|
|
||||||||
, and TNF-
through Nucleotide-Binding Oligomerization Domain 2-Mediated Signaling in Osteoblasts1






* Department of Oral and Maxillofacial Surgery,
Institute for Oral Science, and
Department of Biochemistry, Matsumoto Dental University, Nagano, Japan;
Department of Periodontology and ¶ Department of Pharmacology, School of Dentistry, Aichi Gakuin University, Nagoya, Japan; || Medical Institute of Bioregulation, Kyushu University, Fukuoka, Japan; # Research Institute for Microbial Disease, Osaka University, Suita, Japan; and** Department of Microbiology and Immunology, Tohoku University School of Dentistry, Sendai, Japan
| Abstract |
|---|
|
|
|---|
,25-dihydroxyvitamin D3 (1
,25(OH)2D3) and PGE2, LPS and IL-1
stimulate osteoclast formation in mouse cocultures of primary osteoblasts and hemopoietic cells. MDP alone could not induce osteoclast formation in the coculture, but enhanced osteoclast formation induced by LPS, IL-1
, or TNF-
but not 1
,25(OH)2D3 or PGE2. MDP failed to enhance osteoclast formation from osteoclast progenitors induced by receptor activator of NF-
B ligand (RANKL) or TNF-
. MDP up-regulated RANKL expression in osteoblasts treated with LPS or TNF-
but not 1
,25(OH)2D3. Osteoblasts expressed mRNA of nucleotide-binding oligomerization domain 2 (Nod2), an intracellular sensor of MDP, in response to LPS, IL-1
, or TNF-
but not 1
,25(OH)2D3. Induction of Nod2 mRNA expression by LPS but not by TNF-
in osteoblasts was dependent on TLR4 and MyD88. MDP also enhanced TNF-
-induced osteoclast formation in cocultures prepared from Toll/IL-1R domain-containing adapter protein (TIRAP)-deficient mice through the up-regulation of RANKL mRNA expression in osteoblasts, suggesting that TLR2 is not involved in the MDP-induced osteoclast formation. The depletion of intracellular Nod2 by small interfering RNA blocked MDP-induced up-regulation of RANKL mRNA in osteoblasts. LPS and RANKL stimulated the survival of osteoclasts, and this effect was not enhanced by MDP. These results suggest that MDP synergistically enhances osteoclast formation induced by LPS, IL-1
, and TNF-
through RANKL expression in osteoblasts, and that Nod2-mediated signals are involved in the MDP-induced RANKL expression in osteoblasts. | Introduction |
|---|
|
|
|---|
B ligand (RANKL),3 another cytokine essential for osteoclastogenesis, is expressed by osteoblasts as a membrane-associated cytokine (4, 5). Osteoclast precursors express RANK (a receptor of RANKL), recognize RANKL expressed by osteoblasts through cell-cell interaction, and differentiate into osteoclasts in the presence of M-CSF (6). M-CSF is constitutively expressed by osteoblasts, while RANKL expression is tightly regulated by bone-resorbing hormones and cytokines such as 1
,25-dihydroxyvitamin D3 (1
,25(OH)2D3), parathyroid hormone, PGE2, IL-1
, and IL-11 (7). These factors stimulate the expression of RANKL in osteoblasts. Osteoprotegerin (OPG), produced mainly by osteoblasts, is a soluble decoy receptor for RANKL. OPG blocks osteoclastogenesis by inhibiting the RANKL-RANK interaction. Mature osteoclasts also express RANK, and RANKL supports the survival and stimulates the bone-resorbing activity of osteoclasts (8). TLR family members have been shown to be important in the activation of cells by a variety of microbial ligands (9). LPS, an amphiphilic molecule in the outer membrane of Gram-negative bacteria, is involved in bone resorption in inflammatory diseases (10). TLR4 is a signal-transducing receptor for LPS. It is well known that C3H/HeJ mice, which show extremely low responsiveness to LPS, have a point mutation in the intracellular domain of TLR4 (11). The cytoplasmic signaling cascade of TLR4 is quite similar to that of the IL-1R, because both receptors possess intracytoplasmic Toll/IL-1R (TIR) domains (12). Accumulating evidence has demonstrated that TIR domain-containing adaptors, such as MyD88 and TIR domain-containing adapter protein (TIRAP), modulate IL-1R and TLR signaling pathways (9). MyD88 is essential for the induction of inflammatory cytokines triggered by IL-1R and all TLRs (13). In contrast, TIRAP is specifically involved in the TLR2 and TLR4-mediated signaling (14). TLR2 has been shown to recognize several classes of pathogen-associated molecular patterns, including peptidoglycan (15).
Muramyl dipeptide (MDP), the minimal essential structural unit responsible for the immunoadjuvant activity of peptidoglycans, is distributed ubiquitously in cell walls of both Gram-negative and -positive bacteria (16). MDP has been shown to exert diverse biological effects on immunocompetent cells (17). We have shown that injection of MDP into mice resulted in endotoxin hypersensitivity: enhanced production of TNF-
(18) and lethal shock (19) upon challenge injection of LPS. We also showed that MDP synergistically enhanced LPS-induced proinflammatory cytokine production in human monocytic cells (20). Recently, it was proposed that nucleotide-binding oligomerization domain 2 (Nod2), a member of the Apaf1/Nod protein family, is an intracellular sensor of MDP (21, 22, 23). Nod2 consists of two N-terminal caspase-recruitment domains, a centrally located nucleotide-binding domain and C-terminal leucine-rich repeats, and acts as a signal-transducing adaptor. Nod2 expression is enhanced by proinflammatory cytokines and LPS (22). Recent studies have established that a frameshift mutation of Nod2, which results in a deficiency in MDP-mediated NF-
B activation, is involved in susceptibility to Crohns disease, a chronic inflammatory disorder of the intestinal tract (23). Thus, MDP plays roles in many aspects of inflammatory responses.
Many types of cells, including macrophages, lymphocytes, gingival fibroblasts, and osteoblasts, express TLR4, and produce PGE2 and proinflammatory cytokines such as TNF-
and IL-1 in response to LPS (24, 25, 26). LPS, TNF-
, and IL-1 also stimulate the differentiation and function of osteoclasts directly or indirectly. We and others have reported that TNF-
together with M-CSF directly stimulates the differentiation of osteoclast progenitors into osteoclasts even in the absence of RANKL (27, 28). Osteoclasts express both TLR4 and IL-1R. LPS and IL-1
directly stimulate the survival, fusion, and bone-resorbing activity of osteoclasts through their respective receptors (29, 30). In addition, LPS and IL-1
stimulate RANKL expression in osteoblasts (31, 32). Using MyD88-deficient mice, we have shown that MyD88-mediated signaling is essential in RANKL expression in osteoblasts induced by LPS and IL-1
but not 1
,25(OH)2D3 (33).
In this study, we explored effects of MDP on osteoclast differentiation in vitro. MDP alone could not induce osteoclast formation in mouse cocultures of primary osteoblasts and hemopoietic cells, but markedly enhanced osteoclast formation induced by LPS, IL-1
, or TNF-
but not 1
,25(OH)2D3 or PGE2. MDP up-regulated RANKL expression in osteoblasts treated with LPS or TNF-
but not with 1
,25(OH)2D3. The MDP-induced up-regulation of RANKL expression in osteoblasts was shown to be mediated by Nod2 but not TLR2 or TLR4.
| Materials and Methods |
|---|
|
|
|---|
Five- to 8-wk-old male ddY mice and newborn ddY mice were obtained from the Shizuoka Laboratories Animal Center. C3H/HeJ mice, which have a point mutation in the TLR4 gene, were obtained from Japan Clea. MyD88-deficient (MyD88/), TLR4-deficient (TLR4/), and TIRAP-deficient (TIRAP/) mice were generated and maintained as described previously (13, 14, 34). MyD88/ and TLR4/ mice were derived from the genetic background of C57BL/6J. TIRAP/ mice were derived from a 129 and C57BL/6J mixed background. After heterozygous (+/) mating, homozygous (/), heterozygous (+/), and wild-type (WT) (+/+) mice were identified by PCR analysis of tail DNA from each mouse, as described previously. All procedures for animal care were approved in the Animal Management Committee of Matsumoto Dental University. Purified LPS (Escherichia coli 055:B5) and chemically synthesized MDP (N-acetylmuramyl-L-alany-D-isoglutamine) were purchased from Sigma-Aldrich. Mouse TNF-
and IL-1
were obtained form Genzyme. 1
,25(OH)2D3 and PGE2 were purchased from Wako. Recombinant human M-CSF (Leukoprol) was obtained from Kyowa Hakko. Recombinant human soluble RANKL was purchased from PeproTech. Rabbit anti-mouse phospho-ERK1/2 (Thr202/Tyr204) Ab, rabbit anti-mouse ERK1/2 Ab, and rabbit anti-mouse I
B
Ab were purchased from Cell Signaling Technology. Specific PCR primers for mouse RANKL, OPG, Nod2, and GAPDH were synthesized by Invitrogen Life Technologies. Other chemicals and reagents used were of analytical grade.
Osteoclast differentiation assay
To isolate primary osteoblasts from either ddY, C3H/HeJ, MyD88/, TLR4/, or TIRAP/ mice, calvaria from 2-day-old mice were cut into small pieces and cultured for 5 days in type I collagen gel (Cell matrix type-IA; Nitta Gelatin) prepared in
MEM (Sigma-Aldrich) containing 10% FBS (JRH Biosciences) (35). Osteoblasts grown from the calvaria in the collagen-gel culture were recovered with collagenase and stored at 80°C until use. Bone marrow cells obtained from tibiae of each mouse (5- to 8-wk-old adult mice) were suspended in
MEM supplemented with 10% FBS in 60-mm diameter dishes for 16 h in the presence of M-CSF (100 ng/ml). Then, nonadherent cells were harvested as hemopoietic cells of osteoclast progenitors (33, 36). The hemopoietic cells (8 x 104 cells/well) were cocultured with osteoblasts (8 x 103 cells/well) for 7 days in a 96-well plate with 0.2 ml of
MEM containing 10% FBS in the presence of test chemicals (37). In some experiments, bone marrow cells (8 x 104 cells/well) prepared from ddY mice were cultured in the presence of RANKL (10100 ng/ml) and M-CSF (100 ng/ml) with or without MDP (10 µg/ml) for 5 days in a 96-well plate with 0.2 ml of
MEM containing 10% FBS in the presence of test chemicals. All cultures were incubated in quadruplicate, and cells were replenished on day 3 with fresh medium. Adherent cells were then fixed with 10% formaldehyde in PBS, treated with ethanol-acetone (50:50), and stained for tartrate-resistant acid phosphatase (TRAP, a marker enzyme of osteoclasts), as described previously (37). TRAP-positive cells appeared as red cells. TRAP-positive multinucleated cells containing more than three nuclei were counted as osteoclasts. The results obtained from one experiment typical of at least three independent experiments were expressed as the means ± SD of three cultures. The significance of the differences was determined using Students t test.
PCR amplification of reverse-transcribed mRNA
For semiquantitative RT-PCR analysis, osteoblasts prepared from the ddY, MyD88/, and TLR4/ mice were cultured in
MEM containing 10% FBS in the presence of test chemicals on 60-mm-diameter dishes. After cells were cultured for 3 or 24 h, total cellular RNA was extracted from osteoblasts using TRIzol solution (Invitrogen Life Technologies). First-strand cDNA was synthesized from total RNA with random primers and subjected to PCR amplification with EX Taq polymerase (Takara Biochemicals) using specific PCR primers: mouse RANKL, 5'-CGCTCTGTTCCTGTACTTTCGAGCG-3' (forward, nucleotides 195219) and 5'-TCGTGCTCCCTCCTTTCATCAGGTT-3' (reverse, nucleotides 757781); mouse OPG, 5'-TGGAGATCGAATTCTGCTTG-3' (forward, nucleotides 575595) and 5'-TCAAGTGCTTGAGGG CATAC-3' (reverse, nucleotides 12751295); mouse Nod2, 5'-AACCAGAGACCTGCAGAGTCA-3' (forward, nucleotides 381401) and 5'-TATCCTCCAGGCAAAGATTCT-3' (reverse, nucleotides 722743); mouse GAPDH, 5'-ACCACAGTCCATGCCATCAC-3' (forward, nucleotides 566585) and 5'-TCCACCACCCTGTTGCTGTA-3' (reverse, nucleotides 998-1017). The PCR products were separated by electrophoresis on 2% agarose gels and visualized by ethidium bromide staining with UV light illumination. The numbers of PCR cycles were: 28 for RANKL and OPG, 34 for Nod2 and 20 for GAPDH. The sizes of the PCR products for mouse RANKL, OPG, Nod2, and GAPDH were 587, 721, 363, and 452 bp, respectively.
Measurements of RANKL and OPG in osteoblast cultures
Osteoblasts derived from ddY mice were cultured in
MEM containing 10% FBS for 3 days to confluency, and further incubated in the presence of test chemicals for 3 days. The culture media were then collected for measurement of OPG secretion by osteoblasts. Osteoblasts were lysed in lysis buffer containing 50 mM Tris-HCl (pH 7.2) with 0.1% Triton X-100, 0.1 mM PMSF, and protease inhibitor mixture (Sigma-Aldrich), and centrifuged at 14,000 x g for 10 min to remove insoluble materials. Total protein content was measured using a DC-Bio-Rad Protein Assay kit with BSA as standard. Amounts of RANKL in the cell lysate and OPG in the culture medium were measured using the respective ELISA kits (R&D Systems) as described previously (38).
Western blot analysis
Confluent osteoblasts derived from ddY mice were further incubated with or without test chemicals for 30 min and then washed twice with PBS and lysed in 0.1% Nonidet P-40 lysis buffer containing 20 mM Tris (pH 7.5), 50 mM
-glycerophosphate, 150 mM NaCl, 1 mM EDTA, 25 mM NaF, 1 mM sodium orthovanadate, and 1x protease inhibitor mixture (Sigma-Aldrich). Whole cell extracts were electrophoresed on 10% SDS-polyacrylamide gels and transferred onto nitrocellulose membranes (Millipore). After blocking with 5% skim milk in TBS containing 0.1% Tween 20 (TBST), anti-phospho-ERK1/2 Ab (1/1000), anti-ERK Ab (1/1000), anti-I
B Ab (1/700), or anti-
-actin Ab (1/2000) was added to TBST containing 5% skim milk and the bound Abs were visualized by ECL (Amersham) followed by exposure to x-ray film.
RNA interference analysis
To repress Nod2 expression, small interference RNA (siRNA) for Nod2 was expressed in primary osteoblasts using a lentiviral vector system (Invitrogen Life Technologies). Briefly, the short hairpin DNA oligos (Nod2 no. 1: CACCGGACCTCTTTGATACCCATGGCGAACCATGGGTATCAAAGAGGTCC; Nod2 no. 2: CACCGGTTGACTCTGATGATATTTCCGAAGAAATATCATCAGAGTCAACC) were synthesized and cloned into a pENTR/U6 vector. U6-promotor-driven Nod2-siRNA was recloned into the lentiviral vector pLenti/BLOCK-iT-DEST. These cloned constructs were cotransfected with virus packaging vectors into human embryonic kidney 293 cells to produce virus. After transfection of the cells for 2 days, supernatants of cultures were harvested and used for additional experiments. Primary osteoblasts were infected with the supernatants containing appropriate amounts of the siRNA-expressing virus 1 day before the stimulation with LPS (100 ng/ml) and MDP (10 µg/ml). After cells were cultured for 3 days, total RNA was extracted as described above.
| Results |
|---|
|
|
|---|
A fixed concentration (10 µg/ml) of MDP was used throughout the experiments, because this concentration of MDP stably enhanced the secretion of an inflammatory cytokine (IL-8) in human monocytic THP-1 and U937 cells treated with LPS (20). We first examined the effect of MDP on osteoclast formation in the mouse coculture system in the presence or absence of LPS or IL-1
(Fig. 1, A and B). LPS (100 ng/ml) and IL-1
(1 ng/ml) stimulated osteoclast formation in the cocultures. MDP (10 µg/ml) alone failed to induce osteoclast formation, but markedly enhanced osteoclast formation induced by LPS or IL-1
in the cocultures (Fig. 1, A and B). Treatment of cocultures with 1
,25(OH)2D3 or PGE2 stimulated osteoclast formation, but MDP showed no effect on 1
,25(OH)2D3- or PGE2-induced osteoclast formation (Fig. 1B).
|
Effects of MDP on RANKL and OPG expression in osteoblasts
We recently showed that LPS stimulated osteoclast formation in the cocultures through two parallel events: enhancement of RANKL expression and suppression of OPG expression in osteoblasts (32). The effects of MDP on RANKL and OPGmRNA expression were examined in primary osteoblasts using an RT-PCR technique. Treatment of osteoblasts with LPS or 1
,25(OH)2D3 for 24 h stimulated RANKL mRNA expression (Fig. 2A). Primary osteoblasts constitutively expressed OPG mRNA. The expression of OPG mRNA in osteoblasts was suppressed by LPS or 1
,25(OH)2D3. MDP alone showed little effect on the expression of RANKL and OPG mRNAs in osteoblasts. MDP stimulated the LPS-induced expression of RANKL mRNA but not the LPS-induced suppression of OPG mRNA expression in osteoblasts (Fig. 2A). In contrast, MDP failed to modify 1
,25(OH)2D3-induced changes in RANKL and OPG mRNA expression in osteoblasts (Fig. 2A). These results were confirmed by ELISA measurements of RANKL and OPG contents in the cultures of osteoblasts (Fig. 2B). Osteoblasts constitutively secreted OPG into the culture medium, and the secretion was decreased by treatment with LPS or 1
,25(OH)2D3. The amount of RANKL in osteoblast cell lysates was very low in the control, but was markedly increased in response to LPS or 1
,25(OH)2D3. MDP alone showed no effect on the basal secretion of OPG or RANKL in osteoclasts in the control culture. Treatment of osteoblasts with MDP augmented the increase in RANKL content in osteoblasts treated with LPS (Fig. 2B). MDP had little effect on OPG production even in osteoblasts treated with LPS. MDP had no effect on 1
,25(OH)2D3-induced changes of RANKL content or OPG secretion in osteoblasts (Fig. 2B).
|
,25(OH)2D3 did not induce the phosphorylation of ERK1/2 in osteoblasts. MDP up-regulated the LPS-induced phosphorylation of ERK1/2 by 2.2-fold (Fig. 2C). These results suggest that MDP enhanced LPS-induced osteoclast formation through the up-regulation of ERK phosphorylation followed by RANKL expression in osteoblasts.
Effects of MDP on osteoclast formation induced by TNF-
We next examined the effect of MDP on osteoclast formation induced by TNF-
(Fig. 3). Treatment of the cocultures with TNF-
stimulated osteoclast formation (Fig. 3, A and B). Addition of MDP to the cocultures treated with TNF-
synergistically enhanced TNF-
-stimulated osteoclast formation (Fig. 3A). It was reported that TNF-
together with M-CSF directly stimulated the differentiation of hemopoietic cell-derived osteoclast progenitors into osteoclasts even in the absence of RANKL (27, 28). Osteoclasts were formed in the cultures of hemopoietic cells treated with TNF-
and M-CSF (Fig. 3B). MDP did not enhance TNF-
-induced osteoclast formation in hemopoietic cell cultures (Fig. 3B). TNF-
stimulated RANKL expression in osteoblasts, and MDP enhanced the TNF-
-induced RANKL expression in osteoblasts (Fig. 3C). These results confirmed that the target cells of MDP in the enhancement of osteoclast formation in the cocultures were osteoblasts, not osteoclast progenitors.
|
TLR2 has been shown to recognize peptidoglycan, which contains MDP as an active component (40). To determine whether the MDP-induced effect on osteoclast formation is mediated by TLR4 or TLR2, we examined the effects of MDP on osteoclast formation in cocultures of osteoblasts and hemopoietic cells prepared from C3H/HeJ mice and TIRAP/ mice (Fig. 4). LPS failed to induce osteoclast formation even in the presence MDP in the cocultures prepared from C3H/HeJ mice (Fig. 4A). In contrast, MDP enhanced the osteoclast formation induced by IL-1
in the cocultures. These results suggest that MDP enhanced the osteoclast formation induced by LPS and IL-1 in a TLR4-independent manner. TIRAP has been shown to be involved in TLR2-mediated signaling and in TLR4-mediated MyD88-independent signaling (14). Next, we examined the effect of MDP on TNF-
-induced osteoclast formation in cocultures prepared from TIRAP/ mice. MDP significantly enhanced the osteoclast formation induced by TNF-
in the TIRAP-deficient cocultures (Fig. 4B). TNF-
-induced RANKL mRNA expression was up-regulated by MDP in osteoblasts prepared from TIRAP/ mice (Fig. 4C). These results suggest that MDP-induced up-regulation of RANKL expression in osteoblasts was mediated by neither TLR4 nor TLR2.
|
Nod2 has been proposed to be an intracellular sensor of MDP (21, 23). Therefore we examined the expression of Nod2 mRNA in primary osteoblasts with or without treatment with osteotropic factors (Fig. 5). Nod2 mRNA expression was undetectable in normal osteoblasts prepared from ddY mice (Fig. 5A). Nod2 mRNA expression in osteoblasts was strongly increased by treatment with LPS for 3 h (Fig. 5A). Neither 1
,25(OH)2D3 nor MDP induced Nod2 mRNA expression in osteoblasts. The promoter region of the Nod2 gene has been shown to possess an NF-
B binding site (22). LPS stimulated degradation of I
B in normal osteoblasts, but MDP and 1
,25(OH)2D3 did not (Fig. 5A). These results suggest that NF-
B activation induced by LPS was involved in Nod2 expression in osteoblasts.
|
but not LPS (Fig. 5B). LPS failed to induce Nod2 mRNA expression in osteoblasts derived from MyD88/ mice (Fig. 5C). In contrast, TNF-
stimulated Nod2 mRNA expression in MyD88-deficient osteoblasts. These results suggest that LPS, IL-1, and TNF-
stimulated Nod2 mRNA expression in osteoblasts through their respective signaling pathways. Role of Nod2 in MDP-induced up-regulation of RANKL expression in osteoblasts
To repress Nod2 expression, primary osteoblasts were transfected with lentiviral vectors carrying two different siRNAs for Nod2 (Nod2 no. 1 or Nod2 no. 2) or siRNA for LacZ as the control (Fig. 6). The induction of Nod2 mRNA expression by LPS was markedly suppressed by the expression of either Nod2 no. 1 or Nod2 no. 2 siRNA but not LacZ siRNA (Fig. 6A). The MDP-induced up-regulation of RANKL expression in osteoblasts was also inhibited by both Nod2 siRNAs but not LacZ siRNA (Fig. 6B). Blocking the Nod2 expression by siRNAs had no effect on 1
,25(OH)2D3-induced RANKL expression in osteoblasts (data not shown).
|
We previously reported that purified osteoclasts spontaneously died due to apoptosis within 48 h, and several osteotropic factors, such as LPS, IL-1, and RANKL, promoted the survival of osteoclasts (8). LPS and RANKL supported the survival of purified osteoclasts, and MDP showed no stimulatory effect on the survival of osteoclasts supported by of LPS and RANKL at two different concentrations (10 ng/ml, 100 ng/ml) (Fig. 7, A and B). Unlike osteoblasts, osteoclasts constitutively expressed Nod2 mRNA. Treatment of osteoclasts with LPS, MDP, or RANKL did not enhance Nod2 mRNA expression (Fig. 7C).
|
| Discussion |
|---|
|
|
|---|
but not 1
,25(OH)2D3 or PGE2 (Fig. 1, A and B). In contrast, osteoclast formation induced by RANKL and M-CSF in osteoclast progenitor cultures was not enhanced by MDP (Fig. 1C). RANKL expression induced by LPS or IL-1
in osteoblasts was up-regulated by the addition of MDP (Fig. 2). Similarly, MDP enhanced TNF-
-induced osteoclast formation in the cocultures and RANKL expression in osteoblasts, but not osteoclast formation from hemopoietic cells supported by TNF-
and M-CSF (Fig. 3). The MDP-induced up-regulation of osteoclast formation was observed in cocultures prepared from C3H/HeJ mice and TIRAP/ mice (Fig. 4). RANKL mRNA expression was also enhanced by MDP in TIRAP-deficient osteoblasts (Fig. 4C). These results suggest that the target cells of MDP for the enhancement of osteoclast formation in the cocultures are osteoblasts, not osteoclast progenitors. The stimulatory effect of MDP on RANKL expression in osteoblasts appeared to be mediated by neither TLR2- nor TLR4-mediated signals.
Recent studies have established that Nod2 is an intracellular protein that recognizes MDP and transmits signals in response to MDP (21, 23). Monocytes were shown to constitutively express Nod2 in the absence of all stimuli (22). Primary osteoblasts, however, did not express a detectable level of Nod2 mRNA, but expressed high levels of it in response to LPS, IL-1
, or TNF-
but not 1
,25(OH)2D3 (Fig. 5). The induction of Nod2 mRNA expression by LPS or IL-1
in osteoblasts was MyD88 dependent, but that by TNF-
was not (Fig. 5). These results suggest that Nod2 expression is regulated by both MyD88-dependent and -independent signals. The promoter of Nod2 has been shown to possess an NF-
B binding site (22). LPS but not 1
,25(OH)2D3 induced the degradation of I
B in osteoblasts, suggesting that the activation of NF-
B stimulates Nod2 expression in osteoblasts (Fig. 5A). MDP augmented the induction of RANKL mRNA expression in osteoblasts by LPS or TNF-
but not 1
,25(OH)2D3 (Figs. 2A, 3C, and 4C). The depletion of intracellular Nod2 by siRNAs blocked the MDP-induced up-regulation of RANKL mRNA expression in osteoblasts (Fig. 6). These results suggest that Nod2 expression in osteoblasts is required for the MDP-induced up-regulation of RANKL expression.
Receptor-interacting protein 2 (Rip2, also known as RICK, CARDIAK, CCK, and Ripk2), a serine/threonine kinase, has been proposed to be a downstream signaling molecule of Nod2 (42, 43, 44). Both Nod2 knockout mice and Rip2 knockout mice are significantly protected in endotoxin challenge experiments (45). Rip2 mRNA expression is up-regulated by LPS in murine macrophages (43). We confirmed that osteoblasts expressed Rip2 mRNA in response to LPS, IL-1
, and TNF-
(data not shown). These results suggest that LPS and proinflammatory cytokines increase susceptibility to MDP through up-regulation of both Nod2 and Rip2. MDP enhanced phosphorylation of ERK1/2 and RANKL expression in osteoblasts treated with by LPS (Fig. 2C). Rip2 has been shown to selectively phosphorylate ERK1/2 (46). These results suggest that MDP-Nod2 signals cross-talk with ERK1/2 through Rip2 activation to enhance RANKL expression in osteoblasts.
Purified osteoclasts undergo rapid apoptosis. We showed that osteotropic factors such as LPS, IL-1
, and RANKL enhanced the survival of osteoclasts and induced their bone-resorbing activity (8, 29, 30). Like macrophages, osteoclasts constitutively expressed Nod2 mRNA, but MDP failed to enhance the survival of osteoclasts supported by LPS and RANKL (Fig. 7). LPS and RANKL did not up-regulate Nod2 mRNA expression in osteoclasts, suggesting that up-regulation of Nod2 expression may be required for MDP-induced enhancement of the survival of osteoclasts supported by RANKL and LPS. Alternatively, the Nod2-mediated signal induced by MDP may be blocked in osteoclasts. Further studies will be necessary to elucidate the precise role of MDP-Nod2 signals in osteoclast function. It is important to point out that MDP does not directly stimulate osteoclast function, but indirectly does so though the enhancement of RANKL expression by osteoblasts in the presence of LPS and inflammatory cytokines.
In conclusion, MDP enhanced osteoclast formation induced by LPS, IL-1
, or TNF-
in cocultures via stimulation of RANKL expression in osteoblasts. LPS and IL-1
stimulated Nod2 mRNA expression in osteoblasts via MyD88 signaling, whereas TNF-
induced Nod2 mRNA expression in osteoblasts via MyD88-independent signaling (Fig. 8). The reduction of Nod2 expression by siRNAs blocked MDP-induced up-regulation of RANKL mRNA in osteoblasts. These results suggest that Nod2 acts as an intracellular receptor of MDP to induce RANKL expression in osteoblasts (Fig. 8). MDP has been shown to synergistically enhance the production of proinflammatory cytokines by monocytic cells in the presence of LPS. These results suggest that MDP might play a key role in osteoclastic bone resorption in inflammatory diseases such as periodontitis.
|
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported in part by Grants-in-Aid 80360220 and 90340059, and the Aichi Gakuin University High-Tech Research Center Project from the Ministry of Education, Culture, Sports, Science, and Technology of Japan. ![]()
2 Address correspondence and reprint requests to Dr. Nobuyuki Udagawa, Department of Biochemistry, Matsumoto Dental University, 1780 Gobara, Hiro-oka, Shiojiri, Nagano 399-0781, Japan. E-mail address: udagawa{at}po.mdu.ac.jp ![]()
3 Abbreviations used in this paper: RANKL, receptor activator of NF-
B ligand; 1
,25(OH)2D3, 1
,25-dihydroxyvitamin D3; OPG, osteoprotegerin; TIR, Toll/IL-1R; TIRAP, TIR domain-containing adapter protein; MDP, muramyl dipeptide; Nod2, nucleotide-binding oligomerization domain 2; TRAP, tartrate-resistant acid phosphatase; siRNA, small interference RNA; Rip2, receptor-interacting protein 2. ![]()
Received for publication February 10, 2005. Accepted for publication May 26, 2005.
| References |
|---|
|
|
|---|
B activation. J. Biol. Chem. 277: 41701-41705.
stimulates osteoclast differentiation by a mechanism independent of the ODF/RANKL-RANK interaction. J. Exp. Med. 191: 275-286.
induces differentiation of and bone resorption by osteoclasts. J. Biol. Chem. 275: 4858-4864.
. J. Exp. Med. 200: 601-611.
B ligand activates nuclear factor-
B in osteoclast precursors. Endocrinology 142: 1290-1295.
B. J. Biol. Chem. 276: 4812-4818.Related articles in The JI:
This article has been cited by other articles:
![]() |
Y. Hacchou, T. Uematsu, O. Ueda, Y. Usui, S. Uematsu, M. Takahashi, T. Uchihashi, Y. Kawazoe, T. Shiba, S. Kurihara, et al. Inorganic Polyphosphate: a Possible Stimulant of Bone Formation Journal of Dental Research, September 1, 2007; 86(9): 893 - 897. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. Lebeis, B. Bommarius, C. A. Parkos, M. A. Sherman, and D. Kalman TLR Signaling Mediated by MyD88 Is Required for a Protective Innate Immune Response by Neutrophils to Citrobacter rodentium J. Immunol., July 1, 2007; 179(1): 566 - 577. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. S. Kornbluth and G. W. Stone Immunostimulatory combinations: designing the next generation of vaccine adjuvants J. Leukoc. Biol., November 1, 2006; 80(5): 1084 - 1102. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |