HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Andrew, E. M. Articles by Carding, S. R. Search for Related Content PubMed PubMed Citation Articles by Andrew, E. M. Articles by Carding, S. R.

Delineation of the Function of a Major T Cell Subset during Infection¹

Elizabeth M. Andrew^2,*, Darren J. Newton^2,*, Jane E. Dalton^*, Charlotte E. Egan^*, Stewart J. Goodwin^*, Daniela Tramonti^*, Philip Scott and Simon R. Carding^3,*

^* School of Biochemistry and Microbiology, University of Leeds, Leeds, United Kingdom; and Department of Pathobiology, University of Pennsylvania School of Veterinary Medicine, Philadelphia, PA 19104

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
T cells play important but poorly defined roles in pathogen-induced immune responses and in preventing chronic inflammation and pathology. A major obstacle to defining their function is establishing the degree of functional redundancy and heterogeneity among T cells. Using mice deficient in V1⁺ T cells which are a major component of the T cell response to microbial infection, a specific immunoregulatory role for V1⁺ T cells in macrophage and T cell homeostasis during infection has been established. By contrast, V1⁺ T cells play no significant role in pathogen containment or eradication and cannot protect mice from immune-mediated pathology. Pathogen-elicited V1⁺ T cells also display different functional characteristics at different stages of the host response to infection that involves unique and different populations of V1⁺ T cells. These findings, therefore, identify distinct and nonoverlapping roles for T cell subsets in infection and establish the complexity and adaptability of a single population of T cells in the host response to infection that is not predetermined, but is, instead, shaped by environmental factors.

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
The essential role played by T cells in protective immunity to infection has been demonstrated in studies using T cell-deficient mice. These mice are more susceptible than their wild-type (WT)⁴ counterparts to infection with low doses of viruses (1, 2, 3), bacteria (4, 5, 6), and parasites (7, 8, 9), leading to the development of accelerated and exacerbated inflammatory responses that can result in necrosis, pathology, and even death (reviewed in Ref. 10). In response to microbial infection, T cell responses are staged, accumulating at the site of infection early, before, or concurrent with the involvement of T cells and again later, at the time of pathogen clearance (2, 11, 12, 13, 14, 15, 16, 17). Although reports of the biological role of T cells have been conflicting, models of infectious disease indicate that they may perform different functions at different stages of the immune response. In the early stage of infection T cells appear to be proinflammatory; their absence results in increased pathogen burden (6, 14), and they secrete IFN- (3, 8, 17, 18) and up-regulate its production by other lymphocytes and NK cells (19, 20). They can also direct adaptive ( T cell) responses (21, 22, 23). During the later stages of the immune response to microbial infection, T cells kill bacteria-elicited, activated macrophages, coincident with or after bacterial clearance (24), indicative of the involvement of T cells in preventing chronic inflammation. A similar staging of the T cell response has also been demonstrated in autoimmune disorders. For example, in a mouse model of collagen-induced arthritis, depletion of T cells before collagen immunization reduces disease severity, putatively through removal of a proinflammatory stimulus, whereas their depletion late in the course of disease increases its severity through a lack of regulatory T cells (25).

What is not clear is whether the pro- and anti-inflammatory functions of T cells are mediated by distinct subpopulations of T cells or by the same cells whose functional phenotype is influenced by the microenvironment in which they are activated. The differential expression of TCR variable (V) genes has been widely used to distinguish between different populations (reviewed in Ref. 26) and has been used to assign specific functions to different subsets of T cells (27, 28). The immune response to certain viral (13, 17) and bacterial (29, 30) infections is dominated by a single subset of T cells expressing TCRs encoded by the GV5S1 (V1; TCR-V nomenclature used is that of Heilig and Tonegawa (31)) and TRADV15 (V6) gene families (32) that accumulate in sites of infection coincident with or after pathogen clearance. The ability to kill Listeria monocytogenes (Lm)-elicited, activated macrophages has also been shown to be a property of the V1/V6⁺ subset (33) consistent with a role for these cells in macrophage homeostasis and in preventing chronic inflammatory responses after pathogen removal. The degree of functional heterogeneity of this subset is not clear, however, with both pro- and anti-inflammatory activities and with beneficial as well as detrimental effects on host responses having been described (reviewed in Ref. 34). V1⁺ T cells are prominent during the early stages of Lm infection, in which they have been shown to constitutively express IL-12Rs (30) and to be major producers of IFN- (17, 30), consistent with an early proinflammatory role and with acting as a bridge between the innate and adaptive immune systems. However, studies of the overall protective role of V1⁺ T cells in Lm infection are inconclusive, with in vivo depletion studies resulting in either increased (35) or decreased (36) bacterial numbers, leaving it unclear whether bacterial containment and protection are properties of the V1⁺ or other T cell subsets.

A major obstacle in defining the function of V1⁺ T cells is therefore establishing the degree of functional redundancy and heterogeneity of this population during the course of infection. To resolve the conflicting evidence relating to the function of V1⁺ T cells, TCRV1-deficient (V1^–/–) mice have been used to determine the requirement for V1⁺ T cells in the host response to infection and the extent of functional redundancy among T cells during pathogen-induced immune responses. We show in this study that V1⁺ T cells have an essential, nonredundant function in macrophage homeostasis and may play a novel role in regulating T cell homeostasis. They cannot, however, protect TCR^–/– mice from immune-mediated tissue injury. In addition, V1⁺ T cells exhibit a considerable degree of functional plasticity and heterogeneity, and V1⁺ T cells involved in the early vs late stages of pathogen-induced immune responses comprise nonoverlapping populations that appear to be selectively expanded on the basis of their ability to produce cytokines appropriate to the pervading environmental conditions and the stage of the immune response.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
Mice and infection

Male and female mice were used at 6–8 wk of age, with three to five mice per group. C57BL/6 TCRV1^–/– mice were generated in our laboratory, C57BL/6 TCR^–/– were obtained from The Jackson Laboratory, C57BL/6 mice were obtained from Harlan Laboratories, and all were housed in the animal facility at University of Leeds. For the generation of TCR-V1^–/– mice, fragments of the murine TCR-V1-J4-C4 gene were cloned from a bacterial artificial chromosome murine ES-129/SvJ library, and sequences were checked with those obtained from C57BL/6 genomic DNA. A targeting vector was designed to replace a genomic fragment containing V1, J4, and exon 1 of C4 sequences with a neomycin resistance cassette. The targeting vector was linearized and electroporated into ES cells (Incyte Genetics). After G418 selection, homologous recombinants were identified by Southern blot hybridization using a 5' probe consisting of an 0.3-kb HindII-SacI genomic DNA fragment located 0.4 kb 5' of V2 and a 3' probe comprising an 1.3-kb EcoRV-XbaI genomic DNA fragment encompassing exon 4 of the C4 gene. Two clones heterozygous for the targeted mutation were injected into C57BL/6 blastocysts, which were subsequently transferred into pseudopregnant foster mothers. Chimeric mice were crossed with C57BL/6 mice to produce heterozygous TCR-V1^+/– mice. Germline transmission of the mutation was verified by PCR and Southern blot analysis of tail DNA. Heterozygotes were intercrossed to generate homozygous TCR-V1^–/– mice. Homozygous and heterozygous mutant mice were backcrossed into C57BL/6 mice more than seven times before use in experiments. WT and TCR^–/–, and TCRV1^–/– mice were infected i.p. with 1.5 x 10⁴ CFU of Lm (strain 10403S). Between 2 and 8 days after infection, spleens and livers were weighed and homogenized in distilled water, and 10 µl of the homogenate was plated onto brain-heart infusion agar (Oxoid). Colonies were counted after 24-h incubation at 37°C, and the numbers of CFU per spleen and per gram of tissue were calculated.

Assessment of liver damage

Liver damage in Lm-infected mice was assessed by serum alanine aminotransferase (ALT) levels and histology. Serum ALT was measured on an ADVIA 2400 chemistry system analyzer (Bayer) following the manufacturer’s instructions. For histology, Formalin-fixed, paraffin-embedded, 5-µm tissue sections from the livers of infected and control noninfected mice were stained with H&E and examined with an Axiovert 200M microscope (Zeiss) and Axiovison image analysis software (Imaging Associates).

Cellular phenotypic analysis by flow cytometry

Standard protocols were followed for preparing cell suspensions (37). Briefly, for splenocytes, the tissues were homogenized, contaminating erythrocytes lysed with 0.84% (w/v) ammonium chloride solution, and the cell suspension was passed through a 0.7-µm pore size nylon filter and washed before Ab staining. Small intestinal intraepithelial lymphocytes (iIELs) were isolated from Peyer’s patch-excised small intestines by 37°C incubation in 50 ml of HBSS containing 10% (v/v) FBS, 5 mM EDTA, and 3 mg/ml dithioerythritol, followed by density gradient separation on Percoll (Amersham Biosciences) (38). Peritoneal exudate cells were collected in HBSS containing 10 U/ml heparin. All reagents were purchased from Sigma-Aldrich. For surface staining, the Abs included F(ab')₂ of mAbs specific for TCR-V1 (clone 2.11) (39), TCR V6.3 (clone 17C) (16), and TCR- (GL3) and intact Ab specific for TCR-V7 (F2.67). The 2.11 and F2.67 hybridoma cell lines were provided by Dr. P. Pereira (Institut Pasteur, Paris, France). The commercial anti-mouse mAbs used were TCR (GL3), CD3 (145-2C11), TCRV4 (V2; UC3-10A6), TCRV5 (V3; 536), and F4/80, conjugated to biotin or fluorochromes purchased from Caltag-Medsystems or BD Pharmingen. Streptavidin conjugates of PE, FITC, (Caltag Laboratories), or Alexa Fluor 633 (Molecular Probes) were used as secondary reagents. To block nonspecific Ab binding, cells were incubated with anti-FcR Ab mixture, anti-CD16/32 (20 µg/ml; Caltag Laboratories). Isotype-matched Abs of irrelevant specificity were used to determine the level of nonspecific staining. Stained cells were analyzed on a FACSCalibur flow cytometer using CellQuest software (BD Biosciences).

T cell enrichment and adoptive transfer

T cells were enriched from splenocytes of C57BL/6 mice by positive immunomagnetic selection after labeling with either FITC-F(ab')₂ of anti-TCR-V1 (2.11)- or anti-TCR- (GL3)-specific mAbs, followed by anti-FITC magnetic microbeads and selection on MACS LS columns (Miltenyi Biotec). The resulting cell populations routinely contained >80% T cells of >95% viability, and 2–4 x 10⁵ cells were then transferred i.v. into C57BL/6 TCR^–/– and TCRV1^–/– mice immediately before bacterial infection.

Macrophage-T cell coculture

Plastic-adherent peritoneal exudate cells (5 x 10⁵) from day 8 Lm-infected TCR^–/– mice were incubated with splenocytes (1 x 10⁶) from WT or V1^–/– mice on eight-well chamber slides (ICN Pharmaceuticals) and cultured at 37°C in RPMI 1640 (Sigma-Aldrich) with 10% FBS for 1 h as previously described (33). To evaluate macrophage killing by T cells, adherent macrophages were incubated with the Live/Dead cell reagent (Molecular Probes) containing fluorescent dyes that identify the intracellular esterase activity of viable cells (calcein AM) or that are incorporated in the nuclei of dead cells (ethidium bromide homodimer-1) and were examined by UV microscopy using an Axiovert 200M microscope (Zeiss) and Axiovison image analysis software (Imaging Associates). At least 100 live and/or dead cells were counted in four separate fields.

Cytokine analysis

Intracellular cytokines were detected by cytoplasmic staining of splenocytes recovered from Lm-infected WT mice after culture in vitro for 5 h with 10 µg/ml brefeldin A (Sigma-Aldrich). Cells were then surface-stained with anti-CD3, -TCR-, and -TCR-V1 mAbs; fixed in 1% paraformaldehyde; and permeabilized with 0.5% saponin (Sigma-Aldrich) before cytoplasmic staining with PE-conjugated anti-mouse cytokine mAbs to IL-2, IL-4, IL-5, IL-6, IL-10, IFN-, and TNF- (Caltag-Medsystems or BD Pharmingen) or FITC-conjugated polyclonal Abs to MIP-1 and MCP-1 (Sigma-Aldrich). Anti-TGF- and anti-latency-associated peptide bound to latent TGF- (anti-LAP) mAbs (R&D Systems) were conjugated to FITC and used for surface staining. PE- and FITC-conjugated isotype-matched mAbs of irrelevant specificity were used to determine levels of nonspecific staining of anti-cytokine mAbs.

TCR-V/V profiling and structural analyses

RNA was extracted from T cell-enriched splenocytes from Lm-infected C57BL/6 mice using Tri-reagent (Sigma-Aldrich) according to the manufacturer’s instructions. RNA was reverse transcribed using an oligo(dT)-primed ImpromII RT kit (Promega), and the resulting cDNA was amplified using Reddy-Mix (Abgene) under the following reaction conditions; denaturation at 94°C, annealing at 55°C, and extension at 72°C for 38 cycles. The primers used (5'-3') were V1CCGGCAAAAAGCAAAAAAGT, C4AAGGAGACAAAGGTAGGTCCCAGC, V2TTGGTACCGGCAAAAAACAAATCA, C2CAATACACCCTTATGACATCG, V4CTTGCAACCCCTACCCATAT, V5GAGGATCCCGCTTGGAAATGGATGAGA, V6GATCCAAGAGGAAAGGAAAGACGGC, V7GATCCAACTTCGTCAGTTCCACAAC,C1CCACCACTCGTTTCTTTAGG, V1AATAGCAATTCTACTGATGGTGG, V2AGTCCTCAGTCTCTGACAATC, V3CCAGATTCAATGGAAAGTAC, V4GTACAAACAGCAAGGAGGGCAGG, V5CCAGACAGTGGCAAGCGGCACTG, V6TCAAGTCCATCAGCCTTGTC, C1CGAATTCCACAATCTTCTTG, GCTTCTTTGCAGCTCCTTCGTTG (-actin forward), and TTCTCCATGTCGTCCCAGTTGG (-actin reverse). Products were visualized on 2% ethidium bromide-stained agarose gels. Structural analyses of PCR-amplified TCR cDNAs was conducted by direct sequencing of pGEM-T (Promega)-cloned cDNAs and by spectratyping (Lark DNA Technologies). For spectratype analysis, 2 µl of PCR product was amplified in a 10-cycle run-off reaction using fluorescently labeled, J-region-specific primers (J1, CTTAGTTCCTTCTGCAAATACC; J4, TACGAGCTTTGTCCCTTTG), and the amplicons were analyzed on sequencing gels using GenescanView4 software (CRIBI).

Statistical analysis

Differences in mean values between two groups were evaluated by Mann-Whitney U tests using Statistical Package for the Social Sciences software (SPSS).

	Results

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
Phenotypic characteristics of V1^–/– mice

V1-deficient (V1^–/–) mice were generated to define V1⁺ T cell function and determine the extent of functional redundancy among T cells during pathogen-induced immune responses. Mice homozygous for the V1 null allele were created by mutating the V1 gene as well as the J4 and exons 1 and 2 of the C4 gene to prevent any rearrangement and the possibility of pairing of other V genes with an otherwise intact C4 gene. Founder animals heterozygous for the mutation were bred to obtain homozygous mice, which were identified by Southern blotting (Fig. 1A). The absence of V1 mRNA expression in V1^–/– spleen and thymus confirmed that these mice were deficient in TCRV1-expressing T cells (Fig. 1B). Homozygous mice were backcrossed at least seven generations onto the C57BL/6 background before experimentation. Homozygous mice were healthy, able to mate, and had a normal life span. The only observed physiological differences between V1^–/– and WT mice was an enlargement of the primary lymphoid organs in adult (>6 wk old) V1^–/– mice resulting in an 1.5-fold increase in the cellularity of the thymus (average of 1.1 x 10⁸ in WT and 1.6 x 10⁸ in V1^–/– mice) and spleen (average of 4 x 10⁷ in WT and 6 x 10⁷ in V1^–/– mice). This increase in cellularity was not attributable to any one population of leukocytes and resulted in increased numbers of T cells in these tissues. A comparison of the splenic TCR-V and -V mRNA profiles in noninfected adult WT and V1^–/– mice showed no qualitative differences in the profile of expression of V2-, V4-, and V6-encoded TCRs in the absence of V1⁺ T cells (Fig. 1B). The expression of V6 in these mice, which is the major -chain paired with V1 in WT mice (33, 40), shows that V1 is not required for the expression of this -chain and that it can be used by other V receptors, such as V2 and V4 (41).

View larger version (36K): [in this window] [in a new window]   FIGURE 1. TCRV1-deficient (V1–/–) mouse phenotype. A, Southern blot analysis of V1 alleles in genomic DNA extracted from tail tips of homozygous WT (+/+), heterozygous (+/–), and homozygous V1–/– (–/–) littermates. B, RT-PCR of V and V6 gene expression in the thymus and/or spleen of V1–/– and C57BL/6 (WT) mice. C and D, The distribution of T cells among splenocytes and iIELs of V1–/– and WT mice. Histograms, which are representative of >10 mice of each genotype, show the proportions of CD3+ cells stained with anti- (filled plots) and isotype control (open plots) Abs. The percentage of V7+ iIELs (D) was determined by gating on + cells.

T cell recruitment during Lm infection is regulated by V1⁺ T cells

The T cell response to Lm infection in C57BL/6 mice is biphasic, with increased numbers of cells seen early (day 2), before the T cell response, and later (days 6–8), coincident with or after bacterial clearance (16, 42). The T cells present at both the early and late stages of the response are dominated by a single subset that coexpresses V1 and V6.3 (V1/V6) TCRs (16). The T cell response to infection in the absence of this subset was determined by comparing splenocyte TCR-V and -V receptor expression in both the early and late responses in WT and V1^–/– mice.

Up to 2 days after infection, TCR-V and -V expression in both strains of mice was similar (Fig. 2A), with the exception of a lack of V1 expression in V1^–/– mice. There was also no change in TCR-V expression from the noninfected state, in which only TCR-V6 mRNA was detected (data not shown). Unexpectedly, TCR-V7 mRNA, which was not detected in the spleen of noninfected mice of either strain, was present in the spleen of both V1^–/– and WT mice on day 2 after infection.

View larger version (40K): [in this window] [in a new window]   FIGURE 2. V1+ T cells control recruitment of other T cells to the site of infection. A and B, RT-PCR of the TCR-V and -V genes expressed by T cells enriched from splenocytes of WT (+/+) and V1–/– (–/–) mice obtained at 2 (A) and 8 (B) days after infection with Lm. C, The distribution of TCRV+ subsets of T cells in Lm-infected WT (n = 5) and V1–/– (n = 6) mice and V1–/– mice reconstituted with 2 x 105 V1+ T cells immediately before infection (AT-V1–/–; n = 6), determined by staining splenocytes from day 8 infected mice with anti-CD3-, --, and -V/-specific Abs. AT-V1–/– mice were tested for the V5 and V7 subsets only (p 0.05). D, TCRV spectratype analysis was conducted on V5 and V7 RT-PCR products amplified from skin and iIELs respectively, of noninfected WT (d0) mice and from T cell-enriched splenocytes from day 8 Lm-infected V1–/– mice (d8).

V1⁺ T cells are both necessary and sufficient for T cell involvement in macrophage homeostasis

Previously we have shown that and V1/V6⁺ T cells kill populations of activated macrophages (33, 42). Peak cytocidal activity occurs during the late T cell response coincident with the appearance of large numbers of terminally differentiated macrophages and with bacteria clearance. V1^–/– mice were used therefore to establish whether macrophage killing is a nonredundant function of V1⁺ T cells and what the consequences of their absence is on the response and fate of macrophages during infection. Similar to those in Lm-infected TCR^–/– mice, the percentage and absolute number of macrophages were increased in V1^–/– mice in the primary sites of infection, with a 3- to 4-fold increase in the spleen (Fig. 3A) and a 2-fold or more increase in the peritoneal cavity (Fig. 3B) late during the course of infection. This increase in macrophage numbers in TCRV1^–/– mice was similar to or greater than that seen in TCR^–/– mice and was reduced to levels comparable with those in WT individuals by reconstitution with V1⁺ T cells before infection. Most significant was the absence of any macrophage cytotoxic activity among splenocytes from V1^–/– mice (Fig. 3C). As shown in this study and previously (33), macrophage cytotoxicity was only evident among effector cells obtained from either noninfected or Lm-infected mice with intact T cell populations (WT and TCR^–/– mice) and was restricted to the macrophage-adherent V1⁺ subset of T cells. Thus, V1⁺ T cells are both necessary and sufficient to kill Lm-activated macrophages and play an important and nonredundant role in macrophage homeostasis during pathogen-induced immune responses.

View larger version (29K): [in this window] [in a new window]   FIGURE 3. V1+ T cells are necessary and sufficient to control macrophage (M) homeostasis. A and B, The distribution and number of macrophages recovered from spleen (A) and peritoneal cavity (B) of noninfected C57BL/6, V1–/– mice, TCR–/– mice, and V1–/– mice reconstituted with 2 x 105 V1+ T cells immediately before infection (AT-V1–/–). Histograms, representative of six to eight mice in each group, show the profile of staining with the macrophage-specific Ab, F4/80 (filled plots), and isotype-matched control Ab (open plots). C, Macrophage cytocidal activity among splenocytes from noninfected C57BL/6, V1–/–, and TCR–/– mice determined by coculture with pathogen-elicited macrophages from peritoneal exudate cells from TCR–/– mice obtained 8 days after Lm infection. Macrophage death was evaluated using a live/dead cell assay, with the frequency of dead cells determined by UV microscopy. Levels of spontaneous macrophage death were determined by culturing macrophages in the absence of spleen cells (M alone). Results shown were collated from three experiments of four to six mice per experiment.

V1⁺ T cells do not protect mice from immune-mediated tissue injury

Exaggerated inflammation and extensive tissue (liver) necrosis are hallmark features of microbial and Lm infection in T cell-deficient mice (4, 5). Although the identity and means by which specific populations of T cells normally protect the host from immune-mediated tissue injury as a consequence of infection have not been identified, the reported anti-inflammatory and antibacterial activities of V1⁺ T cells (24, 36) suggest that they may perform such a role. This possibility was investigated further in this study by determining whether V1⁺ T cells contribute to pathogen containment and eradication and/or can prevent the liver necrosis seen in Lm-infected TCR^–/– mice.

V1^–/– mice were able to contain bacterial infection to the same extent as WT animals (Fig. 4A). With the exception of day 2 after infection, there was no significant difference in bacterial numbers in the livers of V1^–/– mice and WT mice throughout infection, although there was a fairly wide distribution in bacterial numbers between individuals in the same group on all days after infection. At 2 days after infection, there were significantly more bacteria in the livers of V1^–/– compared with TCR^–/– mice (p = 0.03). By 4 days after infection, however, which is before or coincident with the onset of liver necrosis, the pattern had reversed, with TCR^–/– mice containing significantly (p = 0.05) more bacteria than either V1^–/– or WT mice. Because the total weight of the liver of each mouse strain was similar and did not change throughout the course of infection, the bacterial CFU per gram values obtained were representative of the total bacterial load in the liver. The difference observed in bacterial burden between V1^–/– and TCR^–/– mice may reflect the slower migration of bacteria in TCR^–/– mice from the initial site of infection (peritoneal cavity) to the liver and then more rapid bacterial growth due to a complete lack of T cells.

View larger version (89K): [in this window] [in a new window]   FIGURE 4. V1+ T cells do not contribute to bacterial containment or protection from liver damage in murine listeriosis. a, Number of bacterial CFU per gram of liver in WT, V1–/–, and TCR–/– mice infected i.p. with 1.5 x 104 CFU of Lm. Total liver mass was similar in all strains. b, Serum ALT levels, indicative of liver damage, before and 6 days after Lm infection. c and d, H&E-stained paraffin sections of livers 6 days after infection to show necrotic lesions (arrows; magnification, x250). c, Appearance of liver in WT (i), TCR–/– (ii), and V1–/– (iii) mice was typical of that seen in at least nine mice per group. d, Livers of TCR–/– mice transfused with 2–4 x 105 (i) or V1+ (ii) T cells immediately before infection, representative of four or five mice per group. e, Number of bacteria per gram of liver 6 days after infection of TCR–/– mice transfused with T cells, V1+- or V1–-enriched T cells, or saline alone (no cells). Each dot represents the CFU of an individual mouse, and horizontal bars represent mean CFU per group.

V1⁺ T cells show stage-dependent functional differences during Lm infection

That T cells are functionally heterogeneous and their involvement in certain pathogen-induced immune responses is staged are well established (3, 6, 11, 12, 14, 16, 17, 18, 21, 47, 48). Important questions, however, are: what is the extent of functional plasticity among cells that express TCRs encoded by the same V/ gene segments, and are the same or different populations of T cells involved in different stages of the host response to infection? To address these issues, the functional attributes and structure of the CDR3 regions of the TCRs expressed by V1⁺ T cells during the early and late stages of the immune response to Lm infection in WT mice were compared.

Intracellular cytokine staining and flow cytometry were used to profile the cytokine response of V1⁺ T cells at 2 and 8 days after infection, corresponding to the peaks of their response to Lm in C57BL/6 mice (Fig. 5A) and mirroring the waves of T cells that form the early and late responses (10, 16). At both stages of the immune response to Lm infection, V1⁺ T cells were the major source of the cytokines produced by T cells as a whole; with the exception of IL-6 production at 2 days after infection, the frequency of V1⁺ cells that produced any of the cytokines tested was at least equivalent to and in some cases higher than that produced by all other (V1^–) T cells (Fig. 5, C and D). In general, the highest number of cytokine-producing V1⁺ T cells was present during the late stage (day 8) of the immune response (Fig. 5, C vs D), with significantly more (p < 0.01) V1⁺ T cells producing the anti-inflammatory cytokines, TGF-, LAP, and IL-10, during the late vs the early stage of the host response to infection (Fig. 5B). There were also significant increases in the frequency of V1⁺ T cells producing IL-6 and IL-2 during the late stage of the immune response to Lm (Fig. 5B) and in IL-5 production by V1⁺ at the early stage of the response (Fig. 5C). In contrast, during the early stage of the anti-Lm response, V1⁺ T cells produced only one cytokine, IL-4, at significantly higher levels (p 0.01) than at the late stage of the response (Fig. 5B). In the early stages the production of IL-4, which is a strong promoter of IL-12 (49) and of neutrophil recruitment to the liver (50), suggests a more proinflammatory role for V1⁺ T cells early in infection. There were essentially no differences in the frequency of cells producing the other cytokines and chemokines examined (IL-5, IFN-, TNF-, MCP-1, and MIP-1), which were all produced to a similar extent by V1⁺ T cells at both time points after infection. On day 8 after infection, the vast majority of LAP- and TGF--positive T cells were V1⁺ (Fig. 5D). Because this was detected on the cell surface, it is not clear whether it was produced by the cells or was bound to the cell surface, although high levels of TGF- mRNA expression were detected among FACS-purified, late-stage V1⁺ T cells by microarray analysis (data not shown). The presence of TGF- in both its latent and active forms, in conjunction with the production by these cells of IL-10 and IL-2, is reminiscent of the functional phenotype of CD4⁺ T regulatory cells, suggestive of a role for V1⁺ T cells in down-modulating the late-stage T cell response either directly or perhaps via induction of CD4⁺CD25⁺ regulatory T cells (51). This analysis of cytokine production by V1⁺ T cells clearly demonstrates their functional heterogeneity, which is appropriate to the stage of infection at which they become involved.

View larger version (23K): [in this window] [in a new window]   FIGURE 5. The functional phenotype of V1+ T cells is influenced by the stage of infection. A, Temporal response of splenic V1+ T cells to Lm infection in C57BL/6 mice before and up to 12 days after infection, showing a significant increase (p < 0.05) in V1+ T cell number between days 0 and 2 and between days 4 and 8. B, Frequency of cytokine-synthesizing V1+ T cells during the early and late stages of Lm infection, determined by four-color flow cytometric analysis. Splenic V1+ T cells (FACS-gated on CD3+,+ cells) from C57BL/6 WT mice 2 (early) and 8 (late) days after infection showed significant differences in the synthesis of IL-2, IL-4, IL-6, IL-10, TGF-, and LAP between days 2 and 8: *, p 0.01; **, p 0.05. C and D, Comparative analysis of the number of cytokine-producing V1+ and V1– T cells (per 103 T cells) at 2 days (C) and 8 days (D) after infection. The mean ± SEM shown are of six to 12 individual mice from three independent experiments.

View larger version (37K): [in this window] [in a new window]   FIGURE 6. Structural diversity of V1/V6 TCRs expressed during infection. TCR spectratype analysis (A and D) and DNA sequencing (B and C) of V1 and V6 TCR cDNAs from RT-PCR-amplified mRNA, expressed by T cells isolated from C57BL/6 WT mice before (day 0) and at 2 days (early) and 8 days (late) after Lm infection. Profiles in A represent V1 CDR3 spectratypes from more than six mice for each sample set from which the distribution of individual peaks was plotted on the bar graph. D, Individual TCR-V1 and V6 cDNAs were cloned and individually sequenced to obtain nucleotide V-(D)-J junctional sequences that were translated into amino acid sequences. B and C, Values in column labeled "no" indicate sequences occurring more than once. Values listed under the heading Net Charge represent net charge in TCRV6-D-J sequences determined using Protean analysis software (DNASTAR).

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

Previously it was shown that V1/V6.3⁺ T cells kill activated macrophages during the late stage of Lm infection (33, 42), an activity that is dependent on specific activation of the macrophages, but not of the V1/V6.3⁺ T cells, and is TCR mediated (33) and Fas-Fas ligand dependent (52). This study extends these findings by demonstrating that macrophage cytocidal activity is unique to V1⁺ T cells and that these T cells are essential for eliminating activated macrophages and regulating activated macrophage numbers. The readiness of V1/V6.3⁺ T cells from noninfected mice to kill activated macrophages may be explained by their constitutive state of activation; in the spleen, they have been shown to constitutively express IL-12Rs (30) and markers of a memory/activation phenotype (53), consistent with their being poised for a rapid response. The inability to detect pathogen specificity among responding T cells, their reactivity with macrophages activated in response to different infectious and noninfectious stimuli (33), and the reactivity of T cell clones and hybridomas with unknown autologous Ags (reviewed in Ref. 10) suggest that V1/V6.3⁺ T cells are innately autoreactive (54) and that activated macrophages express an array of (self) Ags that can be recognized by large numbers of structurally diverse V1/V6 TCRs.

The absence in Lm-infected V1^–/– mice of the immune-mediated liver necrosis that is a hallmark feature of listeriosis in TCR^–/– mice and the inability to transfer this protection to TCR^–/– mice with splenic V1⁺ T cells provide strong evidence for nonoverlapping function of T cell subsets during pathogen-induced immune responses. This does not, however, entirely exclude the possibility that in the absence of the V1⁺ subset of T cells any protective effect they might have is compensated for by other T cells. It is likely, however, that populations of T cells other than V1⁺ T cells contained within the V1^– fraction of splenic T cells (Fig. 4) are responsible for providing protection against immune cell-mediated tissue injury. Although the mechanism(s) of tissue injury in infected TCR^–/– mice remains unclear, the phenotype of Lm-infected V1^–/– mice excludes the involvement of activated macrophages that occurs as a result of a breakdown in macrophage homeostasis due to the absence of V1⁺ T cells. A requirement for the presence of CD4⁺ or CD8⁺ T cells in the development of inflammatory lesions, however, has been demonstrated in Ab depletion studies (23). In contrast to previous studies in which Ab-mediated depletion of V1⁺ T cells enhanced bacterial clearance (36), we found no evidence for a requirement for V1⁺ T cells to limit or control bacterial growth in the primary sites of Lm infection beyond the first 2 days of infection. This apparent discrepancy may be related to differences in the efficiency and specificity of the Abs used for cell ablation vs gene targeting and differences in the strain of Lm used (regarding virulence and infectious dose), the route and site of infection, and the strain of mouse used, all of which influence the magnitude and kinetics of T cell and V1⁺ T cell responses (16, 34).

An unexpected role for V1⁺ T cells in the homeostatic regulation of other T cell populations in response to infection has been identified in this study. The appearance in the spleen of Lm-infected V1^–/– mice of V5⁺ and V7⁺ T cells bearing TCRs that structurally resemble those of V5⁺ DETC and V7⁺ iIEL suggests a role for V1⁺ T cells in the homeostatic regulation of T cells. The fact that reconstitution of V1⁺ T cells in TCRV1^–/– mice restores normal immune cell regulation (splenic T cell repertoires and macrophage homeostasis) effectively defines V1⁺ T cells as an immunoregulatory T cell subset (26). The presence of invariant V6 TCRs (D. J. Newton and S. R. Carding, unpublished observations) in the spleens of Lm-infected V1^–/– mice was also unexpected. Although it was not possible to establish the origin and relationship of the cells in the periphery of infected V1^–/– mice and the epithelial tissues of WT animals, they may be distinct. The vast majority (90%) of V5⁺ T cells in Lm-infected V1^–/– mice were not reactive with the DETC anti-TCRV5/V1 clonotype Ab, 17D.1 (45) (E. M. Andrew and S. R. Carding, unpublished observations), suggesting that the majority of these T cells are not skin derived and that the V5 receptor chain expressed in the spleen of V1^–/– mice may pair with other V-chains. The coincident expression of V4- and V5-chains in addition to V1 in the spleens of infected V1^–/–, but not WT, mice suggests that some of the V5⁺ (and V6⁺) cells may use these alternative V-chains (41), and may confer specificities and functions on these cells different from their epithelia-associated counterparts. At this time it is not clear what, if any, is the functional significance of the unusual V5⁺, V6⁺, and V7⁺ T cells in the spleens of V1^–/– mice late in the course of infection. The inherent anti-inflammatory and cytotoxic activities of mucosa-associated T cells that use the same V-encoded TCRs and their appearance late in the course of infection suggest that they might play a similar role in the spleens of infected V1^–/– mice, compensating, perhaps, for the absence of anti-inflammatory V1⁺ T cells. What stimulates these nonresident T cells to locate to the spleen, and the regulatory mechanism by which V1⁺ T cells control or prevent this, are not clear, although they may be attracted by chemotactic signals, such as MCP-1 (55), from activated macrophages that have not been down-modulated in the absence of anti-inflammatory V1⁺ T cells. Future studies addressing the novel homeostatic properties of V1⁺ T cells should resolve these issues.

Analysis of the cytokine profile of V1⁺ T cells accumulating during the early and late stages of the immune response to Lm demonstrates that this population of T cells is functionally heterogeneous. Differences in V1 (and V6) CDR3 sequences expressed at the early and late stages of the immune response to Lm implies the existence of unique V1⁺ T cell clones at both time points that could confer and account for the different functional characteristics of early- and late-responding V1⁺ T cells. This functional plasticity among pathogen-elicited V1/V6 T cells does not fit well, however, with the idea that T cell function is determined or dictated by TCRV usage (27, 28). Indeed, although this may be more applicable to the restricted and invariant epithelia-associated populations of T cells, the data presented in this study argue for the functional heterogeneity of systemic V1⁺ T cell responses to infection are most likely influenced by their microenvironment and conditions of activation and, therefore, by the stage of infection.

	Disclosures

Top Abstract Introduction Materials and Methods