|
|
||||||||
Induction during Maturation of Intestinal Macrophages1,2

Departments of*
Internal Medicine I and
Pathology, University of Regensburg, Regensburg, Germany
| Abstract |
|---|
|
|
|---|
, indicating that this chemokine is induced in IMAC compared with in vitro differentiated macrophages. MIP-3
protein expression was confirmed in cryostat sections of normal intestinal mucosa by immunohistochemistry. IMAC in the lamina propria stained positive for MIP-3
. FACS of purified IMAC clearly indicated expression of MIP-3
in these cells. In the MCS-in vitro differentiation model for IMAC, MIP-3
protein expression was absent on day 1 but detectable on day 7 of coculture, demonstrating the induction of MIP-3
during differentiation of IMAC. IMAC attracted CD45R0+ T cells to migrate into an MCS coculture model. In human mucosa, a close contact between IMAC and CD45R0+ T cells could be demonstrated. MIP-3
is induced during the differentiation of monocytes into IMAC. Our data suggest that MIP-3
expression could be involved in the recruitment of CD45R0+ cells into the lamina propria. | Introduction |
|---|
|
|
|---|
B is found (12). In addition, IMAC from normal mucosa lack expression of receptors for bacterial wall products such as TLRs 2 and 4 (13). Colonic macrophages from normal mucosa also have low antibacterial toxicity and lack enzymes for oxidative burst reaction such as NADPH oxidase (14). A nondisturbed differentiation of emigrating blood monocytes into IMAC with loss of activation receptors and functional anergy may therefore be crucial for the integrity of the intestinal mucosa. Recently, we established an in vitro multicellular spheroid (MCS) model in which we could induce the phenotype of normal IMAC (15).
For this study, we purified IMAC from normal mucosa according to a protocol recently established in our laboratory (9, 14) and performed a subtractive hybridization to study mRNA expression in normal IMAC vs in vitro differentiated macrophages. In the subtraction of cDNA from in vitro differentiated macrophages from intestinal macrophages from normal mucosa, we obtained 76 gene products. Three of the differentially expressed clones had homology to MIP-3
.
MIP-3
, also called liver and activation-induced chemokine (16), Exodus (17), or SCYA20, is a CC chemokine that has been reported to attract memory T lymphocytes and immature dendritic cells (DCs) (18, 19, 20, 21, 22, 23, 24). It was identified and cloned in 1997 (25). In contrast to many other chemokines, MIP-3
has a relatively specific receptor and binds almost exclusively to the chemokine receptor CCR6, which is expressed on immature DCs and memory T lymphocytes but is also found on B lymphocytes (22, 26, 27, 28, 29, 30). A high constitutive expression of MIP-3
mRNA can be found in lung and liver (16, 17, 25). Epithelial cells are thought to be an important source of MIP-3
production (20, 31, 32, 33, 34, 35), but it is also expressed by other cell types, including endothelial cells, fibroblasts, and monocytes (27, 36). Remarkably, MIP-3
mRNA was found to be highly expressed in lung macrophages (27). Strong induction of MIP-3
mRNA was demonstrated during inflammation (20, 31, 37, 38, 39, 40, 41, 42). MIP-3
is released on stimulation of cells with proinflammatory cytokines, such as TNF or IL-1 mediated by NF-
B activation (40, 43, 44).
However, according to the results presented in this article, epithelial MIP-3
production during inflammatory responses is only one aspect of MIP-3
function in the intestinal mucosa. Our data indicate that MIP-3
expression induced during the differentiation of IMAC might also have an important role in normal mucosal physiology.
| Materials and Methods |
|---|
|
|
|---|
Blood was drawn from 18 healthy male donors between 21 and 31 years of age. PBMCs were isolated from heparinized blood by Ficoll-Paque (Pharmacia Biotech) gradient centrifugation as described in Ref. 45 . The interphase containing PBMCs was collected and washed twice (440 x g for 5 min at 18°C) in HEPES-RPMI 1640 (Sigma-Aldrich). The cell suspension contained 1535% monocytes, 6585% lymphocytes, and <1% granulocytes. Viability was better than 99%, as measured by trypan blue exclusion.
T cells were separated by countercurrent elutriation (J6M-E Beckman centrifuge; Beckman) at a flow rate of 52 ml/min in HBSS and 6% autologous plasma. Cells were frozen immediately in RPMI 1640 culture medium containing 10% DMSO (Sigma-Aldrich) and 40% heat-inactivated (56°C for 30 min) autologous plasma. For experiments, T cells were rapidly thawed at 37°C, washed with PBS (Invitrogen Life Technologies), and resuspended in RPMI 1640.
Monocytes were isolated using a large volume chamber (50 ml), a JE-5 rotor at 2500 rpm, and a flow rate of 110 ml/min in HBSS supplemented with human plasma (46). Elutriated monocytes were >90% pure as determined by morphology and antigenic phenotyping.
Differentiation of monocytes into macrophages
In vitro differentiation of monocytes into macrophages was achieved as described by Andreesen et al. (47). Freshly elutriated monocytes (1 x 106 cells/ml) were cultivated for 7 days in Teflon foil containing medium supplemented with 2% human AB serum (Sigma-Aldrich). Cells were cultured at 37°C under 7% CO2. In vitro differentiated macrophages can easily be detached from the Teflon membrane by incubation at 4°C for 30 min.
Patients
Specimens were taken from healthy areas of the colonic mucosa of patients undergoing surgery: 6 patients with sigmoid carcinoma; 4 patients with rectal carcinoma; 4 patients with diverticulosis; 2 patients with colon carcinoma; 2 patients with diverticulitis; and 1 patient with soft tissue sarcoma. Of a total of 19 subjects, 14 were male and 5 were female. Patients were between 40 and 73 years of age. Histological examination performed on surgical specimens by a pathologist; 19 samples from colon without detectable inflammation were included in the study. The study was approved by the University of Regensburg Ethics Committee.
Isolation of human lamina propria mononuclear cells (LPMNCs)
Small pieces of human intestinal mucosa from a surgical specimen were kept at 4°C in sterile RPMI 1640 supplemented with PenStrep and 10% FCS for transportation. Specimens were then incubated in calcium- and magnesium-free HBSS with 1 mmol/L EDTA for 30 min at 37°C under gentle shaking to remove the intestinal epithelial cells. Human LPMNCs were isolated according to a modification of the method of Bull and Bookman (14) as described recently. Specimen were incubated for 30 min in 2 ml of PBS with 1 mg/ml collagenase type I (= 336 U/ml; Sigma Aldrich Chemie), 0.3 mg/ml DNase I (Boehringer-Mannheim) and 0.2 mg/ml hyaluronidase (Sigma Aldrich Chemie) without FCS at 37°C. Cells were washed in 15 ml PBS with 500 µl FCS and finally submitted to Ficoll density gradient centrifugation for 20 min at 2000 rpm (
690g, without brake) in a Heraeus centrifuge for the isolation of mononuclear cells. The interphase was carefully removed and washed with PBS.
Isolation of IMAC
LPMNCs were isolated from human intestinal mucosa specimens. A total of 107 cells were resuspended in 80 µl of PBS and labeled with 20 µl of immunomagnetic MicroBeads armed with CD33 Ab (isotype, mouse IgG1; clone, P67.6; Miltenyi Biotec). IMAC were purified twice with the help of type AS separation columns (Miltenyi Biotec) as described recently (14). Briefly, LPMNCs with magnetically labeled macrophages were passed through an AS separation column placed in the permanent magnet SuperMACS. The magnetically labeled cells were retained in the column and separated from the unlabeled cells, which pass through. After removal of the column from the magnetic field, the retained fraction could be eluted. Eluted cells were passed through a second AS separation column to increase purification of macrophages to a final purity of >95% as determined by flow cytometry.
Isolation and amplification of mRNA
mRNA was isolated by polyT magnetic beads (Dynal Biotech) from CD33+ mononuclear cells according to the manufacturers protocol. The integrity of the mRNA was verified by a Gene Checker kit (Invitrogen). mRNA was reverse transcribed and amplified with the SMART PCR cDNA synthesis kit (Clontech). Briefly, to obtain amplified cDNA, first-strand synthesis was performed with a modified oligodeoxythymidylate primer with an additional 5' sequence and a second primer with an oligodeoxyguanylate sequence at its 3' end. When reverse transcriptase (RT) reaches the 5'end of the mRNA, the terminal transferase activity of the enzyme adds a few deoxycytidine nucleotides to the 3' end of the cDNA. The second primer pairs with the deoxycytidine stretch, RT then switches templates and continues replicating to the end of the oligonucleotide. cDNA was then amplified with the modified oligodeoxythymidylate and oligodeoxyguanylate primers.
Subtractive hybridization
Subtractive hybridization of the cDNA populations was performed by subtracting cDNA from in vitro differentiated macrophages (from three healthy donors) from those of IMAC (from three different donors) with the Clontech PCR-Select cDNA subtraction kit. cDNA from IMAC was subdivided into two portions, which were ligated with different adaptors. Two hybridizations were performed. In the first, a 4-fold excess of cDNA from monocytes was added to each sample of cDNA from IMAC. The samples were then heat denatured and allowed to anneal. Single-stranded cDNA molecules from IMAC were significantly enriched for differentially expressed sequences, as cDNAs that were not differentially expressed form hybrids with cDNAs from monocytes. During the second hybridization, the two primary hybridization samples were mixed together without denaturation. Only the remaining single-stranded molecules from IMAC could reassociate and form new hybrids. The entire population of molecules was subjected to PCR to amplify the desired differentially expressed sequences. A secondary PCR amplification was performed using nested primers to further reduce background PCR products and enrich for differentially expressed sequences.
PAGE and single-strand conformation polymorphism gel electrophoresis were performed with the subtracted cDNA. Products were cloned with TOPO-TA cloning kit (Invitrogen) and sequenced, and a similarity search was performed. The BLAST program was used to perform DNA database searches for sequence similarities. The result of the BLAST records was evaluated with a score (arbitrary units), considering length of the alignment, mismatches, and gaps. Only hits with an arbitrary score of >700 bits were further analyzed.
Flow cytometry
Human monocytes and IMAC were immunostained according to a modified protocol described by Mikulka et al. (48). For flow cytometry analysis IMAC were isolated from human intestinal mucosa specimen as described and resuspended in PBS. For fixation cells were kept in 70% ice-cold methanol at 20°C for 60 min, washed, and resuspended. To block unspecific binding sites, human AB serum was added to a final concentration of 2%. For each staining, 100 µl of cell suspension were placed in 1.5-ml polypropylene tubes, and anti-MIP-3
Ab or isotype control was added. Incubation was performed in the dark for 60 min on ice to ensure specific staining. Cells were washed with PBS and resuspended in 100 µl of PBS for further staining with anti-goat IgG secondary Ab. Cells were washed with PBS and resuspended in 500 µl of PBS.
For CCR6 staining, the PE-labeled Ab or isotype control (Sigma-Aldrich; final concentration, 0.2 µg/ml) was added.
Flow cytometry was performed using a FACScan (BD Biosciences) equipped with an argon ion laser with an excitation power of 15 mW at 488 nm. The fluorescence of 1 x 104 cells was collected on a linear scale through right angle scatter (side scatter) and fluorescence for FITC or PE was collected at 530 nm (FL1) or 575 nm (FL2), respectively.
Analysis gates were set around debris, and intact cells were set on a forward scatter vs side scatter dot plot. The fluorescence dot plots were generated using the gated data. Acquisition was performed on fixed cells. Data acquisition and analysis were performed automatically using LYSIS TM II software, version 1.1 (BD Biosciences) or WIN-MDI software.
Antibodies
Monoclonal mouse anti-human macrophage CD68 (M0814, clone KP1, IgG1
; DAKO; final concentration, 0.5 µg/ml) was applied for the identification of human IMAC. Purified mouse IgG1
isotype (Sigma-Aldrich; final concentration, 0.5 µg/ml) was used as control Ab. Peroxidase-conjugated goat anti-mouse IgG Ab (Sigma-Aldrich; final concentration, 0.2 µg/ml) or biotin-conjugated goat anti-mouse IgG Ab (Jackson ImmunoResearch Laboratories; final concentration, 0.2 µg/ml) were used as secondary Abs. Goat serum (DAKO; final concentration, 0.4 µg/ml) was used for blocking.
The following Abs were used for the identification of MIP-3
in human mucosa. Goat serum (goat anti-human MIP-3
; AF360, IgG, polyclonal, R&D; final concentration, 0.2 µg/ml) was used as isotype control and for blocking. Biotin-conjugated rabbit anti-goat Ab (B7014; Sigma; final concentration, 0.2 µg/ml) was used as secondary Ab. Rabbit Ig fraction (X0903; DAKO; final concentration, 0.4 µg/ml) was used for blocking. For isolation of human IMAC monoclonal mouse anti-human macrophage, CD33 MicroBeads (Miltenyi Biotec) were used. For flow cytometry analysis, cell suspensions were immunostained with goat anti-human MIP-3
and anti-goat IgG secondary Ab (swine, FITC labeled; Caltag; final concentration, 0.2 µg/ml). For CCR6 staining, the appropriate Ab (No. 559562, mouse IgG1
, monoclonal, PE labeled; BD Biosciences; final concentration, 0.2 µg/ml) or isotype control (M-5284; Sigma; final concentration, 0.2 µg/ml) was added.
The following Abs were used for the fluorescent identification of CD68 in human mucosa and spheroids. Goat serum (goat anti-human CD68; polyclonal; Santa Cruz Biotechnology; final concentration, 0.2 µg/ml) was used as isotype control. Alexa Fluor 594-conjugated chicken anti-goat Ab (Molecular Probes; final dilution, 1/300) was used as secondary Ab for red fluorescence staining.
The following Abs were used for the fluorescent identification of CD45R0. Mouse anti-human CD45R0 (clone UCHL1, IgG2a, monoclonal; DAKO; final concentration, 0.2 µg/ml) was used. Mouse IgG2a (monoclonal; DAKO; final concentration, 0.2 µg/ml) was used as isotype control. Alexa Fluor 488-conjugated goat anti-mouse Ab (Molecular Probes; final dilution, 1/300) was used as secondary Ab for green fluorescence staining.
Neutralizing Abs to human MIP-3
(polyclonal, rabbit, acris-antibodies; final concentrations, 15, 1.5, and 0.15 µg/ml) were used for blocking studies.
Demasking of paraffin-embedded sections
Paraffin-embedded sections used for fluorescence microscopy were cut (5 µm), floated on demineralized water, placed on slides, and baked for 30 min at 60°C. Slides were dewaxed for 10 min with xylene and rehydrated in a graded ethanol series (99%, 95%, 70% ethanol and PBS, pH 7.4, for 5 min each). For demasking, sections were incubated for 30 min with target retrieval solution (DAKO) at 95°C in a microwave oven. Endogenous peroxidase was quenched for 30 min with 1% hydrogen peroxide in PBS buffer. Slides were washed three times in PBS.
Immunohistochemistry
To inactivate endogenous peroxidase, the slides were exposed to 0.3% hydrogen peroxide in PBS for 30 min. To block unspecific binding sites, PBS with BSA (1% final concentration) and serum, appropriate to the primary and secondary antiserum, was added.
For blue staining, sections were exposed to primary antiserum and biotin-conjugated secondary Abs. After formation of an avidin-biotin-peroxidase complex (Vectastain ABC elite standard system; Vector Laboratories), slides were preincubated for 8 min in 0.01% benzidine dihydrochloride (BDHC; Sigma-Aldrich) with 0.03% sodium nitroprusside (Sigma-Aldrich) and transferred to the reaction medium (0.01% BDHC, 0.005% hydrogen peroxide, and 0.03% sodium nitroprusside). The formation of the dark blue granular reaction product was monitored under the microscope.
For brown or red staining, cells tagged with avidin-biotin-peroxidase complex were incubated for 210 min with 3,3'-diaminobenzidine (DAB)-substrate solution (SK-4100, DAB-nickel kit; Vector Laboratories) or a freshly prepared solution of NovaRED (SK-4800; Vector Laboratories).
To identify the cell types that expressed MIP-3
, an immunohistochemical procedure for sequential Ag localization was applied. In the first step, MIP-3
was visualized with NovaRED for red staining as described. To suppress the remaining peroxidase, the slides were exposed to 0.3% hydrogen peroxide in PBS. In the second step CD68 was visualized with DAB-substrate solution (Vector Laboratories) using the gray-black staining option according to the manufacturers protocol.
All staining reactions were stopped with PBS. Cells were counterstained with Mayers hematoxylin solution (blue; Sigma-Aldrich) or aqueous eosin solution (red; Sigma-Aldrich). Finally, the sections were mounted with Faramount aqueous medium (S 3025; Vector Laboratories). Paraffin-embedded sections were mounted with Vectashield medium (Vector Laboratories) containing 4',6'-diamidino-2-phenylindole (DAPI) for labeling of DNA producing a blue fluorescence.
Statistical analysis
For semiquantitative analysis of T cell migration in MCS immunostained cells were counted in three high power fields (hpfs) at a magnification of x200. The number of migrated cells was calculated from three MCS for each time point or anti-MIP-3
concentration. The experiments were repeated three times.
For analysis of T cell migration with neutralizing Abs, cells were counted in four hpfs at a magnification of x200.
For counting double immunostained cells, four hpfs at a magnification of x400 were considered. No apparent gap between the immunostained IMACs and CD45R0+ was defined as "close contact." The number of "close contacts" was determined by evaluating four hpfs at a magnification of x400. Data are expressed as mean ± SD. Statistical analyses were performed using the paired Student t test. Differences were considered significant at p < 0.05.
Cell line
HT-29 cells were grown in DMEM (Biochrom) supplemented with 10% FCS (PAN Systems), 1% penicillin-streptomycin mixture (PAN Systems), 1% nonessential amino acids, and 1% sodium pyruvate (Biochrom). The cell line was cultured under standard tissue culture conditions.
Generation of MCS
MCS were generated according to the liquid overlay culture technique (49). HT-29 (4 x 103) suspended in 0.2 ml of medium per well were seeded in agarose-coated wells of 96-well plates and cultured under static conditions. The cells formed small aggregates within 3 days, which further enlarged during culture. After 3 days, one-half of the medium was replaced by fresh medium. After 3 more days of culture, MCS had formed and were used for experiments. MCS supernatants (0.1 ml each) were replaced by freshly isolated, elutriated monocytes (1 x 104) and/or T cells (1 x 104) in 0.1 ml of medium supplemented with 2% human AB serum. Cocultures of MCS with monocytes and T cells were harvested after 2, 4, 7, and 10 days for analysis. MCS supernatants for blocking studies were replaced by monocytes (4 x 105) and T cells (4 x 105) after 5 days. Cocultures were harvested after 7 days for analysis.
For semiquantitative analysis of migration monocytes and T cells were immunostained and counted in three hpfs fields at a magnification of x200 in three different MCS. For analysis of migration of CD45R0+ in blocking studies, T cells were counted in four hpfs fields in three different MCS.
MCS of HT-29 cells transfected with an empty adenoviral construct (Ad_0) and a MIP-3
expression construct (Ad_MIP-3
) were generated similarly. The adenoviral vector was constructed with the AdEasy Vector System kit (Qbiogene) according to the manufacturers protocol. mRNA isolated from IMAC was reverse transcribed with a reverse transcription system kit (Promega), and a 316-bp fragment containing the MIP-3
coding sequence was amplified in a standard reaction with the Advantage-HF 2 PCR kit (Clontech: upstream primer, ATGTGCTGTACCAAGAGTTTG; downstream primer, TTCCATTCCAGAAAAGCCAC) according to the manufacturers protocols. HT-29 transfection with Ad_MIP-3
was performed with a multiplicity of infection of 1. MIP-3
protein expression was confirmed in supernatants of transfected HT-29 and MCS with the Quantikine ELISA kit (R&D) according to the manufacturers protocol.
Migration assays
Migration assays were performed in the modified 48-well Boyden chamber with a polycarbonate filter (8-µm pore size, polyvinylpyrrolidone-free; Gerbu Biotechnik) as described earlier (50, 51); 25 µl of medium with fMLP (Sigma-Aldrich; 105108 M final concentrations) or recombinant human MIP-3
(R&D; 0.3125 x 10610 2 M final concentration) and without chemoattractant as negative control were tested. Freshly elutriated monocytes (4 x 104) in HEPES-RPMI 1640 with 2% human AB serum were seeded into the wells of the upper compartment. The Boyden chamber was incubated at 37°C in 5% CO2 atmosphere for 2 h. The migrated cells were fixed, stained with a Hemacolor staining kit (Merck), and counted in four microscopic high power fields (hpf) of view at a 400-fold magnification. Each experiment was repeated three times.
| Results |
|---|
|
|
|---|
To elucidate possible functional differences of normal IMAC compared with in vitro differentiated macrophages we performed a subtractive hybridization of mRNA expression in IMAC and in vitro differentiated macrophages as described in material and methods. To avoid individual differences responsible for subtraction results macrophages from three specimens and from three blood donors were pooled. The subtracted cDNAs were further separated with a single-strand conformation polymorphism gel. Overall, 76 different products were obtained. All cDNAs were cloned and sequenced. All sequenced subtracted products are listed in Ref. 52 .
A search of the expressed sequence tag database showed that 3 of these 76 subtracted products had >99% homology to mRNA of MIP-3
. To demonstrate reliability of the subtractive hybridization, we performed semiquantitative RT-PCR for MIP-3
with RNAs from normal IMAC and in vitro differentiated macrophages. RT-PCR was repeated three times with mRNA not used for the subtractive hybridization procedure. Whereas no specific PCR-product could be amplified from in vitro differentiated macrophages with 32 cycles (Fig. 1), a strong signal could be obtained with RNA from normal IMAC. PCR for actin proved integrity of the RNA from both sources.
|
protein expression in human IMAC
By flow cytometric analysis, the data on mRNA expression level obtained by RT-PCR and subtractive hybridization could be confirmed on the protein level. IMAC were isolated and purified from human LPMNCs from noninflamed patients as described in Material and Methods. Human monocytes from healthy volunteers, in vitro differentiated macrophages, and IMAC, all different from those used for RT-PCR and subtractive hybridization, were fixed in methanol. Monocytes from all donors lacked protein expression of MIP-3
(Fig. 2, A and B). The fluorescence ratio of cells immunostained with anti-MIP-3
Ab vs cells incubated with isotype control Ab was 0.99 ± 0.00, clearly indicating a lack of MIP-3
expression. Similarly, in vitro differentiated macrophages showed no expression of MIP-3
(Fig. 2C) except for one experiment in which a slight shift was detectable (Fig. 2D). The fluorescence ratio was increased to 1.36 ± 0.69. In contrast, IMAC showed expression of MIP-3
protein (Fig. 2, E and F). The fluorescence ratio was increased to 39.70 ± 10.60.
|
receptor CCR6 is involved in the migration of IMAC, blood monocytes were tested for expression of CCR6. Freshly elutriated blood monocytes from three healthy donors showed no expression of CCR6 as revealed by FACS (data not shown).
MIP-3
protein expression in human intestinal mucosa
Immunohistochemistry with frozen sections obtained from macroscopic normal mucosa was performed to localize MIP-3
protein in the intestinal mucosa. We applied two immunohistochemical procedures to visualize staining with BDHC (dark blue) and DAB as substrates as described in Materials and Methods to ensure validity of the results. In all specimens, MIP-3
could be detected in epithelial cells but also in the lamina propria with an inhomogeneous pattern of distribution (Fig. 3, A and B). To identify IMAC, we applied an Ab against the typical intracellular macrophage marker CD68. In the lamina propria from the same specimens used for MIP-3
immunostaining,
510% of the cells stained positive for the macrophages (arrows) (Fig. 3, C and D). These cells showed a distribution very similar to that found for the MIP-3
staining, leading us to assume that the MIP-3
-positive cells are IMAC.
|
-expressing cells were IMAC, an immunohistochemical procedure for sequential Ag localization was applied using NovaRED and DAB-nickel as described in Materials and Methods. Staining of MIP-3
in a first step resulted in an diffuse red reaction product. A CD68 Ab for the identification of IMAC was used in the second step and visualized with DAB-nickel resulting in an gray/black intracellular granular deposit. MIP-3
could be colocalized with CD68 in all specimens from macroscopically normal mucosa (Fig. 4A) and submucosa (Fig. 4B). From 62 to 81% of the IMAC immunostained positive for MIP-3
.
|
during the differentiation of IMAC
To demonstrate that MIP-3
is induced during the differentiation of IMAC, we used the recently established MCS model for the differentiation of IMAC as described in Materials and Methods. HT-29-MCS were prepared and incubated with freshly isolated monocytes. Cocultures were transferred to liquid nitrogen after 24 h, 3 days, and 7 days, and Ag expression was determined by immunohistochemistry. MIP-3
and CD68 were both visualized with NovaRED. No expression of MIP-3
was detectable in spheroids after 24 h of coculture (Fig. 5A). Nevertheless, CD68 staining clearly showed the presence of monocytes at day 1 of the coculture experiment (Fig. 5B). Expression of MIP-3
was detectable over the whole cross-section of the spheroids after 7 days of coculture (Fig. 5C) corresponding with detectable CD68-positive macrophages (Fig. 5D). These data confirmed the induction of MIP-3
during IMAC differentiation.
|
To investigate whether the induction of MIP-3
expression by IMAC influences monocyte/macrophage recruitment into the intestinal mucosa, we determined the amount of migration of freshly elutriated monocytes into HT-29-MCS transfected with an adenoviral vector for MIP-3
(Ad_MIP-3
). MIP-3
protein expression was measured by ELISA in the supernatants of the MCS (89 ± 28 pg/ml). MCS migration assays were performed three times. Monocytes did not show increased migration in cocultures with Ad_MIP-3
-transfected HT-29 cells compared with cocultures with Ad_0 or mock transfected HT-29 cells (data not shown). The lack of MIP-3
influence on monocyte migration was further confirmed in the modified 48-well Boyden chamber. Migration assays were performed with recombinant human MIP-3
using seven different concentrations (0.3125 x 10610 2 M) or fMLP as positive control. MIP-3
had no influence on monocyte migration (data not shown).
Colocalization of CD68 and CD45R0 in human intestinal mucosa
Because MIP-3
expression did not influence monocyte/macrophage migration, we investigated whether it could be involved in the recruitment of memory T cells (CD45R0+ cells). Because this is difficult to investigate in an experimental setting in human mucosa, we first performed immunohistochemistry with paraffin-embedded sections obtained from normal mucosa of four patients to determine whether IMAC and CD45R0+ T cells are colocalized in the intestinal mucosa. The anti-CD68 Ab was applied in a first staining step and visualized with an Alexa Fluor 594-conjugated secondary Ab for red fluorescence staining. The Ab for identification of CD45R0 was used for the second staining step and visualized with an Alexa Fluor 488-conjugated secondary Ab for green fluorescence. CD68+ macrophages were detectable in the lamina propria in a typical pattern (Fig. 6, A and C). From 6 to 13% of the IMAC were found in close contact with CD45R0+ cells (Fig. 6, B and C). Cells were counterstained with DAPI.
|
-expressing macrophages in MCS
To prove that the induction of MIP-3
during the differentiation of IMAC in involved in the recruitment of CD45R0+ cells, again the MCS model was used. MCS were either incubated only with elutriated T cells (Fig. 7A) or with T cells and freshly isolated monocytes added at the same time (Fig. 7B) or 2 days before T cell addition (Fig. 7C). Coculture MCS were transferred to liquid nitrogen after 2, 4, 7, and 10 days, and CD45R0 expression was detected by immunofluorescence staining.
|
Further increased migration of CD45RO+ cells was detectable in MCS when monocytes were added 2 days before T cells after 4 days (32.3 ± 3.2 CD45R0+ cells/hpf) and 7 days (35.3 ± 7 CD45R0+ cells/hpf; Fig. 7C). The migration of CD45R0+ cells incubated with monocytes added 2 days before T cells was significantly higher on day 4 than the migration of CD45R0+ cells incubated with monocytes on the same day (p < 0.001) or without monocytes on day 4 (p < 0.001) and day 7 (p = 0.002).
To prove the contribution of MIP-3
to the recruitment of CD45R0+ cells in blocking studies, MCS were generated, and T cells and monocytes were added after 5 days. Cocultures were incubated with 15, 1.5, or 0.15 µg/ml or without neutralizing Abs to human MIP-3
. MCS were harvested after 7 days for analysis, and CD45R0 expression was detected by immunohistochemistry. In spheroids incubated without neutralizing Abs, CD45R0+ cells were detectable after 7 days (Figs. 8A and 9). The migration of CD45R0+ cells incubated with 0.15 µg/ml neutralizing Abs was significantly reduced (p = 0.032) with cells from donor 1 (23 ± 2.5 vs 1 ± 0.3 CD45R0+ cells/hpf in MCS; Fig. 9). Little CD45R0 expression was detectable only in the border area of spheroids with 1.5 and 15 µg/ml neutralizing Abs with cells from donor 1 (Fig. 8E). Migration of CD45R0+ cells from donor 2 was 39 ± 2.5 CD45R0+ cells/hpf after incubation with neutralizing Abs at a final concentration of 1.5 µg/ml and significantly less (p = 0.030) after incubation with 15 µg/ml (14 ± 1.9 CD45R0+ cells/hpf; Figs. 8C and 9).
|
|
| Discussion |
|---|
|
|
|---|
mRNA and protein expression in macrophages of the intestinal mucosa. We provide evidence that MIP-3
is induced during the specific differentiation of IMAC. Furthermore, our experiments suggest that MIP-3
has a physiological role in IMAC from normal, noninflamed mucosa for the recruitment of CD45R0+ memory T cells. In addition, in confirmation of other studies, MIP-3
expression was found in intestinal epithelial cells (53).
MIP-3
expression is induced after stimulation of monocytic cell lines and is implicated in the pathogenesis of inflammatory bowel disease. Up-regulated MIP-3
protein expression was shown in THP-1 monocytic cells activated by PMA or LPS (36) and in in vitro differentiated human macrophages by infection with viruses (54). Izadpanah et al. (32) demonstrated production and regulated expression of MIP-3
by human intestinal epithelium. Intestinal epithelial cell lines showed constitutively MIP-3
mRNA expression and an up-regulation by proinflammatory cytokines or in response to infection with bacterial pathogens (32). Kwon et al. (53) also described IL-1- and TNF-mediated induction of MIP-3
production in intestinal epithelial cell lines. In addition, they found significantly elevated MIP-3
mRNA and protein levels in Crohns disease compared with controls or ulcerative colitis. In this study, MIP-3
immunoreactivity in normal colon and inflammatory bowel disease was described to be associated only with crypt and surface epithelial cells (53). From these studies, it was concluded that MIP-3
plays a role only during mucosal inflammation. Our study now provides evidence that the role of MIP-3
under normal, noninflamed conditions may be even more important.
Expression of the MIP-3
-exclusive receptor CCR6 has been demonstrated on B cells, DCs, and T cells but is limited to certain time points of differentiation. Mature, naive B cells lose CCR6 after triggering by Ag but re-express CCR6 as memory B cells (55). Distinct immature DC subsets migrate in response to MIP-3
, e.g., CD34+ Langerhans cell precursors from the cord blood and freshly isolated Langerhans cells (18, 20, 24, 27, 56). Within T cells, CCR6 expression and chemotactic response to MIP-3
is thought to be limited to the CD45R0+ memory T cell population (28).
Taken together, our data suggest that CCR6 acts on cells that home to mucosal sites. Recruitment of memory T cells is induced by IMAC regardless of the T cell Ag specificity. MIP-3
and its receptor may be involved in the aggregation of this cell population as part of an immune response (28, 57). IMAC are possibly exposed to a low but constant level of bacterial Ags independent of an intact epithelial barrier and behave like APCs even in the absence of infection. Low expression of MHC class II molecules on IMAC has been shown (9); however, in normal mucosa, these cells lack expression of costimulatory molecules CD80 and CD86. Similar to naive T cells, memory T cells exposed to Ag presentation without costimulation will not be activated. The lack of expression of costimulatory molecules on IMAC could be an important mechanism involved in the induction of peripheral tolerance to abundant Ags to which the mucosa is continuously exposed.
During infection and inflammation, memory T cells migrate into the mucosa and are exposed to microbial Ags presented by IMAC, which are localized preferentially at the site of Ag entry. Mucosal inflammation is characterized by the appearance of a functionally different subset of CD80+ and CD86+ IMAC (6). Costimulated memory T cells may stick more closely and tightly to IMAC via integrins as indicated in a recent article by Hogg et al. (58). Thereby, Ag-specific T cells may be retained in the intestinal mucosa and prevented from recirculation.
Interestingly, no CCR6 expression has been described for immature B cells (29, 55), precursors of DCs, DCs derived from peripheral blood monocytes, mature DCs (20, 22, 24), and precursors of memory T cells (28), suggesting that cells might acquire MIP-3
responsiveness during migration into the tissue or induction of tissue-specific local cytokine microenvironment (59). Under normal conditions, CCR6+ cells might also not exist in sufficient number to be detected in the circulation (20).
An analogous principle may be postulated for monocytes but available data are discussed controversial at present. Ruth et al. (60) found MIP-3
-induced monocyte chemotactic activity, whereas Power et al. (27) found no chemotaxis. No CCR6 was detected on monocytes (20, 28), but it could be inducible or expressed on a subpopulation as mentioned above. However, we failed to detect any CCR6 expression on blood monocytes by FACS. Further, monocytes showed no increased migration in MCS cocultures with intestinal epithelial cells transfected by a MIP-3 adenoviral vector. In addition, monocytes did not migrate in response to MIP-3
protein in the modified Boyden chamber. Thus, we conclude that the MIP-3
-producing intestinal macrophages do not perpetuate the recruitment of blood monocytes in the mucosa.
CCR6-homozygous null mice exhibit a reduced immune response to oral Ags (61). They are viable and fertile but show underdeveloped Payers patches (62). Payers patches are 2-fold decreased in the total leukocyte number, consistent with a smaller size and a lower number of developed follicles. Impaired development could be a result of diminished recruitment of CD11b+CD11c+ myeloid DCs into the subepithelial dome (62). Derived from this mouse model, a regulatory role for MIP-3
in humoral immunity and lymphocyte homeostasis in the intestinal mucosa was postulated, but thus far no evidence for this was gained in humans.
The portion of secreted MIP-3
protein contributed by IMAC to the total amount in the intestinal mucosa is unknown. However, professional Ag-presenting and MIP-3
-secreting IMAC may serve as a contact point for memory T and B cells and subpopulations of DCs underneath the epithelial layer. The results presented here indicate that MIP-3
plays a decisive role for normal mucosal physiology in addition to the important function during inflammatory responses.
| Acknowledgments |
|---|
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This study was supported by Deutsche Forschungsgemeinschaft (Ro 1236/3-2, SFB 585, Projekt A6) and the Bundesministerium für Bildung, Wissenschaft, Forschung und Technologie Inflammatory Bowel Disease Network of Competence (Kompetenznetz) Chronisch Entzuedliche Darmerkrankungen). ![]()
2 Parts of this work were presented at Digestive Disease Weeks 2001 and 2004. ![]()
3 Address correspondence and reprint requests to Dr. Martin Hausmann, Department of Internal Medicine I, University of Regensburg, 93042 Regensburg, Germany. E-mail address: martin.hausmann{at}klinik.uni-regensburg.de ![]()
4 Abbreviations used in this paper: BDHC, benzidine dihydrochloride; DAB, 3,3'-diaminobenzidine; DAPI, 4',6-diamidino-2-phenylindole, DCs, dendritic cells; hpf, high power fields, IMAC, intestinal macrophages; LPMNCs, lamina propria mononuclear cells; MCS, multicellular spheroid; RT, reverse transcriptase. ![]()
Received for publication July 13, 2004. Accepted for publication May 10, 2005.
| References |
|---|
|
|
|---|
B is activated in macrophages and epithelial cells of inflamed intestinal mucosa. Gastroenterology 115: 357-369.[Medline]
-chemokine. Blood 89: 3315-3322.
is expressed at inflamed epithelial surfaces and is the most potent chemokine known in attracting Langerhans cell precursors. J. Exp. Med. 192: 705-718.
and is highly expressed in human dendritic cells. J. Exp. Med. 186: 837-844.
is involved in the constitutive trafficking of epidermal Langerhans cells. J. Exp. Med. 190: 1755-1768.
and MIP-3
. J. Immunol. 158: 1033-1036.[Abstract]
from lung dendritic cells. J. Exp. Med. 186: 825-835.
. J. Immunol. 162: 186-194.
/CCL20 production by human intestinal epithelium: mechanism for modulating mucosal immunity. Am. J. Physiol. Gastrointest. Liver Physiol. 280: G710-G119.
from normal and transformed cells. J. Immunol. 165: 4470-4477.
, by human mast cells in response to Pseudomonas aeruginosa. Infect. Immun. 71: 365-373.
production in LPS-stimulated neutrophils is enhanced by the chemoattractant formyl-methionyl-leucyl-phenylalanine and IFN-
through independent mechanisms. Eur. J. Immunol. 32: 3515-3524.[Medline]
/CCL20/LARC/Exodus/SCYA20 is transcriptionally upregulated by tumor necrosis factor-
via a nonstandard NF-
B site. FEBS Lett. 509: 439-445.[Medline]
/CCL20 in mucosal epithelial cells through NF-
B [correction of NK-
B]. Int. Immunol. 13: 1255-1263.
/CCL20 and CC chemokine receptor 6 in psoriasis. J. Immunol. 164: 6621-6632.
gene expression by TNF-dependent NF-
B activation. J. Immunol. 168: 5621-5628.
B, activator protein 1, and cAMP response element binding protein. J. Immunol. 169: 7026-7038.
(MIP-3
) production in normal colon and inflammatory bowel disease. Gut 51: 818-826.
/CCL20 in human B cells. Blood 96: 2338-2345.
, MIP-3
, and secondary lymphoid organ chemokine. J. Exp. Med. 191: 1381-1394.
and its ligand CCR6 in rheumatoid arthritis. Lab. Invest. 83: 579-588.[Medline]
This article has been cited by other articles:
![]() |
W. Qi, X. Chen, Y. Zhang, J. Holian, E. Mreich, R. E. Gilbert, D. J. Kelly, and C. A. Pollock High glucose induces macrophage inflammatory protein-3{alpha} in renal proximal tubule cells via a transforming growth factor-{beta}1 dependent mechanism Nephrol. Dial. Transplant., November 1, 2007; 22(11): 3147 - 3153. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. I. Fenton, S. D. Hursting, S. N. Perkins, and N. G. Hord Leptin induces an Apc genotype-associated colon epithelial cell chemokine production pattern associated with macrophage chemotaxis and activation Carcinogenesis, February 1, 2007; 28(2): 455 - 464. [Abstract] [Full Text] [PDF] |
||||
![]() |
L Santucci, M Agostini, S Bruscoli, A Mencarelli, S Ronchetti, E Ayroldi, A Morelli, M Baldoni, and C Riccardi GITR modulates innate and adaptive mucosal immunity during the development of experimental colitis in mice Gut, January 1, 2007; 56(1): 52 - 60. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |