{kappa}B and their target genes (20, 21, 22). In agreement with the previous findings, we also found that UV irradiation alone could increase certain levels of Egr-1, c-Jun, and NF-{kappa}B expression in nonstimulated T cells. However, we did not detect substantial elevations of IL-2, IFN-{gamma}, TNF-{alpha}, and IL-4 in UV-irradiated T cells. With the exception of two donors, a slightly elevated IL-4 production was seen after a higher dose (60 J/m2) of UV 254 nm exposure. However, this was not seen in other donors. In comparison, TCR stimulation induces much higher levels of c-Jun, Egr-1, and NF-{kappa}B expression accompanied with high levels of cytokine expression. Apparently, the levels of transcription factors induced by UV irradiation are not high enough to initiate transcription of cytokine genes in T cells, indicating that UV irradiation alone is not able to activate T cells to produce cytokines.

Studies have shown that UV exposure especially inhibits Th1 immune responses, whereas the role of UV irradiation in regulation of Th2 responses is not well documented (16). One study indicates that APCs from internal lymphoid organs of UV-irradiated mice do not present Ag to Th1, but to Th2 cells. However, the exact mechanisms by which the APCs distinguish between Th1 and Th2 are not known (47). It has been speculated that suppression of Th1 responses by UV irradiation might induce a skewing toward Th2 responses, although recent studies in rodents show suppression of the Th2 immune response as well (18, 19, 48). Our experiments demonstrate that exposure of peripheral blood T cells to UV results in an almost equal impairment of Th1 and Th2 cytokine expression at both the protein and the mRNA levels. Therefore, UV exposure leads to a general inhibition of T cell activation.

The most significant wavelength of UV irradiation with respect to skin cancer lies in the range of 200–400 nm. The short wavelength UV at 200–280 nm can largely be absorbed by ozone and oxygen and does not penetrate the earth’s atmosphere as well as the longer wavelength (280–400). Therefore, the contribution of the short wavelength UV irradiation to the development of skin cancers has often been considered to be less important. However, the continuous reduction of the ozone layer by environmental pollutants (49, 50, 51) implies that exposure to short wavelength UV from thinner ozone layers increases the risk for skin cancer (51, 52). In addition, UVC doses at the 159 mJ/cm2 to 11.88 J/cm2 have been shown to suppress contact hypersensitivity in animal studies (8, 9). Prolongation of survival of human alloskin grafts was observed in a clinical trial using UVC 11 J/cm (10). UVC was also indicated to be a more effective wavelength than UVB (8). Our data show that UVC (254 nm) is ~100-fold more potent than UVB (312 nm) in suppressing cytokine expression. A single 5 J/m2 UV 254 nm exposure resulted in a >80% reduction of cytokine expression in peripheral blood T cells. The doses used in our studies are much lower than the doses used in animal and clinical studies. Thus, although only a small amount of UVC may reach the dermis, the biological effects might be significant.


    Acknowledgments
 
We thank Dr. T. Wirth for providing the Jurkat cells bearing the 3x{kappa}B-Luc reporter gene; Dr. M. L. Schmitz for providing the pluc-Bax plasmid; and K. Bourkoula, S. Baumann and R. Arnold for critically evaluating the manuscript.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Address correspondence and reprint requests to Dr. Min Li-Weber, Tumor Immunology Program D030, German Cancer Research Center (Deutches Krebsforschungszentrum), Im Neuenheimer Feld 280, 69120 Heidelberg, Germany. E-mail address: m.li-weber{at}dkfz-heidelberg.de Back

2 Abbreviation used in this paper: p, phosphorylated. Back

Received for publication December 1, 2004. Accepted for publication May 30, 2005.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Daya-Grosjean, L., N. Dumaz, A. Sarasin. 1995. The specificity of p53 mutation spectra in sunlight induced human cancers. J. Photochem. Photobiol. B 28: 115-124. [Medline]
  2. Dumaz, N., C. Drougard, A. Sarasin, L. Daya-Grosjean. 1993. Specific UV-induced mutation spectrum in the p53 gene of skin tumors from DNA-repair-deficient xeroderma pigmentosum patients. Proc. Natl. Acad. Sci. USA 90: 10529-11033. [Abstract/Free Full Text]
  3. Sleijffers, A., J. Garssen, H. Van Loveren. 2002. Ultraviolet radiation, resistance to infectious diseases, and vaccination responses. Methods 28: 111-121. [Medline]
  4. Kripke, M. L., M. S. Fisher. 1976. Immunologic parameters of ultraviolet carcinogenesis. J. Natl. Cancer Inst. 57: 211-215.
  5. Noonan, F. P., M. L. Kripke, G. M. Pedersen, M. I. Greene. 1981. Suppression of contact hypersensitivity in mice by ultraviolet irradiation is associated with defective antigen presentation. Immunology 43: 527-533. [Medline]
  6. Streilein, J. W., J. R. Taylor, V. Vincek, I. Kurimoto, T. Shimizu, C. Tie, C. Golomb. 1994. Immune surveillance and sunlight-induced skin cancer. Immunol. Today 15: 174-179. [Medline]
  7. Kripke, M. L.. 1984. Immunological unresponsiveness induced by ultraviolet radiation. Immunol. Rev. 80: 87-102. [Medline]
  8. Nithiuthai, S., J. R. Allen. 1984. Effects of ultraviolet irradiation on epidermal Langerhans cells in guinea-pigs. Immunology 51: 143-151. [Medline]
  9. Baker, D., D. D. Parker, J. L. Turk. 1985. Effect of depletion of epidermal dendritic cells on the induction of contact sensitivity in the guinea-pig. Br. J. Dermatol. 113: 285-294. [Medline]
  10. Wu, J., D. Barisoni, U. Armato. 1996. Prolongation of survival of alloskin grafts with no concurrent general suppression of the burned patient’s immune system: a preliminary clinical investigation. Burns 22: 353-358. [Medline]
  11. Fisher, M. S., M. L. Kripke. 1982. Suppressor T lymphocytes control the development of primary skin cancers in ultraviolet-irradiated mice. Science 216: 1133-1134. [Abstract/Free Full Text]
  12. Greene, M. I., M. Sy, M. S. Kripke, B. Benacerraf. 1979. Impairment of antigen-presenting cell function by ultraviolet radiation. Proc. Natl. Acad. Sci. USA 76: 6591-6595. [Abstract/Free Full Text]
  13. Daynes, R. A., C. W. Spellman. 1977. Evidence for the generation of suppressor cells by ultraviolet radiation. Cell. Immunol. 31: 182-187. [Medline]
  14. Fisher, M. S., M. L. Kripke. 1977. Systemic alteration induced in mice by ultraviolet light irradiation and its relationship to ultraviolet carcinogenesis. Proc. Natl. Acad. Sci. USA 74: 1688-1692. [Abstract/Free Full Text]
  15. Moodycliffe, A. M., D. Nghiem, G. Clydesdale, S. E. Ullrich. 2000. Immune suppression and skin cancer development: regulation by NKT cells. Nat. Immunol. 1: 521-525. [Medline]
  16. Brown, E. L., J. M. Rivas, S. E. Ullrich, C. R. Young, S. J. Norris, M. L. Kripke. 1995. Modulation of immunity to Borrelia burgdorferi by ultraviolet irradiation: differential effect on Th1 and Th2 immune responses. Eur. J. Immunol. 25: 3017-3022. [Medline]
  17. Garssen, J., R. J. Vandebriel, F. R. De Gruijl, D. A. Wolvers, M. Van Dijk, A. Fluitman, H. Van Loveren. 1999. UVB exposure-induced systemic modulation of Th1- and Th2-mediated immune responses. Immunology 97: 506-514. [Medline]
  18. Goettsch, W., J. Garssen, A. Deijns, F. R. de Gruijl, H. van Loveren. 1994. UV-B exposure impairs resistance to infection by Trichinella spiralis. Environ. Health Perspect. 102: 298-301. [Medline]
  19. Goettsch, W., J. Garssen, F. R. De Gruijl, H. Van Loveren. 1996. UVB-induced decreased resistance to Trichinella spiralis in the rat is related to impaired cellular immunity. Photochem. Photobiol. 64: 581-585. [Medline]
  20. Bender, K., M. Gottlicher, S. Whiteside, H. J. Rahmsdorf, P. Herrlich. 1998. DNA damage-independent and -dependent activation of NF-{kappa}B by UV. EMBO J. 17: 5170-5181. [Medline]
  21. Huang, R. P., Y. Fan, A. L. Boynton. 1999. UV irradiation up-regulates Egr-1 expression at transcription level. J. Cell. Biochem. 73: 227-236. [Medline]
  22. Wilhelm, D., H. van Dam, I. Herr, B. Baumann, P. Herrlich, P. Angel. 1995. Both ATF-2 and c-Jun are phosphorylated by stress-activated protein kinases in response to UV irradiation. Immunobiology 193: 143-148. [Medline]
  23. Decker, E. L., C. Skerka, P. E. Zipfel. 1998. The early growth response protein (EGR-1) regulates interleukin-2 transcription by synergistic interaction with the nuclear factor of activated T cells. J. Biol. Chem. 273: 26923-26930. [Abstract/Free Full Text]
  24. Jain, J., C. Loh, A. Rao. 1995. Transcriptional regulation of the IL-2 gene. Curr. Opin. Immunol. 7: 333-342. [Medline]
  25. Kaminuma, O., C. Elly, Y. Tanaka, A. Mori, Y. C. Liu, A. Altman, S. Miyatake. 2002. Vav-induced activation of the human IFN-{gamma} gene promoter is mediated by up-regulation of AP-1 activity. FEBS Lett. 514: 153-158. [Medline]
  26. Sica, A., L. Dorman, V. Viggiano, M. Cippitelli, P. Ghosh, N. Rice, H. A. Young. 1997. Interaction of NF-{kappa}B and NFAT with the interferon-{gamma} promoter. J. Biol. Chem. 272: 30412-30420. [Abstract/Free Full Text]
  27. Guha, M., M. A. O’Connell, R. Pawlinski. 2001. Lipopolysaccharide activation of the MEK-ERK1/2 pathway in human monocytic cells mediates tissue factor and tumor necrosis factor {alpha} expression by inducing Elk-1 phosphorylation and Egr-1 expression. Blood 98: 1429-1439. [Abstract/Free Full Text]
  28. Shi, L., R. Kishore, M. R. McMullen, L. E. Nagy. 2002. Lipopolysaccharide stimulation of ERK1/2 increases TNF-{alpha} production via Egr-1. Am. J. Physiol. Cell Physiol. 282: C1205-C1211. [Abstract/Free Full Text]
  29. Li-Weber, M., M. Giasi, P. H. Krammer. 1998. Involvement of Jun and Rel proteins in up-regulation of interleukin-4 gene activity by the T cell accessory molecule CD28. J. Biol. Chem. 273: 32460-32466. [Abstract/Free Full Text]
  30. Li-Weber, M., P. H. Krammer. 2003. Regulation of IL4 gene expression by T cells and therapeutic perspectives. Nat. Rev. Immunol. 3: 534-543. [Medline]
  31. Klas, C., K. M. Debatin, R. R. Jonker, P. H. Krammer. 1993. Activation interferes with the APO-1 pathway in mature human T cells. Int. Immunol. 5: 625-630. [Abstract/Free Full Text]
  32. Li-Weber, M., M. Giaisi, M. K. Treiber, P. H. Krammer. 2002. The anti-inflammatory sesquiterpene lactone parthenolide suppresses IL-4 gene expression in peripheral blood T. Eur. J. Immunol. 32: 3587-3597. [Medline]
  33. Heid, C. A., J. Stevens, K. J. Livak, P. M. Williams. 1996. Real time quantitative PCR. Genome Res. 6: 986-994. [Abstract/Free Full Text]
  34. Weston, R., R. J. Davis. 2002. The JNK signal transduction pathway. Curr. Opin. Genet. Dev. 12: 14-21. [Medline]
  35. Dong, C., R. J. Davis, R. A. Flavell. 2002. MAP kinases in the immune response. Annu. Rev. Immunol. 20: 55-72. [Medline]
  36. Platanias, L. C.. 2003. MAP kinase signaling pathways and hematologic malignancies. Blood 101: 4667-4679. [Abstract/Free Full Text]
  37. Pahl, H. L.. 1999. Activators and target genes of Rel/NF-{kappa}B transcription factors. Oncogene 18: 6853-6866. [Medline]
  38. Ivanov, V. N., Z. Ronai. 2000. p38 protects human melanoma cells from UV-induced apoptosis through down-regulation of NF-{kappa}B activity and Fas expression. Oncogene 19: 3003-3012. [Medline]
  39. Midgley, V. C., L. M. Khachigian. 2004. Fibroblast growth factor-2 induction of platelet-derived growth factor-C chain transcription in vascular smooth muscle cells is ERK-dependent but not JNK-dependent and mediated by Egr-1. J. Biol. Chem. 279: 40289-40295. [Abstract/Free Full Text]
  40. Murphy, L. O., J. P. MacKeigan, J. Blenis. 2004. A network of immediate early gene products propagates subtle differences in mitogen-activated protein kinase signal amplitude and duration. Mol. Cell. Biol. 24: 144-153. [Abstract/Free Full Text]
  41. Jones, N., F. H. Agani. 2003. Hyperoxia induces Egr-1 expression through activation of extracellular signal-regulated kinase 1/2 pathway. J. Cell. Physiol. 196: 326-333. [Medline]
  42. Bochkov, V. N., D. Mechtcheriakova, M. Lucerna, J. Huber, R. Malli, W. F. Graier, E. Hofer, B. R. Binder, N. Leitinger. 2002. Oxidized phospholipids stimulate tissue factor expression in human endothelial cells via activation of ERK/EGR-1 and Ca++/NFAT. Blood 99: 199-206. [Abstract/Free Full Text]
  43. Schorle, H., T. Holtschke, T. Hunig, A. Schimpl, I. Horak. 1991. Development and function of T cells in mice rendered interleukin-2 deficient by gene targeting. Nature 352: 621-624. [Medline]
  44. Blankenstein, T., Z. Qin. 2003. The role of IFN-{gamma} in tumor transplantation immunity and inhibition of chemical carcinogenesis. Curr. Opin. Immunol. 15: 148-154. [Medline]
  45. Iordanov, M., K. Bender, T. Ade, W. Schmid, C. Sachsenmaier, K. Engel, M. Gaestel, H. J. Rahmsdorf, P. Herrlich. 1997. CREB is activated by UVC through a p38/HOG-1-dependent protein kinase. EMBO J. 16: 1009-1022. [Medline]
  46. Sachsenmaier, C., A. Radler-Pohl, R. Zinck, A. Nordheim, P. Herrlich, H. J. Rahmsdorf. 1994. Involvement of growth factor receptors in the mammalian UVC response. Cell 78: 963-972. [Medline]
  47. Ullrich, S. E.. 1994. Mechanism involved in the systemic suppression of antigen-presenting cell function by UV irradiation: keratinocyte-derived IL-10 modulates antigen-presenting cell function of splenic adherent cells. J. Immunol. 152: 3410-3416. [Abstract]
  48. Van Loveren, H., A. Boonstra, M. Van Dijk, A. Fluitman, H. F. Savelkoul, J. Garssen. 2000. UV exposure alters respiratory allergic responses in mice. Photochem. Photobiol. 72: 253-259. [Medline]
  49. Coldiron, B. M.. 1996. Ozone depletion update. Dermatol. Surg. 22: 296-299. [Medline]
  50. Prather, M., P. Midgley, F. S. Rowland, R. Stolarski. 1996. The ozone layer: the road not taken. Nature 381: 551-554.
  51. Slaper, H., G. J. Velders, J. S. Daniel, F. R. de Gruijl, J. C. van der Leun. 1996. Estimates of ozone depletion and skin cancer incidence to examine the Vienna Convention achievements. Nature 384: 256-258. [Medline]
  52. Jankowski, J., A. B. Cader. 1997. The effect of depletion of the earth ozone layer on the human health condition. Int. J. Occup. Med. Environ. Health 10: 349-364. [Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
M. E. Munroe and G. A. Bishop
A Costimulatory Function for T Cell CD40
J. Immunol., January 15, 2007; 178(2): 671 - 682.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
X. Shan, A. Hu, H. Veler, S. Fatma, J. S. Grunstein, S. Chuang, and M. M. Grunstein
Regulation of Toll-like receptor 4-induced proasthmatic changes in airway smooth muscle function by opposing actions of ERK1/2 and p38 MAPK signaling
Am J Physiol Lung Cell Mol Physiol, September 1, 2006; 291(3): L324 - L333.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Li-Weber, M.
Right arrow Articles by Krammer, P. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li-Weber, M.
Right arrow Articles by Krammer, P. H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS