The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Related articles in The JI
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yang, S.
Right arrow Articles by Furusawa, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yang, S.
Right arrow Articles by Furusawa, K.
The Journal of Immunology, 2005, 175: 1956-1964.
Copyright © 2005 by The American Association of Immunologists

Muramyl Dipeptide Enhances Osteoclast Formation Induced by Lipopolysaccharide, IL-1{alpha}, and TNF-{alpha} through Nucleotide-Binding Oligomerization Domain 2-Mediated Signaling in Osteoblasts1

Shuhua Yang*, Naoyuki Takahashi{dagger}, Teruhito Yamashita{ddagger}, Nobuaki Sato§, Masahiro Takahashi*, Makio Mogi, Takashi Uematsu*, Yasuhiro Kobayashi{dagger}, Yuko Nakamichi{dagger}, Kiyoshi Takeda||, Shizuo Akira#, Haruhiko Takada**, Nobuyuki Udagawa2,{ddagger} and Kiyofumi Furusawa*

* Department of Oral and Maxillofacial Surgery, {dagger} Institute for Oral Science, and {ddagger} Department of Biochemistry, Matsumoto Dental University, Nagano, Japan; § Department of Periodontology and Department of Pharmacology, School of Dentistry, Aichi Gakuin University, Nagoya, Japan; || Medical Institute of Bioregulation, Kyushu University, Fukuoka, Japan; # Research Institute for Microbial Disease, Osaka University, Suita, Japan; and** Department of Microbiology and Immunology, Tohoku University School of Dentistry, Sendai, Japan


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Muramyl dipeptide (MDP) is the minimal essential structural unit responsible for the immunoadjuvant activity of peptidoglycan. As well as bone-resorbing factors such as 1{alpha},25-dihydroxyvitamin D3 (1{alpha},25(OH)2D3) and PGE2, LPS and IL-1{alpha} stimulate osteoclast formation in mouse cocultures of primary osteoblasts and hemopoietic cells. MDP alone could not induce osteoclast formation in the coculture, but enhanced osteoclast formation induced by LPS, IL-1{alpha}, or TNF-{alpha} but not 1{alpha},25(OH)2D3 or PGE2. MDP failed to enhance osteoclast formation from osteoclast progenitors induced by receptor activator of NF-{kappa}B ligand (RANKL) or TNF-{alpha}. MDP up-regulated RANKL expression in osteoblasts treated with LPS or TNF-{alpha} but not 1{alpha},25(OH)2D3. Osteoblasts expressed mRNA of nucleotide-binding oligomerization domain 2 (Nod2), an intracellular sensor of MDP, in response to LPS, IL-1{alpha}, or TNF-{alpha} but not 1{alpha},25(OH)2D3. Induction of Nod2 mRNA expression by LPS but not by TNF-{alpha} in osteoblasts was dependent on TLR4 and MyD88. MDP also enhanced TNF-{alpha}-induced osteoclast formation in cocultures prepared from Toll/IL-1R domain-containing adapter protein (TIRAP)-deficient mice through the up-regulation of RANKL mRNA expression in osteoblasts, suggesting that TLR2 is not involved in the MDP-induced osteoclast formation. The depletion of intracellular Nod2 by small interfering RNA blocked MDP-induced up-regulation of RANKL mRNA in osteoblasts. LPS and RANKL stimulated the survival of osteoclasts, and this effect was not enhanced by MDP. These results suggest that MDP synergistically enhances osteoclast formation induced by LPS, IL-1{alpha}, and TNF-{alpha} through RANKL expression in osteoblasts, and that Nod2-mediated signals are involved in the MDP-induced RANKL expression in osteoblasts.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Osteoclasts, the multinucleated cells that resorb bone, originate from monocyte-macrophage lineage cells. Osteoblasts (or bone marrow stromal cells) are involved in osteoclastogenesis (1, 2). M-CSF produced by osteoblasts is an essential factor for osteoclast formation (3). Receptor activator of NF-{kappa}B ligand (RANKL),3 another cytokine essential for osteoclastogenesis, is expressed by osteoblasts as a membrane-associated cytokine (4, 5). Osteoclast precursors express RANK (a receptor of RANKL), recognize RANKL expressed by osteoblasts through cell-cell interaction, and differentiate into osteoclasts in the presence of M-CSF (6). M-CSF is constitutively expressed by osteoblasts, while RANKL expression is tightly regulated by bone-resorbing hormones and cytokines such as 1{alpha},25-dihydroxyvitamin D3 (1{alpha},25(OH)2D3), parathyroid hormone, PGE2, IL-1{alpha}, and IL-11 (7). These factors stimulate the expression of RANKL in osteoblasts. Osteoprotegerin (OPG), produced mainly by osteoblasts, is a soluble decoy receptor for RANKL. OPG blocks osteoclastogenesis by inhibiting the RANKL-RANK interaction. Mature osteoclasts also express RANK, and RANKL supports the survival and stimulates the bone-resorbing activity of osteoclasts (8).

TLR family members have been shown to be important in the activation of cells by a variety of microbial ligands (9). LPS, an amphiphilic molecule in the outer membrane of Gram-negative bacteria, is involved in bone resorption in inflammatory diseases (10). TLR4 is a signal-transducing receptor for LPS. It is well known that C3H/HeJ mice, which show extremely low responsiveness to LPS, have a point mutation in the intracellular domain of TLR4 (11). The cytoplasmic signaling cascade of TLR4 is quite similar to that of the IL-1R, because both receptors possess intracytoplasmic Toll/IL-1R (TIR) domains (12). Accumulating evidence has demonstrated that TIR domain-containing adaptors, such as MyD88 and TIR domain-containing adapter protein (TIRAP), modulate IL-1R and TLR signaling pathways (9). MyD88 is essential for the induction of inflammatory cytokines triggered by IL-1R and all TLRs (13). In contrast, TIRAP is specifically involved in the TLR2 and TLR4-mediated signaling (14). TLR2 has been shown to recognize several classes of pathogen-associated molecular patterns, including peptidoglycan (15).

Muramyl dipeptide (MDP), the minimal essential structural unit responsible for the immunoadjuvant activity of peptidoglycans, is distributed ubiquitously in cell walls of both Gram-negative and -positive bacteria (16). MDP has been shown to exert diverse biological effects on immunocompetent cells (17). We have shown that injection of MDP into mice resulted in endotoxin hypersensitivity: enhanced production of TNF-{alpha} (18) and lethal shock (19) upon challenge injection of LPS. We also showed that MDP synergistically enhanced LPS-induced proinflammatory cytokine production in human monocytic cells (20). Recently, it was proposed that nucleotide-binding oligomerization domain 2 (Nod2), a member of the Apaf1/Nod protein family, is an intracellular sensor of MDP (21, 22, 23). Nod2 consists of two N-terminal caspase-recruitment domains, a centrally located nucleotide-binding domain and C-terminal leucine-rich repeats, and acts as a signal-transducing adaptor. Nod2 expression is enhanced by proinflammatory cytokines and LPS (22). Recent studies have established that a frameshift mutation of Nod2, which results in a deficiency in MDP-mediated NF-{kappa}B activation, is involved in susceptibility to Crohn’s disease, a chronic inflammatory disorder of the intestinal tract (23). Thus, MDP plays roles in many aspects of inflammatory responses.

Many types of cells, including macrophages, lymphocytes, gingival fibroblasts, and osteoblasts, express TLR4, and produce PGE2 and proinflammatory cytokines such as TNF-{alpha} and IL-1 in response to LPS (24, 25, 26). LPS, TNF-{alpha}, and IL-1 also stimulate the differentiation and function of osteoclasts directly or indirectly. We and others have reported that TNF-{alpha} together with M-CSF directly stimulates the differentiation of osteoclast progenitors into osteoclasts even in the absence of RANKL (27, 28). Osteoclasts express both TLR4 and IL-1R. LPS and IL-1{alpha} directly stimulate the survival, fusion, and bone-resorbing activity of osteoclasts through their respective receptors (29, 30). In addition, LPS and IL-1{alpha} stimulate RANKL expression in osteoblasts (31, 32). Using MyD88-deficient mice, we have shown that MyD88-mediated signaling is essential in RANKL expression in osteoblasts induced by LPS and IL-1{alpha} but not 1{alpha},25(OH)2D3 (33).

In this study, we explored effects of MDP on osteoclast differentiation in vitro. MDP alone could not induce osteoclast formation in mouse cocultures of primary osteoblasts and hemopoietic cells, but markedly enhanced osteoclast formation induced by LPS, IL-1{alpha}, or TNF-{alpha} but not 1{alpha},25(OH)2D3 or PGE2. MDP up-regulated RANKL expression in osteoblasts treated with LPS or TNF-{alpha} but not with 1{alpha},25(OH)2D3. The MDP-induced up-regulation of RANKL expression in osteoblasts was shown to be mediated by Nod2 but not TLR2 or TLR4.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Animals and drugs

Five- to 8-wk-old male ddY mice and newborn ddY mice were obtained from the Shizuoka Laboratories Animal Center. C3H/HeJ mice, which have a point mutation in the TLR4 gene, were obtained from Japan Clea. MyD88-deficient (MyD88–/–), TLR4-deficient (TLR4–/–), and TIRAP-deficient (TIRAP–/–) mice were generated and maintained as described previously (13, 14, 34). MyD88–/– and TLR4–/– mice were derived from the genetic background of C57BL/6J. TIRAP–/– mice were derived from a 129 and C57BL/6J mixed background. After heterozygous (+/–) mating, homozygous (–/–), heterozygous (+/–), and wild-type (WT) (+/+) mice were identified by PCR analysis of tail DNA from each mouse, as described previously. All procedures for animal care were approved in the Animal Management Committee of Matsumoto Dental University. Purified LPS (Escherichia coli 055:B5) and chemically synthesized MDP (N-acetylmuramyl-L-alany-D-isoglutamine) were purchased from Sigma-Aldrich. Mouse TNF-{alpha} and IL-1{alpha} were obtained form Genzyme. 1{alpha},25(OH)2D3 and PGE2 were purchased from Wako. Recombinant human M-CSF (Leukoprol) was obtained from Kyowa Hakko. Recombinant human soluble RANKL was purchased from PeproTech. Rabbit anti-mouse phospho-ERK1/2 (Thr202/Tyr204) Ab, rabbit anti-mouse ERK1/2 Ab, and rabbit anti-mouse I{kappa}B{alpha} Ab were purchased from Cell Signaling Technology. Specific PCR primers for mouse RANKL, OPG, Nod2, and GAPDH were synthesized by Invitrogen Life Technologies. Other chemicals and reagents used were of analytical grade.

Osteoclast differentiation assay

To isolate primary osteoblasts from either ddY, C3H/HeJ, MyD88–/–, TLR4–/–, or TIRAP–/– mice, calvaria from 2-day-old mice were cut into small pieces and cultured for 5 days in type I collagen gel (Cell matrix type-IA; Nitta Gelatin) prepared in {alpha}MEM (Sigma-Aldrich) containing 10% FBS (JRH Biosciences) (35). Osteoblasts grown from the calvaria in the collagen-gel culture were recovered with collagenase and stored at –80°C until use. Bone marrow cells obtained from tibiae of each mouse (5- to 8-wk-old adult mice) were suspended in {alpha}MEM supplemented with 10% FBS in 60-mm diameter dishes for 16 h in the presence of M-CSF (100 ng/ml). Then, nonadherent cells were harvested as hemopoietic cells of osteoclast progenitors (33, 36). The hemopoietic cells (8 x 104 cells/well) were cocultured with osteoblasts (8 x 103 cells/well) for 7 days in a 96-well plate with 0.2 ml of {alpha}MEM containing 10% FBS in the presence of test chemicals (37). In some experiments, bone marrow cells (8 x 104 cells/well) prepared from ddY mice were cultured in the presence of RANKL (10–100 ng/ml) and M-CSF (100 ng/ml) with or without MDP (10 µg/ml) for 5 days in a 96-well plate with 0.2 ml of {alpha}MEM containing 10% FBS in the presence of test chemicals. All cultures were incubated in quadruplicate, and cells were replenished on day 3 with fresh medium. Adherent cells were then fixed with 10% formaldehyde in PBS, treated with ethanol-acetone (50:50), and stained for tartrate-resistant acid phosphatase (TRAP, a marker enzyme of osteoclasts), as described previously (37). TRAP-positive cells appeared as red cells. TRAP-positive multinucleated cells containing more than three nuclei were counted as osteoclasts. The results obtained from one experiment typical of at least three independent experiments were expressed as the means ± SD of three cultures. The significance of the differences was determined using Student’s t test.

PCR amplification of reverse-transcribed mRNA

For semiquantitative RT-PCR analysis, osteoblasts prepared from the ddY, MyD88–/–, and TLR4–/– mice were cultured in {alpha}MEM containing 10% FBS in the presence of test chemicals on 60-mm-diameter dishes. After cells were cultured for 3 or 24 h, total cellular RNA was extracted from osteoblasts using TRIzol solution (Invitrogen Life Technologies). First-strand cDNA was synthesized from total RNA with random primers and subjected to PCR amplification with EX Taq polymerase (Takara Biochemicals) using specific PCR primers: mouse RANKL, 5'-CGCTCTGTTCCTGTACTTTCGAGCG-3' (forward, nucleotides 195–219) and 5'-TCGTGCTCCCTCCTTTCATCAGGTT-3' (reverse, nucleotides 757–781); mouse OPG, 5'-TGGAGATCGAATTCTGCTTG-3' (forward, nucleotides 575–595) and 5'-TCAAGTGCTTGAGGG CATAC-3' (reverse, nucleotides 1275–1295); mouse Nod2, 5'-AACCAGAGACCTGCAGAGTCA-3' (forward, nucleotides 381–401) and 5'-TATCCTCCAGGCAAAGATTCT-3' (reverse, nucleotides 722–743); mouse GAPDH, 5'-ACCACAGTCCATGCCATCAC-3' (forward, nucleotides 566–585) and 5'-TCCACCACCCTGTTGCTGTA-3' (reverse, nucleotides 998-1017). The PCR products were separated by electrophoresis on 2% agarose gels and visualized by ethidium bromide staining with UV light illumination. The numbers of PCR cycles were: 28 for RANKL and OPG, 34 for Nod2 and 20 for GAPDH. The sizes of the PCR products for mouse RANKL, OPG, Nod2, and GAPDH were 587, 721, 363, and 452 bp, respectively.

Measurements of RANKL and OPG in osteoblast cultures

Osteoblasts derived from ddY mice were cultured in {alpha}MEM containing 10% FBS for 3 days to confluency, and further incubated in the presence of test chemicals for 3 days. The culture media were then collected for measurement of OPG secretion by osteoblasts. Osteoblasts were lysed in lysis buffer containing 50 mM Tris-HCl (pH 7.2) with 0.1% Triton X-100, 0.1 mM PMSF, and protease inhibitor mixture (Sigma-Aldrich), and centrifuged at 14,000 x g for 10 min to remove insoluble materials. Total protein content was measured using a DC-Bio-Rad Protein Assay kit with BSA as standard. Amounts of RANKL in the cell lysate and OPG in the culture medium were measured using the respective ELISA kits (R&D Systems) as described previously (38).

Western blot analysis

Confluent osteoblasts derived from ddY mice were further incubated with or without test chemicals for 30 min and then washed twice with PBS and lysed in 0.1% Nonidet P-40 lysis buffer containing 20 mM Tris (pH 7.5), 50 mM {beta}-glycerophosphate, 150 mM NaCl, 1 mM EDTA, 25 mM NaF, 1 mM sodium orthovanadate, and 1x protease inhibitor mixture (Sigma-Aldrich). Whole cell extracts were electrophoresed on 10% SDS-polyacrylamide gels and transferred onto nitrocellulose membranes (Millipore). After blocking with 5% skim milk in TBS containing 0.1% Tween 20 (TBST), anti-phospho-ERK1/2 Ab (1/1000), anti-ERK Ab (1/1000), anti-I{kappa}B Ab (1/700), or anti-{beta}-actin Ab (1/2000) was added to TBST containing 5% skim milk and the bound Abs were visualized by ECL (Amersham) followed by exposure to x-ray film.

RNA interference analysis

To repress Nod2 expression, small interference RNA (siRNA) for Nod2 was expressed in primary osteoblasts using a lentiviral vector system (Invitrogen Life Technologies). Briefly, the short hairpin DNA oligos (Nod2 no. 1: CACCGGACCTCTTTGATACCCATGGCGAACCATGGGTATCAAAGAGGTCC; Nod2 no. 2: CACCGGTTGACTCTGATGATATTTCCGAAGAAATATCATCAGAGTCAACC) were synthesized and cloned into a pENTR/U6 vector. U6-promotor-driven Nod2-siRNA was recloned into the lentiviral vector pLenti/BLOCK-iT-DEST. These cloned constructs were cotransfected with virus packaging vectors into human embryonic kidney 293 cells to produce virus. After transfection of the cells for 2 days, supernatants of cultures were harvested and used for additional experiments. Primary osteoblasts were infected with the supernatants containing appropriate amounts of the siRNA-expressing virus 1 day before the stimulation with LPS (100 ng/ml) and MDP (10 µg/ml). After cells were cultured for 3 days, total RNA was extracted as described above.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Effects of MDP on osteoclast formation in mouse cocultures and in macrophage cultures

A fixed concentration (10 µg/ml) of MDP was used throughout the experiments, because this concentration of MDP stably enhanced the secretion of an inflammatory cytokine (IL-8) in human monocytic THP-1 and U937 cells treated with LPS (20). We first examined the effect of MDP on osteoclast formation in the mouse coculture system in the presence or absence of LPS or IL-1{alpha} (Fig. 1, A and B). LPS (100 ng/ml) and IL-1{alpha} (1 ng/ml) stimulated osteoclast formation in the cocultures. MDP (10 µg/ml) alone failed to induce osteoclast formation, but markedly enhanced osteoclast formation induced by LPS or IL-1{alpha} in the cocultures (Fig. 1, A and B). Treatment of cocultures with 1{alpha},25(OH)2D3 or PGE2 stimulated osteoclast formation, but MDP showed no effect on 1{alpha},25(OH)2D3- or PGE2-induced osteoclast formation (Fig. 1B).



View larger version (88K):
[in this window]
[in a new window]
 
FIGURE 1. Effects of MDP on osteoclast formation in cocultures of osteoblasts with bone marrow cells, and in cultures of osteoclast progenitors. Bone marrow cells obtained from tibiae of ddY mice were cultured for 16 h in the presence of M-CSF (100 ng/ml). Then, nonadherent cells were harvested as hemopoietic cells. Osteoblasts were prepared from calvaria of newborn ddY mice. A and B, Osteoblasts (8 x 103 cells/well) and hemopoietic cells (8 x 104 cells/well) were cocultured in 96-well plates in the presence or absence of LPS (100 ng/ml), IL-1{alpha} (1 ng/ml), 1{alpha},25(OH)2D3 (1,25D3) (10–8 M) or PGE2 (10–6 M) with or without MDP (10 µg/ml). C and D, Hemopoietic cells (8 x 104 cells/well) were cultured in 96-well plates in the presence or absence of RANKL (0, 10, or 100 ng/ml) and M-CSF (50 ng/ml) with or without MDP (10 µg/ml). After culturing for 5 days, cells were fixed and stained for TRAP (A and C). TRAP-positive cells containing three or more nuclei were counted as osteoclasts (B and D). Values are expressed as the means ± SD of three cultures. Experiments were repeated five times, and similar results were obtained. #, Significantly different from the culture without MDP treatment; p < 0.01.

 
We next examined the effect of MDP on RANKL-induced osteoclast formation from hemopoietic cell-derived osteoclast progenitors (Fig. 1, C and D). Treatment of osteoclast progenitors with RANKL (100 ng/ml) together with M-CSF (50 ng/ml) stimulated osteoclast formation. MDP alone did not stimulate osteoclast formation even in the presence of M-CSF. MDP showed no effect on osteoclast formation induced by RANKL (10 ng/ml, 100 ng/ml) together with M-CSF (50 ng/ml) (Fig. 1, C and D).

Effects of MDP on RANKL and OPG expression in osteoblasts

We recently showed that LPS stimulated osteoclast formation in the cocultures through two parallel events: enhancement of RANKL expression and suppression of OPG expression in osteoblasts (32). The effects of MDP on RANKL and OPGmRNA expression were examined in primary osteoblasts using an RT-PCR technique. Treatment of osteoblasts with LPS or 1{alpha},25(OH)2D3 for 24 h stimulated RANKL mRNA expression (Fig. 2A). Primary osteoblasts constitutively expressed OPG mRNA. The expression of OPG mRNA in osteoblasts was suppressed by LPS or 1{alpha},25(OH)2D3. MDP alone showed little effect on the expression of RANKL and OPG mRNAs in osteoblasts. MDP stimulated the LPS-induced expression of RANKL mRNA but not the LPS-induced suppression of OPG mRNA expression in osteoblasts (Fig. 2A). In contrast, MDP failed to modify 1{alpha},25(OH)2D3-induced changes in RANKL and OPG mRNA expression in osteoblasts (Fig. 2A). These results were confirmed by ELISA measurements of RANKL and OPG contents in the cultures of osteoblasts (Fig. 2B). Osteoblasts constitutively secreted OPG into the culture medium, and the secretion was decreased by treatment with LPS or 1{alpha},25(OH)2D3. The amount of RANKL in osteoblast cell lysates was very low in the control, but was markedly increased in response to LPS or 1{alpha},25(OH)2D3. MDP alone showed no effect on the basal secretion of OPG or RANKL in osteoclasts in the control culture. Treatment of osteoblasts with MDP augmented the increase in RANKL content in osteoblasts treated with LPS (Fig. 2B). MDP had little effect on OPG production even in osteoblasts treated with LPS. MDP had no effect on 1{alpha},25(OH)2D3-induced changes of RANKL content or OPG secretion in osteoblasts (Fig. 2B).



View larger version (30K):
[in this window]
[in a new window]
 
FIGURE 2. Effects of MDP on RANKL and OPG expression in osteoblasts. A, Subconfluent cultures of osteoblasts prepared from ddY mice were further incubated for 24 h in the presence or absence of LPS (100 ng/ml) or 1{alpha},25(OH)2D3 (1,25D3) (10–8 M) with or without MDP (10 µg/ml). Total RNA was extracted from osteoblasts and subjected to RT-PCR analysis of RANKL and OPG mRNAs. Figures below the signals represent the level of the RANKL and OPG mRNA expression relative to GAPDH mRNA expression. B, Confluent cultures of osteoblasts were incubated in the presence or absence of LPS (100 ng/ml) or 1{alpha},25(OH)2D3 (1,25D3) (10–8 M) with or without MDP (10 µg/ml). After culturing for 72 h, the culture medium was collected for the measurement of OPG content, and osteoblasts were lysed in a lysate buffer for measurement of the RANKL content. The contents of RANKL and OPG were measured using the respective ELISA kits. Values are expressed as the mean result of two cultures. C, Confluent cultures of osteoblasts prepared from ddY mice were incubated for 30 min in the presence or absence of LPS (100 ng/ml) or 1{alpha},25(OH)2D3 (1,25D3) (10–8 M) with or without MDP (10 µg/ml). Osteoblasts were then lysed in a cell lysate buffer and subjected to Western blot analysis using anti-phospho-ERK1/2 Ab, anti-ERK Ab, and anti-{beta}-actin Ab. Figures below the signals represent the level of phosphorylated ERK1/2 protein expression relative to ERK1/2 protein expression. Experiments were repeated twice, and similar results were obtained.

 
The induction of RANKL mRNA expression by LPS was shown to be mediated through ERK signals (39). LPS stimulated the phosphorylation of ERK1/2 within 30 min in osteoblasts (Fig. 2C). 1{alpha},25(OH)2D3 did not induce the phosphorylation of ERK1/2 in osteoblasts. MDP up-regulated the LPS-induced phosphorylation of ERK1/2 by 2.2-fold (Fig. 2C). These results suggest that MDP enhanced LPS-induced osteoclast formation through the up-regulation of ERK phosphorylation followed by RANKL expression in osteoblasts.

Effects of MDP on osteoclast formation induced by TNF-{alpha}

We next examined the effect of MDP on osteoclast formation induced by TNF-{alpha} (Fig. 3). Treatment of the cocultures with TNF-{alpha} stimulated osteoclast formation (Fig. 3, A and B). Addition of MDP to the cocultures treated with TNF-{alpha} synergistically enhanced TNF-{alpha}-stimulated osteoclast formation (Fig. 3A). It was reported that TNF-{alpha} together with M-CSF directly stimulated the differentiation of hemopoietic cell-derived osteoclast progenitors into osteoclasts even in the absence of RANKL (27, 28). Osteoclasts were formed in the cultures of hemopoietic cells treated with TNF-{alpha} and M-CSF (Fig. 3B). MDP did not enhance TNF-{alpha}-induced osteoclast formation in hemopoietic cell cultures (Fig. 3B). TNF-{alpha} stimulated RANKL expression in osteoblasts, and MDP enhanced the TNF-{alpha}-induced RANKL expression in osteoblasts (Fig. 3C). These results confirmed that the target cells of MDP in the enhancement of osteoclast formation in the cocultures were osteoblasts, not osteoclast progenitors.



View larger version (16K):
[in this window]
[in a new window]
 
FIGURE 3. Effects of MDP on osteoclast formation induced by TNF-{alpha}. A, Osteoblasts (8 x 103 cells/well) and hemopoietic cells (8 x 104 cells/well) prepared from ddY mice were cocultured in 96-well plates in the presence or absence of TNF-{alpha} (10 ng/ml) with or without MDP (10 µg/ml). B, Hemopoietic cells (8 x 104 cells/well) prepared from ddY mice were cultured in 96-well plates in the presence or absence of TNF-{alpha} (10 ng/ml) and M-CSF (50 ng/ml) with or without MDP (10 µg/ml). After culturing for 5 days, cells were fixed and stained for TRAP. TRAP-positive cells containing three or more nuclei were counted as osteoclasts. Values are expressed as the means ± SD of three cultures. Experiments were repeated five times, and similar results were obtained. C, Subconfluent cultures of osteoblasts prepared from ddY mice were further incubated for 24 h in the presence or absence of TNF-{alpha} (10 ng/ml) with or without MDP (10 µg/ml). Total RNA was extracted from osteoblasts and subjected to RT-PCR analysis of RANKL mRNA. Figures below the signals represent the level of RANKL mRNA expression relative to GAPDH mRNA expression. Experiments were repeated three times, and similar results were obtained. #, Significantly different from the culture without MDP treatment; p < 0.01.

 
Roles of TLR4- and TLR2-mediated signals in MDP-induced osteoclast formation

TLR2 has been shown to recognize peptidoglycan, which contains MDP as an active component (40). To determine whether the MDP-induced effect on osteoclast formation is mediated by TLR4 or TLR2, we examined the effects of MDP on osteoclast formation in cocultures of osteoblasts and hemopoietic cells prepared from C3H/HeJ mice and TIRAP–/– mice (Fig. 4). LPS failed to induce osteoclast formation even in the presence MDP in the cocultures prepared from C3H/HeJ mice (Fig. 4A). In contrast, MDP enhanced the osteoclast formation induced by IL-1{alpha} in the cocultures. These results suggest that MDP enhanced the osteoclast formation induced by LPS and IL-1 in a TLR4-independent manner. TIRAP has been shown to be involved in TLR2-mediated signaling and in TLR4-mediated MyD88-independent signaling (14). Next, we examined the effect of MDP on TNF-{alpha}-induced osteoclast formation in cocultures prepared from TIRAP–/– mice. MDP significantly enhanced the osteoclast formation induced by TNF-{alpha} in the TIRAP-deficient cocultures (Fig. 4B). TNF-{alpha}-induced RANKL mRNA expression was up-regulated by MDP in osteoblasts prepared from TIRAP–/– mice (Fig. 4C). These results suggest that MDP-induced up-regulation of RANKL expression in osteoblasts was mediated by neither TLR4 nor TLR2.



View larger version (15K):
[in this window]
[in a new window]
 
FIGURE 4. Effects of MDP on osteoclast formation in cocultures prepared from C3H/HesJ mice and TIRAP–/–mice. A, Osteoblasts (8 x 103 cells/well) and hemopoietic cells (8 x 104 cells/well) prepared from C3H/HeJ mice were cocultured in the presence or absence of LPS (100 ng/ml) or IL-1{alpha} (1 ng/ml) with or without MDP (10 µg/ml). B, Osteoblasts (8 x 103 cells/well) and hemopoietic cells (8 x 104 cells/well) prepared from TIRAP–/–mice were cocultured in the presence or absence of TNF-{alpha} (100 ng/ml) with or without MDP (10 µg/ml). After culturing for 7 days, cells were fixed and stained for TRAP. TRAP-positive cells containing three or more nuclei were counted as osteoclasts. Values are expressed as the means ± SD of three cultures. Experiments were repeated five times, and similar results were obtained. C, Subconfluent cultures of osteoblasts prepared from TIRAP–/–mice were further incubated for 24 h in the presence or absence of TNF-{alpha} (10 ng/ml) with or without MDP (10 µg/ml). Total RNA was extracted from osteoblasts and subjected to RT-PCR analysis of RANKL mRNA. Figures below the signals represent the level of RANKL mRNA expression relative to GAPDH mRNA expression. Experiments were repeated twice, and similar results were obtained. #, Significantly different from the culture without MDP treatment; p < 0.01.

 
Induction of Nod2 mRNA expression by MyD88-dependent and -independent pathways in osteoblasts

Nod2 has been proposed to be an intracellular sensor of MDP (21, 23). Therefore we examined the expression of Nod2 mRNA in primary osteoblasts with or without treatment with osteotropic factors (Fig. 5). Nod2 mRNA expression was undetectable in normal osteoblasts prepared from ddY mice (Fig. 5A). Nod2 mRNA expression in osteoblasts was strongly increased by treatment with LPS for 3 h (Fig. 5A). Neither 1{alpha},25(OH)2D3 nor MDP induced Nod2 mRNA expression in osteoblasts. The promoter region of the Nod2 gene has been shown to possess an NF-{kappa}B binding site (22). LPS stimulated degradation of I{kappa}B in normal osteoblasts, but MDP and 1{alpha},25(OH)2D3 did not (Fig. 5A). These results suggest that NF-{kappa}B activation induced by LPS was involved in Nod2 expression in osteoblasts.



View larger version (38K):
[in this window]
[in a new window]
 
FIGURE 5. Induction of Nod2 mRNA expression in osteoblasts. A, Confluent cultures of osteoblasts prepared from the ddY normal mice were incubated for 3 h in the presence or absence of MDP (10 µg/ml), LPS (100 ng/ml) or 1{alpha},25(OH)2D3 (1,25D3) (10–8 M). B, Confluent cultures of osteoblasts prepared from TLR4–/– mice were incubated for 3 h in the presence or absence of MDP (10 µg/ml), LPS (100 ng/ml), or IL-1{alpha} (1 ng/ml). C, Confluent cultures of osteoblasts prepared from MyD88–/– mice were incubated for 3 h in the presence or absence of MDP (10 µg/ml), LPS (100 ng/ml), or TNF-{alpha} (10 ng/ml). Total RNA was extracted from osteoblasts and subjected to RT-PCR analysis of Nod2 mRNA.

 
MyD88 is a common adaptor molecule in LPS- and IL-1-induced signaling (13, 41). Nod2 mRNA expression was also examined in osteoblasts obtained from TLR4–/– and MyD88–/– mice. TLR4-deficient osteoblasts expressed Nod2 mRNA in response to IL-1{alpha} but not LPS (Fig. 5B). LPS failed to induce Nod2 mRNA expression in osteoblasts derived from MyD88–/– mice (Fig. 5C). In contrast, TNF-{alpha} stimulated Nod2 mRNA expression in MyD88-deficient osteoblasts. These results suggest that LPS, IL-1, and TNF-{alpha} stimulated Nod2 mRNA expression in osteoblasts through their respective signaling pathways.

Role of Nod2 in MDP-induced up-regulation of RANKL expression in osteoblasts

To repress Nod2 expression, primary osteoblasts were transfected with lentiviral vectors carrying two different siRNAs for Nod2 (Nod2 no. 1 or Nod2 no. 2) or siRNA for LacZ as the control (Fig. 6). The induction of Nod2 mRNA expression by LPS was markedly suppressed by the expression of either Nod2 no. 1 or Nod2 no. 2 siRNA but not LacZ siRNA (Fig. 6A). The MDP-induced up-regulation of RANKL expression in osteoblasts was also inhibited by both Nod2 siRNAs but not LacZ siRNA (Fig. 6B). Blocking the Nod2 expression by siRNAs had no effect on 1{alpha},25(OH)2D3-induced RANKL expression in osteoblasts (data not shown).



View larger version (32K):
[in this window]
[in a new window]
 
FIGURE 6. Effects of depletion of Nod2 by siRNA on RANKL expression in osteoblasts. Confluent cultures of osteoblasts were infected with lentiviral vectors carrying LacZ siRNA as a control and two different siRNAs for Nod2 (Nod2 no. 1 and Nod2 no. 2). A, After infection for 24 h, osteoblasts were treated for 3 h with or without LPS (100 ng/ml). Total RNA was then extracted from osteoblasts and subjected to RT-PCR analysis of Nod2 mRNA. B, After infection for 24 h, osteoblasts were cultured for 72 h in the presence or absence of LPS (100 ng/ml) with or without MDP (10 µg/ml). Total RNA was then extracted from osteoblasts and subjected to RT-PCR analysis of RANKL mRNA. Figures below the signals represent the level of RANKL mRNA expression relative to GAPDH mRNA expression.

 
Effect of MDP on the survival of osteoclasts supported by LPS and RANKL

We previously reported that purified osteoclasts spontaneously died due to apoptosis within 48 h, and several osteotropic factors, such as LPS, IL-1, and RANKL, promoted the survival of osteoclasts (8). LPS and RANKL supported the survival of purified osteoclasts, and MDP showed no stimulatory effect on the survival of osteoclasts supported by of LPS and RANKL at two different concentrations (10 ng/ml, 100 ng/ml) (Fig. 7, A and B). Unlike osteoblasts, osteoclasts constitutively expressed Nod2 mRNA. Treatment of osteoclasts with LPS, MDP, or RANKL did not enhance Nod2 mRNA expression (Fig. 7C).



View larger version (62K):
[in this window]
[in a new window]
 
FIGURE 7. Effects of MDP on the survival of osteoclasts. A and B, Purified osteoclasts were cultured in the presence or absence of LPS (10 ng/ml, 100 ng/ml) or RANKL (10 ng/ml, 100 ng/ml) with or without MDP (10 µg/ml). After culturing for 48 h, cells were fixed and stained for TRAP (A). TRAP-positive cells with more than three nuclei were counted as living osteoclasts (B). Values are expressed as the means ± SD of three cultures. C, Purified osteoclasts were incubated for 3 h in the presence or absence of LPS (100 ng/ml), RANKL (100 ng/ml) or MDP (10 µg/ml). Total RNA was extracted from osteoclasts and subjected to RT-PCR analysis of Nod2 mRNA. Experiments were repeated three times, and similar results were obtained.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
We previously reported that MDP enhanced the LPS-induced production of inflammatory cytokines in human monocytic THP-1 cells (20, 21, 22). In the present study, we examined the effects of MDP on osteoclast formation and function using in vitro culture systems. MDP alone showed no effect on osteoclast formation in the cocultures. However, MDP enhanced osteoclast formation induced by LPS or IL-1{alpha} but not 1{alpha},25(OH)2D3 or PGE2 (Fig. 1, A and B). In contrast, osteoclast formation induced by RANKL and M-CSF in osteoclast progenitor cultures was not enhanced by MDP (Fig. 1C). RANKL expression induced by LPS or IL-1{alpha} in osteoblasts was up-regulated by the addition of MDP (Fig. 2). Similarly, MDP enhanced TNF-{alpha}-induced osteoclast formation in the cocultures and RANKL expression in osteoblasts, but not osteoclast formation from hemopoietic cells supported by TNF-{alpha} and M-CSF (Fig. 3). The MDP-induced up-regulation of osteoclast formation was observed in cocultures prepared from C3H/HeJ mice and TIRAP–/– mice (Fig. 4). RANKL mRNA expression was also enhanced by MDP in TIRAP-deficient osteoblasts (Fig. 4C). These results suggest that the target cells of MDP for the enhancement of osteoclast formation in the cocultures are osteoblasts, not osteoclast progenitors. The stimulatory effect of MDP on RANKL expression in osteoblasts appeared to be mediated by neither TLR2- nor TLR4-mediated signals.

Recent studies have established that Nod2 is an intracellular protein that recognizes MDP and transmits signals in response to MDP (21, 23). Monocytes were shown to constitutively express Nod2 in the absence of all stimuli (22). Primary osteoblasts, however, did not express a detectable level of Nod2 mRNA, but expressed high levels of it in response to LPS, IL-1{alpha}, or TNF-{alpha} but not 1{alpha},25(OH)2D3 (Fig. 5). The induction of Nod2 mRNA expression by LPS or IL-1{alpha} in osteoblasts was MyD88 dependent, but that by TNF-{alpha} was not (Fig. 5). These results suggest that Nod2 expression is regulated by both MyD88-dependent and -independent signals. The promoter of Nod2 has been shown to possess an NF-{kappa}B binding site (22). LPS but not 1{alpha},25(OH)2D3 induced the degradation of I{kappa}B in osteoblasts, suggesting that the activation of NF-{kappa}B stimulates Nod2 expression in osteoblasts (Fig. 5A). MDP augmented the induction of RANKL mRNA expression in osteoblasts by LPS or TNF-{alpha} but not 1{alpha},25(OH)2D3 (Figs. 2A, 3C, and 4C). The depletion of intracellular Nod2 by siRNAs blocked the MDP-induced up-regulation of RANKL mRNA expression in osteoblasts (Fig. 6). These results suggest that Nod2 expression in osteoblasts is required for the MDP-induced up-regulation of RANKL expression.

Receptor-interacting protein 2 (Rip2, also known as RICK, CARDIAK, CCK, and Ripk2), a serine/threonine kinase, has been proposed to be a downstream signaling molecule of Nod2 (42, 43, 44). Both Nod2 knockout mice and Rip2 knockout mice are significantly protected in endotoxin challenge experiments (45). Rip2 mRNA expression is up-regulated by LPS in murine macrophages (43). We confirmed that osteoblasts expressed Rip2 mRNA in response to LPS, IL-1{alpha}, and TNF-{alpha} (data not shown). These results suggest that LPS and proinflammatory cytokines increase susceptibility to MDP through up-regulation of both Nod2 and Rip2. MDP enhanced phosphorylation of ERK1/2 and RANKL expression in osteoblasts treated with by LPS (Fig. 2C). Rip2 has been shown to selectively phosphorylate ERK1/2 (46). These results suggest that MDP-Nod2 signals cross-talk with ERK1/2 through Rip2 activation to enhance RANKL expression in osteoblasts.

Purified osteoclasts undergo rapid apoptosis. We showed that osteotropic factors such as LPS, IL-1{alpha}, and RANKL enhanced the survival of osteoclasts and induced their bone-resorbing activity (8, 29, 30). Like macrophages, osteoclasts constitutively expressed Nod2 mRNA, but MDP failed to enhance the survival of osteoclasts supported by LPS and RANKL (Fig. 7). LPS and RANKL did not up-regulate Nod2 mRNA expression in osteoclasts, suggesting that up-regulation of Nod2 expression may be required for MDP-induced enhancement of the survival of osteoclasts supported by RANKL and LPS. Alternatively, the Nod2-mediated signal induced by MDP may be blocked in osteoclasts. Further studies will be necessary to elucidate the precise role of MDP-Nod2 signals in osteoclast function. It is important to point out that MDP does not directly stimulate osteoclast function, but indirectly does so though the enhancement of RANKL expression by osteoblasts in the presence of LPS and inflammatory cytokines.

In conclusion, MDP enhanced osteoclast formation induced by LPS, IL-1{alpha}, or TNF-{alpha} in cocultures via stimulation of RANKL expression in osteoblasts. LPS and IL-1{alpha} stimulated Nod2 mRNA expression in osteoblasts via MyD88 signaling, whereas TNF-{alpha} induced Nod2 mRNA expression in osteoblasts via MyD88-independent signaling (Fig. 8). The reduction of Nod2 expression by siRNAs blocked MDP-induced up-regulation of RANKL mRNA in osteoblasts. These results suggest that Nod2 acts as an intracellular receptor of MDP to induce RANKL expression in osteoblasts (Fig. 8). MDP has been shown to synergistically enhance the production of proinflammatory cytokines by monocytic cells in the presence of LPS. These results suggest that MDP might play a key role in osteoclastic bone resorption in inflammatory diseases such as periodontitis.



View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 8. Possible role of MDP in osteoclastogenesis induced by LPS, IL-1{alpha}, and TNF-{alpha}. LPS and IL-1{alpha} induce osteoblasts to express Nod2, a cellular receptor for MDP, through TLR4 and IL-1R, respectively. MyD88 is involved in TLR4- and IL-1R-mediated signaling. TNF-{alpha} binds to the TNF-{alpha} receptor (TNFR), and induces Nod2 expression through a MyD88-independent pathway. MDP binds to Nod2 and synergistically enhances the RANKL expression induced by LPS, IL-1{alpha}, and TNF-{alpha}. In contrast, 1{alpha},25(OH)2D3 directly induces RANKL expression via the vitamin D receptor (VDR) in a Nod2-independent manner.

 

    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported in part by Grants-in-Aid 80360220 and 90340059, and the Aichi Gakuin University High-Tech Research Center Project from the Ministry of Education, Culture, Sports, Science, and Technology of Japan. Back

2 Address correspondence and reprint requests to Dr. Nobuyuki Udagawa, Department of Biochemistry, Matsumoto Dental University, 1780 Gobara, Hiro-oka, Shiojiri, Nagano 399-0781, Japan. E-mail address: udagawa{at}po.mdu.ac.jp Back

3 Abbreviations used in this paper: RANKL, receptor activator of NF-{kappa}B ligand; 1{alpha},25(OH)2D3, 1{alpha},25-dihydroxyvitamin D3; OPG, osteoprotegerin; TIR, Toll/IL-1R; TIRAP, TIR domain-containing adapter protein; MDP, muramyl dipeptide; Nod2, nucleotide-binding oligomerization domain 2; TRAP, tartrate-resistant acid phosphatase; siRNA, small interference RNA; Rip2, receptor-interacting protein 2. Back

Received for publication February 10, 2005. Accepted for publication May 26, 2005.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Takahashi, N., T. Akatsu, N. Udagawa, T. Sasaki, A. Yamaguchi, J. M. Moseley, T. J. Martin, T. Suda. 1988. Osteoblastic cells are involved in osteoclast formation. Endocrinology 123: 2600-2602.[Abstract/Free Full Text]
  2. Udagawa, N., N. Takahashi, T. Akatsu, H. Tanaka, T. Sasaki, T. Nishihara, T. Koga, T. J. Martin, T. Suda. 1990. Origin of osteoclasts: mature monocytes and macrophages are capable of differentiating into osteoclasts under a suitable microenvironment prepared by bone marrow-derived stromal cells. Proc. Natl. Acad. Sci. USA 87: 7260-7264.[Abstract/Free Full Text]
  3. Yoshida, H., S. Hayashi, T. Kunisada, M. Ogawa, S. Nishikawa, H. Okamura, T. Sudo, L. D. Shultz. 1990. The murine mutation osteopetrosis is in the coding region of the macrophage colony stimulating factor gene. Nature 345: 442-444.[Medline]
  4. Boyle, W. J., W. S. Simonet, D. L. Lacey. 2003. Osteoclast differentiation and activation. Nature 423: 337-342.[Medline]
  5. Hofbauer, L. C., S. Khosla, C. R. Dunstan, D. L. Lacey, W. J. Boyle, B. L. Riggs. 2000. The roles of osteoprotegerin and osteoprotegerin ligand in the paracrine regulation of bone resorption. J. Bone Miner Res. 15: 2-12.[Medline]
  6. Yasuda, H., N. Shima, N. Nakagawa, S. I. Mochizuki, K. Yano, N. Fujise, Y. Sato, M. Goto, K. Yamaguchi, M. Kuriyama, et al 1998. Identity of osteoclastogenesis inhibitory factor (OCIF) and osteoprotegerin (OPG): a mechanism by which OPG/OCIF inhibits osteoclastogenesis in vitro. Endocrinology 139: 1329-1337.[Abstract/Free Full Text]
  7. Suda, T., N. Takahashi, N. Udagawa, E. Jimi, M. T. Gillespie, T. J. Martin. 1999. Modulation of osteoclast differentiation and function by the new members of the tumor necrosis factor receptor and ligand families. Endocr. Rev. 20: 345-357.[Abstract/Free Full Text]
  8. Jimi, E., S. Akiyama, T. Tsurukai, N. Okahashi, K. Kobayashi, N. Udagawa, T. Nishihara, N. Takahashi, T. Suda. 1999. Osteoclast differentiation factor acts as a multifunctional regulator in murine osteoclast differentiation and function. J. Immunol. 163: 434-442.[Abstract/Free Full Text]
  9. Takeda, K., T. Kaisho, S. Akira. 2003. Toll-like receptors. Annu. Rev. Immunol. 21: 335-376.[Medline]
  10. Ulevitch, R. J., P. S. Tobias. 1995. Receptor-dependent mechanisms of cell stimulation by bacterial endotoxin. Annu. Rev. Immunol. 13: 437-457.[Medline]
  11. Poltorak, A., X. He, I. Smirnova, M. Y. Liu, C. Van Huffel, X. Du, D. Birdwell, E. Alejos, M. Silva, C. Galanos, et al 1998. Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene. Science 282: 2085-2088.[Abstract/Free Full Text]
  12. Takeda, K., S. Akira. 2001. Roles of Toll-like receptors in innate immune responses. Genes Cells 6: 733-742.[Abstract]
  13. Adachi, O., T. Kawai, K. Takeda, M. Matsumoto, H. Tsutsui, M. Sakagami, K. Nakanishi, S. Akira. 1998. Targeted disruption of the MyD88 gene results in loss of IL-1- and IL-18-mediated function. Immunity 9: 143-150.[Medline]
  14. Yamamoto, M., S. Sato, H. Hemmi, H. Sanjo, S. Uematsu, T. Kaisho, K. Hoshino, O. Takeuchi, M. Kobayashi, T. Fujita, et al 2002. Essential role for TIRAP in activation of the signalling cascade shared by TLR2 and TLR4. Nature 420: 324-329.[Medline]
  15. Iwaki, D., H. Mitsuzawa, S. Murakami, H. Sano, M. Konishi, T. Akino, Y. Kuroki. 2002. The extracellular Toll-like receptor 2 domain directly binds peptidoglycan derived from Staphylococcus aureus. J. Biol. Chem. 277: 24315-24320.[Abstract/Free Full Text]
  16. Oppenheim, J. J., A. Togawa, L. Chedid, S. Mizel. 1980. Components of mycobacteria and muramyl dipeptide with adjuvant activity induce lymphocyte activating factor. Cell Immunol. 50: 71-81.[Medline]
  17. Murata, J., T. Kitamoto, Y. Ohya, T. Ouchi. 1997. Effect of dimerization of the D-glucose analogue of muramyl dipeptide on stimulation of macrophage-like cells. Carbohydr. Res. 297: 127-133.[Medline]
  18. Takada, H., S. Yokoyama, S. Yang. 2002. Enhancement of endotoxin activity by muramyldipeptide. J. Endotoxin Res. 8: 337-342.
  19. Takada, H., C. Galanos. 1987. Enhancement of endotoxin lethality and generation of anaphylactoid reactions by lipopolysaccharides in muramyl-dipeptide-treated mice. Infect. Immun. 55: 409-413.[Abstract/Free Full Text]
  20. Yang, S., R. Tamai, S. Akashi, O. Takeuchi, S. Akira, S. Sugawara, H. Takada. 2001. Synergistic effect of muramyldipeptide with lipopolysaccharide or lipoteichoic acid to induce inflammatory cytokines in human monocytic cells in culture. Infect. Immun. 69: 2045-2053.[Abstract/Free Full Text]
  21. Girardin, S. E., L. H. Travassos, M. Herve, D. Blanot, I. G. Boneca, D. J. Philpott, P. J. Sansonetti, D. Mengin-Lecreulx. 2003. Peptidoglycan molecular requirements allowing detection by Nod1 and Nod2. J. Biol. Chem. 278: 41702-41708.[Abstract/Free Full Text]
  22. Gutierrez, O., C. Pipaon, N. Inohara, A. Fontalba, Y. Ogura, F. Prosper, G. Nunez, J. L. Fernandez-Luna. 2002. Induction of Nod2 in myelomonocytic and intestinal epithelial cells via nuclear factor-{kappa}B activation. J. Biol. Chem. 277: 41701-41705.[Abstract/Free Full Text]
  23. Inohara, N., Y. Ogura, A. Fontalba, O. Gutierrez, F. Pons, J. Crespo, K. Fukase, S. Inamura, S. Kusumoto, M. Hashimoto, et al 2003. Host recognition of bacterial muramyl dipeptide mediated through NOD2: implications for Crohn’s disease. J. Biol. Chem. 278: 5509-5512.[Abstract/Free Full Text]
  24. Nomura, F., S. Akashi, Y. Sakao, S. Sato, T. Kawai, M. Matsumoto, K. Nakanishi, M. Kimoto, K. Miyake, K. Takeda, S. Akira. 2000. Cutting edge: endotoxin tolerance in mouse peritoneal macrophages correlates with down-regulation of surface Toll-like receptor 4 expression. J. Immunol. 164: 3476-3479.[Abstract/Free Full Text]
  25. Matsuguchi, T., K. Takagi, T. Musikacharoen, Y. Yoshikai. 2000. Gene expressions of lipopolysaccharide receptors, Toll-like receptors 2 and 4, are differently regulated in mouse T lymphocytes. Blood 95: 1378-1385.[Abstract/Free Full Text]
  26. Hatakeyama, J., R. Tamai, A. Sugiyama, S. Akashi, S. Sugawara, H. Takada. 2003. Contrasting responses of human gingival and periodontal ligament fibroblasts to bacterial cell-surface components through the CD14/Toll-like receptor system. Oral Microbiol. Immunol. 18: 14-23.[Medline]
  27. Kobayashi, K., N. Takahashi, E. Jimi, N. Udagawa, M. Takami, S. Kotake, N. Nakagawa, M. Kinosaki, K. Yamaguchi, N. Shima, et al 2000. Tumor necrosis factor {alpha} stimulates osteoclast differentiation by a mechanism independent of the ODF/RANKL-RANK interaction. J. Exp. Med. 191: 275-286.[Abstract/Free Full Text]
  28. Azuma, Y., K. Kaji, R. Katogi, S. Takeshita, A. Kudo. 2000. Tumor necrosis factor-{alpha} induces differentiation of and bone resorption by osteoclasts. J. Biol. Chem. 275: 4858-4864.[Abstract/Free Full Text]
  29. Jimi, E., I. Nakamura, L. T. Duong, T. Ikebe, N. Takahashi, G. A. Rodan, T. Suda. 1999. Interleukin 1 induces multinucleation and bone-resorbing activity of osteoclasts in the absence of osteoblasts/stromal cells. Exp. Cell Res. 247: 84-93.[Medline]
  30. Itoh, K., N. Udagawa, K. Kobayashi, K. Suda, X. Li, M. Takami, N. Okahashi, T. Nishihara, N. Takahashi. 2003. Lipopolysaccharide promotes the survival of osteoclasts via Toll-like receptor 4, but cytokine production of osteoclasts in response to lipopolysaccharide is different from that of macrophages. J. Immunol. 170: 3688-3695.[Abstract/Free Full Text]
  31. Kikuchi, T., T. Matsuguchi, N. Tsuboi, A. Mitani, S. Tanaka, M. Matsuoka, G. Yamamoto, T. Hishikawa, T. Noguchi, Y. Yoshikai. 2001. Gene expression of osteoclast differentiation factor is induced by lipopolysaccharide in mouse osteoblasts via Toll-like receptors. J. Immunol. 166: 3574-3579.[Abstract/Free Full Text]
  32. Suda, K., N. Udagawa, N. Sato, M. Takami, K. Itoh, J. T. Woo, N. Takahashi, K. Nagai. 2004. Suppression of osteoprotegerin expression by prostaglandin E2 is crucially involved in lipopolysaccharide-induced osteoclast formation. J. Immunol. 172: 2504-2510.[Abstract/Free Full Text]
  33. Sato, N., N. Takahashi, K. Suda, M. Nakamura, M. Yamaki, T. Ninomiya, Y. Kobayashi, H. Takada, K. Shibata, M. Yamamoto, et al 2004. MyD88 but not TRIF is essential for osteoclastogenesis induced by lipopolysaccharide, diacyl lipopeptide, and IL-1{alpha}. J. Exp. Med. 200: 601-611.[Abstract/Free Full Text]
  34. Hoshino, K., O. Takeuchi, T. Kawai, H. Sanjo, T. Ogawa, Y. Takeda, K. Takeda, S. Akira. 1999. Cutting edge: Toll-like receptor 4 (TLR4)-deficient mice are hyporesponsive to lipopolysaccharide: evidence for TLR4 as the Lps gene product. J. Immunol. 162: 3749-3752.[Abstract/Free Full Text]
  35. Udagawa, N., N. Takahashi, H. Yasuda, A. Mizuno, K. Itoh, Y. Ueno, T. Shinki, M. T. Gillespie, T. J. Martin, K. Higashio, T. Suda. 2000. Osteoprotegerin produced by osteoblasts is an important regulator in osteoclast development and function. Endocrinology 141: 3478-3484.[Abstract/Free Full Text]
  36. Wei, S., S. L. Teitelbaum, M. W. Wang, F. P. Ross. 2001. Receptor activator of nuclear factor-{kappa}B ligand activates nuclear factor-{kappa}B in osteoclast precursors. Endocrinology 142: 1290-1295.[Abstract/Free Full Text]
  37. Takahashi, N., N. Udagawa, S. Tanaka, T. Suda. 2003. Generating murine osteoclasts from bone marrow. Methods Mol. Med. 80: 129-144.[Medline]
  38. Nakamura, M., N. Udagawa, S. Matsuura, M. Mogi, H. Nakamura, H. Horiuchi, N. Saito, B. Y. Hiraoka, Y. Kobayashi, K. Takaoka, et al 2003. Osteoprotegerin regulates bone formation through a coupling mechanism with bone resorption. Endocrinology 144: 5441-5449.[Abstract/Free Full Text]
  39. Li, X., N. Udagawa, K. Itoh, K. Suda, Y. Murase, T. Nishihara, T. Suda, N. Takahashi. 2002. p38 MAPK-mediated signals are required for inducing osteoclast differentiation but not for osteoclast function. Endocrinology 143: 3105-3113.[Abstract/Free Full Text]
  40. Takeuchi, O., K. Hoshino, T. Kawai, H. Sanjo, H. Takada, T. Ogawa, K. Takeda, S. Akira. 1999. Differential roles of TLR2 and TLR4 in recognition of Gram-negative and Gram-positive bacterial cell wall components. Immunity 11: 443-451.[Medline]
  41. Kawai, T., O. Adachi, T. Ogawa, K. Takeda, S. Akira. 1999. Unresponsiveness of MyD88-deficient mice to endotoxin. Immunity 11: 115-122.[Medline]
  42. Ogura, Y., N. Inohara, A. Benito, F. F. Chen, S. Yamaoka, G. Nunez. 2001. Nod2, a Nod1/Apaf-1 family member that is restricted to monocytes and activates NF-{kappa}B. J. Biol. Chem. 276: 4812-4818.[Abstract/Free Full Text]
  43. Chin, A. I., P. W. Dempsey, K. Bruhn, J. F. Miller, Y. Xu, G. Cheng. 2002. Involvement of receptor-interacting protein 2 in innate and adaptive immune responses. Nature 416: 190-194.[Medline]
  44. Kobayashi, K., N. Inohara, L. D. Hernandez, J. E. Galan, G. Nunez, C. A. Janeway, R. Medzhitov, R. A. Flavell. 2002. RICK/Rip2/CARDIAK mediates signalling for receptors of the innate and adaptive immune systems. Nature 416: 194-199.[Medline]
  45. Pauleau, A. L., P. J. Murray. 2003. Role of nod2 in the response of macrophages to Toll-like receptor agonists. Mol. Cell Biol. 23: 7531-7539.[Abstract/Free Full Text]
  46. Navas, T. A., D. T. Baldwin, T. A. Stewart. 1999. RIP2 is a Raf1-activated mitogen-activated protein kinase kinase. J. Biol. Chem. 274: 33684-33690.[Abstract/Free Full Text]

Related articles in The JI:

IN THIS ISSUE

The JI 2005 175: 1359-1360. [Full Text]  



This article has been cited by other articles:


Home page
JDRHome page
Y. Hacchou, T. Uematsu, O. Ueda, Y. Usui, S. Uematsu, M. Takahashi, T. Uchihashi, Y. Kawazoe, T. Shiba, S. Kurihara, et al.
Inorganic Polyphosphate: a Possible Stimulant of Bone Formation
Journal of Dental Research, September 1, 2007; 86(9): 893 - 897.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. L. Lebeis, B. Bommarius, C. A. Parkos, M. A. Sherman, and D. Kalman
TLR Signaling Mediated by MyD88 Is Required for a Protective Innate Immune Response by Neutrophils to Citrobacter rodentium
J. Immunol., July 1, 2007; 179(1): 566 - 577.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
R. S. Kornbluth and G. W. Stone
Immunostimulatory combinations: designing the next generation of vaccine adjuvants
J. Leukoc. Biol., November 1, 2006; 80(5): 1084 - 1102.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Related articles in The JI
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yang, S.
Right arrow Articles by Furusawa, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yang, S.
Right arrow Articles by Furusawa, K.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS