The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Khader, S. A.
Right arrow Articles by Cooper, A. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Khader, S. A.
Right arrow Articles by Cooper, A. M.
The Journal of Immunology, 2005, 175: 788-795.
Copyright © 2005 by The American Association of Immunologists

IL-23 Compensates for the Absence of IL-12p70 and Is Essential for the IL-17 Response during Tuberculosis but Is Dispensable for Protection and Antigen-Specific IFN-{gamma} Responses if IL-12p70 Is Available1

Shabaana A. Khader*, John E. Pearl*, Kaori Sakamoto{dagger}, Leigh Gilmartin*, Guy K. Bell*, Dawn M. Jelley-Gibbs*, Nico Ghilardi{ddagger}, Fred deSauvage{ddagger} and Andrea M. Cooper2,*

* Trudeau Institute, Saranac Lake, NY 12983; {dagger} Department of Microbiology and Immunology, Veterinary Medical Center, Cornell University, Ithaca, NY 14853; and {ddagger} Genentech, South San Francisco, CA 94080


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
IL-12p70 induced IFN-{gamma} is required to control Mycobacterium tuberculosis growth; however, in the absence of IL-12p70, an IL-12p40-dependent pathway mediates induction of IFN-{gamma} and initial bacteriostatic activity. IL-23 is an IL-12p40-dependent cytokine containing an IL-12p40 subunit covalently bound to a p19 subunit that is implicated in the induction of CD4 T cells associated with autoimmunity and inflammation. We show that in IL-23 p19-deficient mice, mycobacterial growth is controlled, and there is no diminution in either the number of IFN-{gamma}-producing Ag-specific CD4 T cells or local IFN-{gamma} mRNA expression. Conversely, there is an almost total loss of both IL-17-producing Ag-specific CD4 T cells and local production of IL-17 mRNA in these mice. The absence of IL-17 does not alter expression of the antimycobacterial genes, NO synthase 2 and LRG-47, and the absence of IL-23 or IL-17, both of which are implicated in mediating inflammation, fails to substantially affect the granulomatous response to M. tuberculosis infection of the lung. Despite this redundancy, IL-23 is required to provide a moderate level of protection in the absence of IL-12p70, and this protection correlates with a requirement for IL-23 in the IL-12p70-independent induction of Ag-specific, IFN-{gamma}-producing CD4 T cells. We also show that IL-23 is required for the induction of an IL-17-producing Ag-specific phenotype in naive CD4 T cells in vitro and that absence of IL-12p70 promotes an increase in the number of IL-17-producing Ag-specific CD4 T cells both in vitro and in vivo.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Tuberculosis (Tb)3 is the most prevalent infectious disease worldwide and kills >3 million people/year (1). Cell-mediated immune responses are critical to host defense, with IL-12 induction of IFN-{gamma} production providing the primary pathway by which bacterial growth is controlled (2, 3). IL-12p70, is a heterodimeric cytokine made up of two disulfide-linked subunits, p35 and p40 (4), the biological activity of which requires its interaction with the IL-12R complex, composed of IL-12R{beta}1 and IL-12R{beta}2 (5).

In the absence of the IL-12p40 subunit, there is a profound loss of the protective immune response to mycobacteria (6, 7), which results in increased bacterial growth, reduced production of IFN-{gamma}, decreased Ag-specific inflammation, and increased mortality (7). In contrast, mice lacking the IL-12p35 subunit are less susceptible to Mycobacterium tuberculosis (Mtb) infection. Specifically, they are able to inhibit bacterial growth to a limited degree, they can generate an Ag-specific IFN-{gamma} T cell response and elaborate Ag-specific inflammation, and they can survive longer than the p40-deficient mice (7). The fact that both the p35- and p40-deficient mice lack IL-12p70, yet the p40-deficient mice are more susceptible to disease, implicates other p40-dependent molecules as mediators of protection in tuberculosis. A novel, four-{alpha} helix molecule, p19, has been identified that is structurally similar to p35 and forms a disulfide-bonded heterodimer with the p40 subunit (8); the p40/p19 heterodimer is termed IL-23.

Macrophages and dendritic cells (DC) produce IL-23 in a TLR2-dependent manner (9). Although IL-12p70 acts on naive T cells, IL-23 has been shown to induce proliferation and cytokine production in T cells with an activated phenotype (8, 10, 11). As an activator of STAT-4 and an inducer of IFN-{gamma} production in human T cells, IL-23 was initially considered a pale imitator of IL-12p70 (8, 10). In murine cultures, however, IL-23 acts on T cells via STAT-3/STAT-4 heterodimers to promote the production not of IFN-{gamma}, but of IL-17 (11, 12). This induction has been postulated to be a new axis of T cell differentiation, because neither IL-12p70 nor IL-4 is able to induce IL-17 production in T cells (13, 14, 15).

Both IL-23 and IL-17 are implicated in T cell-dependent inflammatory responses. Specifically, both IL-17- and IL-23-deficient mice have reduced Ag-specific inflammatory responses (14 , 16), whereas transgenic overexpression of IL-23 results in systemic inflammation and premature death of mice (17). Similarly, IL-17 has been implicated in T cell-dependent inflammatory responses by induction of cytokines and CXC chemokines by the interstitium (reviewed in Refs. 12 and 13). Most recently, the IL-23/IL-17 axis has been identified as the primary mediator of tissue damage in the murine experimental autoimmune encephalomyelitis model (15, 18) and in collagen-induced arthritis (19). Furthermore, the resistance of IL-23-deficient mice to collagen-induced arthritis is associated with abrogated T cell-dependent IL-17 production (19). Inflammation and granuloma formation are important components of mycobacterial disease progression; thus, IL-23 and IL-17 may be implicated in the immunopathologic response to Tb. In this regard, the relative deficiency of the Ag-specific inflammatory (7) and granulomatous (3) responses in B6.p40–/– mice compared with that in B6.p35–/– mice suggests that cellular accumulation during Tb may depend upon the IL-23/IL-17 pathway.

To determine the role of IL-23 in the immune response to Mtb, we aerogenically infected mice lacking the IL-23p19 subunit and followed disease progression by enumeration of bacteria, histological analysis, and assessment of Ag-specific CD4 T cell responses. We also determined whether and how IL-23 mediates the observed IL-12p70-independent, IL-12p40-dependent protection seen in IL-12p35-deficient mice by challenging mice lacking both IL-12p35 and IL-23p19.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Animals

C57BL/6 (B6), IL-12p35 gene-deficient (B6.p35–/–), and IL-12p40 gene-deficient (B6.p40–/–) mice were purchased from The Jackson Laboratory. Both male and female mice between the ages of 6 and 12 wk were used; experimental mice were age and sex matched. IL-23p19 gene-disrupted mice (B6.p19–/–) were generated at Genentech by Drs. F. de Sauvage and Ghilardi as previously described (14). Specifically, the entire IL-23p19-coding region was replaced with an enhanced GFP. The B6.p19–/–B6.p35–/– double-gene-deficient mouse was generated by crossing B6.p35–/– with B6.p19–/–, typing the progeny by PCR using primers available from The Jackson Laboratory, and as previously reported (14); progeny from the F3 generation were used. OT-II {alpha}{beta}TCR-transgenic male mice, which are MHC class II I-Ab restricted and specific for OVA323–339 (20), were obtained from the Trudeau Institute animal breeding facility.

Experimental infection

An initial stock of H37Rv strain of Mtb was received from Dr. R. North (Trudeau Institute) and was grown in Proskauer Beck medium containing 0.05% Tween 80 to midlog phase and frozen in 1-ml aliquots at –70°C. For aerosol infections, subject animals were infected using a Glas-Col airborne infection system as previously described in detail (21).

Bacterial load determination

Infected mice were killed by CO2 asphyxiation, and the organs were aseptically excised. Each of the organs was individually homogenized in physiological saline, and serial dilutions of the organ homogenate plated on nutrient 7H11 agar. Bacterial colony formation was counted after 3 wk of incubation at 37°C (21).

Cell preparation and culture

Lung cell suspensions were prepared by perfusing cold saline containing heparin through the heart until the lungs appeared white, whereupon they were removed and sectioned in ice-cold DMEM (Mediatech-Cellgro) using sterile razor blades. Dissected lung tissue was then incubated in DMEM containing collagenase IX (0.7 mg/ml; Sigma-Aldrich) and DNase (30 µg/ml; Sigma-Aldrich) at 37°C for 30 min (21). Digested lung tissue was gently dispersed by passage through a 70-µm pore size nylon tissue strainer (Falcon; BD Biosciences); the resultant single-cell suspension was treated with Gey’s solution to remove any residual RBC, washed twice, and counted (21). Cells prepared in this way were used for ELISPOT and flow cytometric analyses.

Detection of IFN-{gamma}- and IL-17-producing cells by ELISPOT assay

Detection of Ag-specific IFN-{gamma}- and IL-17-producing cells from infected lungs was conducted using an ELISPOT assay. In brief, cell culture plates (Multiscreen-HA; Millipore) were coated overnight at 4°C with monoclonal purified anti-mouse IFN-{gamma} (clone R4-6A2; eBioscience) or monoclonal purified anti-mouse IL-17 (clone 50101.111; R&D Systems) in PBS. The plates were then incubated with blocking solution (DMEM containing 100 U/ml penicillin, 100 U/ml streptomycin, and 10% FBS; all additives from Sigma-Aldrich). Cells from the organs of infected mice were generated as described above and seeded at an initial concentration of 1 x 105 cells/well in the Ab-coated plates; doubling dilutions of these cells were then made. Irradiated splenocytes from uninfected B6 mice were used as APCs at a concentration of 1 x 106 cells/well in all wells. The relatively immunodominant (4% of CD4+ T cells in infected lungs) Mtb ESAT-61–20 peptide (10 µg/ml) (22, 23) was used as the Ag for assays from infected mice, whereas the OVA peptide was used to stimulate cells from OT-II {alpha}{beta}TCR-transgenic mice; mouse rIL-2 (Sigma-Aldrich; 10 U/ml) was added to all wells. After 24 h of incubation in 5% CO2 at 37°C, the plates were washed, and biotinylated anti-mouse IFN-{gamma} (clone XMG1.2; eBiosciences) or biotinylated anti-mouse IL-17 Ab (clone AUS02; R&D Systems) was used to detect the captured cytokine. Spots were visualized using streptavidin-alkaline phosphatase (DakoCytomation) and 5-bromo-4-chloro-3-indoylphosphate/nitro blue tetrazolium (Sigma-Aldrich) as substrate. Spots were enumerated visually under a dissection microscope. The frequency of responding cells was determined and applied to the number of cells per sample to generate the total number of responding cells per organ. Neither cells cultured in the absence of Ag nor cells from uninfected mice produced detectable spots.

Flow cytometry

Single-cell suspensions from the lungs of infected mice were prepared as described above and cultured with anti-CD3 and anti-CD28 in the presence of monensin as previously described (7). After 4 h, cells were stained with labeled Abs specific for CD4 (clone GK1.5) and CD3 (clone 145-2C11). Cells were then fixed and permeabilized, and the presence of intracellular IFN-{gamma} was determined using clone XMG 1.2. Isotype Abs were used in parallel samples to confirm the specificity of binding. Cells were analyzed using CellQuest on a FACSCalibur, dual-laser, flow cytometer (BD Biosciences) with excitation at 488 and 633 nm. Lymphocytes were gated based on their forward and side scatter characteristics and then on CD4 and CD3, and the number of such lymphocytes per organ was determined. CD4-positive lymphocytes were analyzed for their expression of IFN-{gamma}, and the frequency was applied to the total number of CD4 T cells per organ to determine the number of IFN-{gamma}-producing cells per organ.

Real-time PCR of lungs

Lung tissue from infected and control mice was homogenized and frozen in 1 ml of TRIzol reagent (Invitrogen Life Technologies), and total RNA was extracted according to the manufacturer’s protocol. RNA samples (n = 4) from each group and each time point were treated with DNase (Ambion) and reverse transcribed using Moloney murine leukemia virus reverse transcriptase (Invitrogen Life Technologies). cDNA was then amplified using TaqMan reagents on the ABI PRISM 7700 sequence detection system (Applied Biosystems). Samples were run in the absence of the RT enzyme to confirm that signal was derived from RNA. The fold increase in signal over that derived from uninfected tissue or cells was determined using the {Delta}{Delta}ct calculation recommended by the ABI PRISM 7700 manufacturer. The primer and probe sequences for murine IL-12p40, IL-12p35 (24), IL-23p19 (7), GAPDH, IFN-{gamma}, NO synthase 2 (nos2), and TNF-{alpha} (25) were previously published. The primer and probes for LRG-47 were obtained from Applied Biosystems. The IL-17 probe/primer set was designed at the Molecular Biology Core Facility, Trudeau Institute, and had the following sequences: forward primer, CCACGTCACCCTGGACTCTC (exon 1; 185–204 bp); reverse primer, CTCCGCATTGACACAGCG (exon 2; 268–285 bp); and probe, CCTCTGTGATCTGGGAAGCTCA-GTGCC (exon 2; 233–259 bp). All primer and probes sets were determined to be 95% efficient using murine mRNA by the Molecular Biology Core Facility, Trudeau Institute.

Histology

The caudal lobe of each lung was inflated with 10% neutral buffered saline and processed routinely for light microscopy. Sections were then stained with H&E and assessed by histological techniques as described previously (26). Four to eight mice were examined for each group and at each time point. Sections were screened and scored in a blinded manner by a qualified veterinary pathologist (K. Sakamoto).

Generation of bone marrow-derived DC (BMDC)

DC were generated from the bone marrow cells of B6, B6.p19–/–, B6.p40–/– or B6.p35–/– mice as previously described (27). Briefly, cells were extracted from mouse femurs, and 1 x 106 BMDC were cultured in 10 ml of DMEM supplemented with 10% FBS (complete DMEM (cDMEM)) containing 20 ng/ml murine rGM-CSF (rmGM-CSF; PeproTech). Cells were cultured for 3 days at 37°C in 5% CO2, after which an additional 10 ml of cDMEM containing 20 ng/ml rmGM-CSF was added. On days 6 and 8, half the volume of culture medium was removed, the culture was centrifuged, and the cell pellet was added back to the same plate in 10 ml of fresh cDMEM containing 20 ng/ml rmGM-CSF. On day 10 of culture, nonadherent cells were collected by centrifugation, counted, and used as APCs. BMDC were characterized morphologically by cytospins, and >80% of the cells contained dendrites.

Infection of DC

BMDCs from 10-day cultures were placed in six-well plates, infected with Mtb H37Rv at a multiplicity of infection of 10 in antibiotic-deficient cDMEM, and incubated at 37°C in 5% CO2. At different times after infection, plates were centrifuged, and culture supernatant was taken from each well and frozen for analysis by ELISA. The remaining adherent and nonadherent cells were treated with TRIzol, RNA was extracted, and the fold induction of cytokine mRNA levels was determined by real-time PCR.

ELISA

ELISA Ab pairs were used to detect IL-12p40 and IL-12p70 (BD Pharmingen) in the culture supernatants. Recombinant cytokines were used to generate standard curves.

Naive CD4+ T cell isolation and in vitro effector generation

Naive CD4+ T cells were isolated from single-cell suspensions of spleens and lymph nodes of OT-II {alpha}{beta}TCR-transgenic mice using magnetic CD4+ beads (clone GK1.5; Miltenyi Biotec) on an AutoMACS machine following the manufacturer’s instructions. We routinely obtained >95% CD4+ T cells. Mtb-infected BMDCs from B6, B6.p35–/–, B6.p19–/–, and B6.p40–/– mice were generated as described above. Naive OT-II CD4+ T cells (3 x 105 cells/ml) were cultured with infected DCs (3 x 105 cells/ml), the antigenic peptide OVA323–339 (5 µM), and IL-2 (10 ng/ml) for 72 h at 37°C in 5% CO2. The primed cells (5 x 105 cells/ml) were then washed, counted, and restimulated in the presence of irradiated B6 splenocytes (5 x 105 cells/ml) and OVA323–339 peptide (5 µM) for an additional 72 h at 37°C in 5% CO2. Lymphocytes were again washed and counted, and the frequency of OVA323–339-specific, IFN-{gamma}- or IL-17-producing CD4+ T cells was determined by ELISPOT.

Statistical analysis

Differences between the means of experimental groups were analyzed using Student’s t test. Differences were considered significant at p ≤ 0.05.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Mice lacking IL-23p19 control bacterial growth with comparable kinetics as C57BL/6 mice when infected with a low dose aerosol of Mtb

The potential for IL-23 to mediate a protective immune response to Tb was suggested by the induction of IL-23p19 in Mtb-infected lungs (7), the differential susceptibility of B6.p35–/– and B6.p40–/– mice to Tb (7), and the published role of IL-23 in mediating inflammatory responses (14, 16, 17). To determine whether IL-23 is intrinsically protective, the bacterial burden in B6 and B6.p19–/– mice was compared over time. Surprisingly, there were no significant differences in the bacterial burden of any of the organs screened, apart from day 140 in the spleen, where a significantly higher bacterial burden was found in the absence of IL-23p19 (Fig 1). The absence of substantial differences in the bacterial burden suggests that neither IL-23 nor any other p19-dependent molecule is required to mediate either initial cessation or long-term control of mycobacterial growth in the murine model.



View larger version (27K):
[in this window]
[in a new window]
 
FIGURE 1. C57BL/6 (•) and B6.p19–/– ({circ}) mice were infected via the aerosol route with ~100 Mtb H37Rv bacteria, and the bacterial burden was determined in target organs over time. The data points represent the mean bacterial burden for between 4 and 12 animals over three separate experiments. **, p ≤ 0.005, by Student’s t test. DLN, draining lymph node/mediastinal node.

 
Mice lacking IL-23p19 produce comparable levels of IFN-{gamma} in the lung as C57BL/6 mice

The ability of the B6.p19–/– mice to control bacterial burden was surprising, because IL-23 was initially identified for its role in proliferation and IFN-{gamma} production by activated CD4+ T cells (8). To determine whether the absence of IL-23 affected the Th1 response to Tb, we compared this response in Mtb-infected B6 and B6.p19–/– mice. In light of the bacterial numbers, we were not surprised to find comparable numbers of CD4+ T cells specific for the immunodominant mycobacterial Ag, ESAT61–20 (23), in the lungs of both groups of mice throughout 140 days of infection (Fig. 2a). We also found the total number of CD4+ T cells capable of expressing IFN-{gamma} in the lung after a polyclonal TCR stimulus (anti-CD3/anti-CD28) to be equivalent between the two groups (Fig. 2b). Furthermore, in confirmation of a failure of IL-23 to affect the total IFN-{gamma} response in the lung, we demonstrate in this study that equivalent levels of IFN-{gamma} mRNA were detectable in the lungs of both groups throughout the infection (Fig. 2c). This apparent inability of the absence of IL-23 to compromise the IFN-{gamma} response in the lung suggests that IL-23 is dispensable for this component of the protective response to Tb.



View larger version (18K):
[in this window]
[in a new window]
 
FIGURE 2. C57BL/6 (•) and B6.p19–/– ({circ}) mice were infected, and the lymphocytes were isolated from the lung at specific time points after infection. Cells were cultured with irradiated feeder cells and Mtb ESAT1–20 peptide for 24 h, and the number of IFN-{gamma}-producing cells was determined by ELISPOT (a). The data points represent the mean and SD for four animals for each time point. The total number of CD4+ T cells in the lungs of C57BL/6 ({blacksquare}) and B6.p19–/– ({square}) mice capable of expressing IFN-{gamma} after a TCR stimulus (anti-CD3/anti-CD28) were determined by intracellular staining and analysis by flow cytometry (b). The bars represent the mean value for four mice ± SD, and one experiment representative of three is shown. Lung tissue from C57BL/6 (•) and B6.p19–/– ({circ}) mice was harvested and processed to extract RNA. The presence of IFN-{gamma} mRNA (c) was determined by real-time PCR, and the log10 fold increase was determined for three infected mice vs four noninfected mice. The data points represent the mean and SD for three mice for each time point, and one experiment, representative of two, is shown.

 
Mice lacking IL-23p19 produce significantly lower levels of IL-17 in the lung

As discussed above, IL-23 has been implicated in the induction of an IL-17-producing phenotype in CD4+ T cells (11, 12, 15). To determine first whether there is an IL-17 response to Tb and second whether IL-23 affects this response, we compared the number of Ag-specific, IL-17-producing CD4+ T cells produced in the presence and the absence of IL-23. We show in this study that IL-17-producing Ag-specific CD4+ T cells are induced during pulmonary infection with Mtb (Fig. 3a), and that the number of these cells was significantly reduced in B6.p19–/– mice compared with B6 mice throughout the infection (Fig. 3a). In support of a global inhibition of IL-17 production within the IL-23-deficient infected lung, we also found that although B6 mice expressed IL-17 mRNA early upon infection and maintained this expression throughout infection, B6.p19–/– mice failed to significantly express IL-17 mRNA throughout the infection (Fig. 3b).



View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 3. C57BL/6 (•) and B6.p19–/– ({circ}) mice were infected, and lymphocytes were isolated from the lung at specific time points after infection. Cells were cultured with irradiated feeder cells and Mtb ESAT1–20 peptide for 24 h, and the number of IL-17-producing cells was determined by ELISPOT (a). The data points represent the mean and SD for four animals for each time point. Lung tissue from C57BL/6 (•) and B6.p19–/– ({circ}) mice was harvested and processed to extract RNA. The presence of IL-17 mRNA (b) was determined by real-time PCR, and the log10 fold increase was determined for three infected mice vs four noninfected mice. The data points represent the mean and SD for three mice for each time point, and one experiment, representative of two, is shown. **, p ≤ 0.005, by Student’s t test.

 
Absence of IL-23 does not affect induction of the antimycobacterial agents NOS2 and LRG-47

Having identified significant reductions in the levels of IL-17-producing, Ag-specific CD4+ T cells and total IL-17 mRNA in the Mtb-infected lung, we wanted to determine what effect this had on the induction of specific genes in the lung. Two known antimycobacterial agents, the inducible NOS gene (nos2) (28) and the LRG-47 gene (29) (a member of the 47-kDa GTPase family involved in maturation of phagosomes), were both induced in the lungs upon infection. Induction was comparable between B6 and B6.p19–/– mice throughout infection (Fig. 4). These observations support those made above that the IFN-{gamma}-dependent antimycobacterial immune response was not compromised in the absence of IL-23. As previously reported, the IL-23p19 subunit was induced in the lungs of infected mice (data not shown). Both the p35 and p40 subunits of IL-12 were also induced during infection, and the levels of induction were not affected by the absence of IL-23 or IL-17 (data not shown).



View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 4. C57BL/6 (•) and B6.p19–/– ({circ}) mice were infected as described in Fig. 1, and at specific times after infection, lung tissue was harvested and processed to extract RNA. The presence of specific mRNA was determined by real-time PCR, and the log10 fold-increase in mRNA was determined for three infected mice vs four noninfected mice. The data points represent the mean and SD for three mice for each time point. One representative experiment of two is shown.

 
Absence of IL-23 moderately affects the immunopathology of the Mtb-infected lung

As discussed above, both IL-23 and IL-17 are potent inducers/mediators of inflammatory responses (30, 31, 32). In the absence of IL-23 and IL-17, the difference in the granulomatous response to Mtb was not dramatic. As shown in Table I, the absence of IL-23 and IL-17 resulted in the more rapid appearance of moderate inflammation, with severe inflammation as an end point. This inflammation corresponded with a minor increase in the consolidation of the IL-23-deficient lung response and with a slightly reduced deposition of fibrin. IL-17 has been implicated in neutrophil recruitment; however, there was no difference in the accumulation of granulocytes between the two groups of mice (data not shown).


View this table:
[in this window]
[in a new window]
 
Table I. B6.p19–/– mice exhibit slightly enhanced inflammatory responses in the lung following Mtb infection

 
IL-23 is required for protection against Mtb in B6.p35–/– mice

Despite the apparent failure of IL-23 to contribute to the protective response seen in mice capable of making IL-12p70, we were still interested in whether this cytokine contributed to the IL-12p70-independent, IL-12p40-dependent protection seen in B6.p35–/– mice (7). To determine whether IL-23 contributed to this protection, we generated mice lacking both IL-23p19 and IL-12p35 and infected them aerogenically with Mtb. We show in this study that in the absence of IL-23, mice lacking IL-12p35 are unable to express the moderate level of protection seen in the presence of IL-23. Specifically, there was a significant difference in the bacterial burden in the lung (Fig. 5a), liver (Fig. 5c), and draining lymph nodes (Fig. 5d) between B6.p35–/– mice and B6.p19–/–p35–/– mice; the difference in bacterial burden in the spleen approached significance (Fig. 5b). As previously reported (7) B6.p40–/– mice supported significantly more bacterial growth than did B6.p35–/– mice in all organs (Fig. 5).



View larger version (27K):
[in this window]
[in a new window]
 
FIGURE 5. C57BL/6 and gene-deficient mice were infected via the aerosol route with ~100 Mtb H37Rv bacteria, and the bacterial burden was determined in target organs on day 30. The data points represent the mean bacterial burden for four animals. *, p ≤ 0.05; **, p ≤ 0.005; ***, p ≤ 0.0005 (by Student’s t test). DLN, draining lymph node/mediastinal node.

 
IL-23 is required for the induction of high levels of LRG-47 and NOS2 mRNA in Mtb-infected B6.p35–/– mice

To examine how the absence of IL-23 affects the immune response of Mtb-infected B6.p35–/– mice, we compared the induction of mRNA within the lungs of Mtb-infected, gene-deficient mice. We show in this study that although B6.p35–/– mice exhibited similar levels of mRNA for the protective molecules NOS2 (Fig. 6a) and LRG47 (Fig. 6b) to the B6 mice (Fig. 6), the B6.p19–/–p35–/– mice exhibited similar mRNA levels as B6.p40–/– mice; these levels were significantly lower than those in both B6 and B6.p35–/– mice. We measured other cytokines, such as IL-10 and IL-18, and although these cytokines were induced upon infection, the expression level was not altered by the absence of IL-12p40, IL-12p70, or IL-23 (data not shown).



View larger version (19K):
[in this window]
[in a new window]
 
FIGURE 6. C57BL/6 and gene-deficient mice were infected as described in Fig. 5, and lung tissue was harvested and processed to extract RNA. The presence of specific mRNA was determined by real-time PCR, and the log10 fold increase in mRNA was determined for four infected mice vs four noninfected mice. The data points represent the mean and SD for four mice. *, p ≤ 0.05; **, p ≤ 0.005 (by Student’s t test).

 
IL-23 is required for the induction of Mtb-specific IFN-{gamma}- and IL-17-producing CD4 T cells in B6.p35–/– mice

To determine whether IL-23 was acting to induce Th1 cells during Mtb infection in B6.p35–/– mice, we used the ESAT-61–20 peptide-based ELISPOT to compare the numbers of IFN-{gamma}-producing CD4+ T cells in the lungs of infected, gene-deficient mice. We show in this study that although B6.p35–/– mice can generate a small, but measurable, Ag-specific Th1 response to Mtb, B6.p19–/–p35–/– mice generate a significantly reduced response, which is not different from that seen in B6.p40–/– mice (Fig. 7a). We also wanted to determine the effect of IL-12p70 on the development of the Mtb-specific, IL-17-producing CD4+ T cells. We show in this study, using the ESAT-61–20 peptide-driven ELISPOT, that the number of these cells is significantly increased in the lungs of Mtb-infected B6.p35–/– mice compared with B6 mice (Fig. 7b) and that this response is ablated in the B6.p19–/–, B6.p40–/–, and B6.p19–/–p35–/– mice.



View larger version (16K):
[in this window]
[in a new window]
 
FIGURE 7. C57BL/6 and gene-deficient mice were infected as described in Fig. 5, and the lymphocytes were isolated from the lung. Cells were cultured with irradiated feeder cells and Mtb ESAT1–20 peptide for 24 h, and the numbers of IFN-{gamma}-producing cells (a) and IL-17-producing cells (b) were determined by ELISPOT. The data points represent the mean and SD for four animals. *, p ≤ 0.05; **, p ≤ 0.005; ***, p ≤ 0.0005 (by Student’s t test).

 
Mtb-infected DC require IL-23 to drive differentiation of IL-17-producing T cells, and IL-12p70 reduces the efficiency of this polarization

We show that in the absence of IL-23, the frequency and total number of mycobacteria-specific, IL-17-producing CD4+ T cells are profoundly reduced (Figs. 3a and 7b). Although the role of IL-23 in the expression of an IL-17-producing phenotype has been previously documented (11, 14, 18), in these publications IL-23 was relatively inefficient at driving naive CD4 T cells to an IL-17-producing phenotype. The in vivo data (Figs. 3a and 7b) suggest that Mtb infection is a potent inducer of IL-17-producing CD4+ T cells, and we therefore determined whether Mtb was able to drive DC to a state that would efficiently induce IL-17-producing, Ag-specific CD4+ T cells. First, we determined that IL-12p40 (Fig. 8a), IL-12p35 (Fig. 8b), and IL-23p19 (Fig. 8c) mRNA were all induced during infection of DC with live Mtb, and that this expression was maintained at high levels up to 48 h (Fig. 8). Both IL-12p40 and IL-12p70 protein were induced to detectable levels from 4 through 48 h (500–3500 pg/ml IL-12p40 and 100–300 pg/ml IL-12p70). We then used infected C57BL/6 and gene-deficient DC to prime naive CD4+ TCR-transgenic T cells (OT-II) in the presence of their cognate Ag (OVA323–339). This priming was designed to determine the ability of Mtb-matured DC to induce naive CD4+ T cells to an IL-17-producing phenotype as well as the role of IL-23 in that induction. In this study we show that when CD4+ T cells are primed in the presence of Mtb-infected DC, a substantial number of cells express an IL-17-producing phenotype after restimulation with Ag in the presence of irradiated uninfected splenocytes (Fig. 8d). If these cells are primed in the absence of IL-23, however (i.e., B6.p19–/– DC), there is a significant drop in the number of IL-17-producing cells despite the fact that restimulation is with IL-23-competent splenocytes (Fig. 8d); the number of IFN-{gamma}-producing cells is unaffected (Fig. 8e). IL-12p70 has been shown to limit the production of IL-17 in culture (11); thus, we determined how the absence of IL-12p70 affected the generation of IL-17-prodcuing CD4+ T cells from naive T cells. We show in this study that when naive CD4+ T cells are primed in the absence of IL-12p70 (i.e., by B6.p35–/– DC), a significantly increased number become IL-17-producing cells compared with cells primed in the presence of IL-12p70 (Fig. 8d). In the absence of IL-12p40, there was very limited induction of IL-17-producing CD4 T cells (Fig. 8d).



View larger version (29K):
[in this window]
[in a new window]
 
FIGURE 8. The induction of mRNA for IL-12p40 (a), IL-12p35 (b), and IL-23p19 (c) was measured in in vitro cultured BMDCs after infection with Mtb bacteria. The data points represent the log10 fold increase of the specific mRNA compared with uninfected DCs. The data points represent the mean and SD for three independent BMDC preparations. Activation and polarization of naive OT-II TCR-transgenic CD4+ T cells were conducted in the presence of their cognate Ag and Mtb-infected BMDCs from C57BL/6 and gene-deficient mice. Cells were then restimulated in the presence of OVA323–339 and irradiated splenocytes from C57BL/6 mice, and the frequency of IL-17-producing (d) and IFN-{gamma}-producing (e) cells was determined by ELISPOT. The data points show the mean and SD for three independent culture samples. One representative experiment of two is shown. *, p ≤ 0.05; **, p ≤ 0.005 (by Student’s t test).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
We show in this study for the first time that the absence of the IL-23 p19 subunit has little effect on disease progression during both early and chronic Mtb infection. We also show that in the absence of IL-23, Ag-specific IFN-{gamma} responses are not compromised and are able to adequately induce antimycobacterial activity. The absence of IL-23 does result in a profound reduction in the frequency and number of Ag-specific, IL-17-producing CD4+ T cells and in local IL-17 mRNA production in the lung; however, this fails to substantially alter the immunopathologic response to Mtb in the lung. This limited phenotype suggests that although the IL-23/IL-17 axis of T cell activation is induced in tuberculosis, it does not mediate antibacterial or profound inflammatory elements of the primary host response. In contrast, however, we demonstrate that when IL-12p70 is absent, as is the case in mice lacking the IL-12p35 gene, then IL-23 is required for the generation of Ag-specific, IFN-{gamma}-producing CD4+ T cells, induction of anti-mycobacterial genes, and control of bacterial growth. The increased numbers of Ag-specific, IL-17-producing CD4+ T cells seen both in vitro and in vivo suggest that IL-12p70 regulates the activity of IL-23 during murine tuberculosis.

The fact that IL-23 deficiency does not adversely affect the Ag-specific IFN-{gamma} response during tuberculosis is not surprising based on the growing literature showing that the primary function of IL-23 is the induction of Ag-specific CD4+ T cells that produce IL-17, IL-6, and TNF (11, 14, 15, 19). IL-23 was initially identified as being able to induce IFN-{gamma} production in already activated human CD4+ T cells (8); however, the ability of IL-23 to induce IFN-{gamma}-producing cells in the mouse is less clear. Our previous data demonstrating that IL-12p35-deficient mice were able to generate an Ag-specific IFN-{gamma} response to Mtb (7) implicated IL-23 in the induction of this response, and indeed, we show in this study that in the absence of IL-12p70, IL-23 is essential for the generation of IFN-{gamma}-producing CD4+ T cells. That this compensatory response is unable to control experimental infection (7) indicates that the IL-23-induced IFN-{gamma} response is not as potent as the IL-12p70-induced response, and our data demonstrate that the total number of Ag-specific CD4 T cells is significantly reduced when only IL-23 is available. A similar ability of IL-23 to compensate for the absence of IL-12p70 has been reported for the Toxoplasma model, in which exogenous IL-23 was able to improve control of pathogen burden in IL-12p40-deficient mice (33). That a compensatory IL-23 response may protect humans from Tb is suggested by the fact that although there are extensive reports of increased susceptibility to mycobacterial infection in humans lacking IL-12p40 or IL-12R{beta}1 (34, 35, 36, 37, 38), there are no reports of susceptibility in humans lacking IL-12p35. The facts that mycobacterial stimulation of human macrophages results in IL-23 production (39) and that IL-23 has been shown to augment IFN-{gamma} production in human T cells (8, 40) also support the potential for IL-23 to mediate protection in humans.

The essential requirement for IL-23 in the induction of the Ag-specific, IL-17-producing CD4+ T cell response to Mtb allowed us to determine the effect of IL-17 on the mycobacterial granuloma. We show in this study that in the absence of IL-17, the development of the mycobacterial mononuclear granuloma is not substantially altered. This failure is particularly surprising in view of the reported role of IL-17 as a mediator of inflammation in asthma (41), pneumonia (12), airway hypersensitivity (16), and neutrophil recruitment to the lung (30, 31, 32). It is also surprising because inflammatory responses are compromised in the absence of IL-12p40 (7), IL-23 (14), and IL-17 (16), but not in the absence of IFN-{gamma} (42) or IL-12p35 (7, 14). It would therefore appear that although IL-17 is induced in response to Mtb infection, it plays little role in initial granuloma formation and long-term maintenance of the mononuclear nature of the granuloma. It may be the case that prolonged granuloma integrity requires IL-17, and we are investigating this possibility.

Although the ability of IL-17-producing CD4+ T cells to modulate the primary control of Mtb infection in the lung is limited, a high number of such cells is induced during Mtb infection. The majority of the literature supports the ability of IL-23 to augment the IL-17 production of already activated cells, with only a small proportion of naive cells progressing to an IL-17-producing phenotype in the presence of IL-23 (11, 15). In contrast, we show in this study that substantial numbers of naive TCR-transgenic T cells activated in the presence of cognate Ag and Mtb-activated DC, develop an IL-17-producing phenotype and that this is dependent upon IL-23. These data suggest that Mtb-activated DC are potent inducers of the IL-17-producing phenotype in naive CD4 T cells. It is intriguing to speculate that this ability to induce IL-17-producing cells combined with the dependence of experimental arthritis on IL-23 (19) is the basis for the association between mycobacterial exposure and arthritis (43, 44, 45).

The observed increase in the number of Ag-specific, IL-17-producing CD4+ T cells both in vivo (Fig. 7) and in vitro (Fig. 8) in the absence of IL-12p35 corresponds with the reported ability of IL-12p70 to limit IL-17 production in vitro (11) and the fact that in the absence of IL-12p70 (19) or IL-12R{beta}2 signaling (46) there is an increase in IL-17-producing T cells. Our data clearly show that the absence of IL-12p70 during the initial activation of naive cells allows for a significant increase in the number of IL-17-producing CD4+ T cells, suggesting that the relative availability of IL-12p70 and IL-23 during the initiation of T cell activation will determine the eventual effector phenotype of the T cell. This ability of IL-12p70 to limit the activity of IL-23 may serve to mask the protective role of IL-23 in Mtb-infected C57BL/6 mice.

In conclusion, we show in this study for the first time that in the absence of IL-12p35, IL-23 is able to generate a moderately protective response to Mtb, and that this response is associated with the induction of IFN-{gamma}-producing CD4+ T cells and the expression of IFN-{gamma}-dependent, antimycobacterial genes. In contrast, although IL-23 is required for the induction of Ag-specific, IL-17-producing CD4+ T cells, the absence of these cells fails to modulate disease progression during primary Mtb infection.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by National Institutes of Health Grant AI46530; the New York Community Trust-Heiser Fund Fellowship (to S.A.K.), and the Trudeau Institute. Back

2 Address correspondence and reprint requests to Dr. Andrea M. Cooper, Trudeau Institute, 154 Algonquin Avenue, Saranac Lake, NY 12983. E-mail address: acooper{at}trudeauinstitute.org Back

3 Abbreviations used in this paper: Tb, tuberculosis; DC, dendritic cell; BMDC, bone marrow-derived DC; cDMEM, complete DMEM; Mtb, Mycobacterium tuberculosis; NOS2, NO synthase 2; rmGM-CSF, murine rGM-CSF; ESAT, 6 kDa early secreted antigenic target. Back

Received for publication August 24, 2004. Accepted for publication May 12, 2005.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Dye, C., S. Scheele, P. Dolin, V. Pathania, M. C. Raviglione. 1999. Consensus statement, global burden of tuberculosis: estimated incidence, prevalence and mortality by country. J. Am. Med. Assoc. 282: 677-686.[Abstract/Free Full Text]
  2. Cooper, A. M., A. D. Roberts, E. R. Rhoades, J. E. Callahan, D. M. Getzy, I. M. Orme. 1995. The role of interleukin-12 in acquired immunity to Mycobacterium tuberculosis infection. Immunology 84: 423-432.[Medline]
  3. Cooper, A. M., J. Magram, J. Ferrante, I. M. Orme. 1997. IL-12 is crucial to the development of protective immunity in mice intravenously infected with Mycobacterium tuberculosis. J. Exp. Med. 186: 39-45.[Abstract/Free Full Text]
  4. Kobayashi, M., L. Fitz, M. Ryan, R. Hewick, S. Clark, S. Chan, R. Loudon, F. Sherman, B. Perussia, G. Trinchieri. 1989. Identification and purification of natural killer cell stimulatory factor (NKSF), a cytokine with multiple biologic effects on human lymphocytes. J. Exp. Med. 170: 827-845.[Abstract/Free Full Text]
  5. Presky, D. H., H. Yang, L. J. Minetti, A. O. Chua, N. Nabavi, C. Y. Wu, M. K. Gately, U. Gubler. 1996. A functional interleukin 12 receptor complex is composed of two {beta}-type cytokine receptor subunits. Proc. Natl. Acad. Sci. USA 93: 14002-14007.[Abstract/Free Full Text]
  6. Holscher, C., R. Atkinson, B. Arendse, N. Brown, E. Myburgh, G. Alber, F. Brombacher. 2001. A protective and agonistic function of IL-12p40 in mycobacterial infection. J. Immunol. 167: 6957-6966.[Abstract/Free Full Text]
  7. Cooper, A. M., A. Kipnis, J. Turner, J. Magram, J. Ferrante, I. M. Orme. 2002. Mice lacking bioactive IL-12 can generate protective, antigen-specific cellular responses to mycobacterial infection only if the IL-12 p40 subunit is present. J. Immunol. 168: 1322-1327.[Abstract/Free Full Text]
  8. Oppmann, B., R. Lesley, B. Blom, J. C. Timans, Y. Xu, B. Hunte, F. Vega, N. Yu, J. Wang, K. Singh, et al 2000. Novel p19 protein engages IL-12p40 to form a cytokine, IL-23, with biological activities similar as well as distinct from IL-12. Immunity 13: 715-725.[Medline]
  9. Re, F., J. Strominger. 2001. Toll-like receptor 2 (TLR2) and TLR4 differentially activate human dendritic cells. J. Biol. Chem. 276: 37692-37699.[Abstract/Free Full Text]
  10. Parham, C., M. Chirica, J. Timans, E. Vaisberg, M. Travis, J. Cheung, S. Pflanz, R. Zhang, K. P. Singh, F. Vega, et al 2002. A receptor for the heterodimeric cytokine IL-23 is composed of IL-12R{beta}1 and a novel cytokine receptor subunit, IL-23R. J. Immunol. 168: 5699-5708.[Abstract/Free Full Text]
  11. Aggarwal, S., N. Ghilardi, M. Xie, F. J. de Sauvage, A. L. Gurney. 2002. Interleukin-23 promotes a distinct CD4+ T cell activation state characterised by the production of IL-17. J. Biol. Chem. 278: 190-1914.
  12. Happel, K. I., M. Zheng, E. Young, L. J. Quinton, E. Lockhart, A. J. Ramsay, J. E. Shellito, J. R. Schurr, G. J. Bagby, S. Nelson, et al 2003. Cutting edge: roles of Toll-like receptor 4 and IL-23 in IL-17 expression in response to Klebsiella pneumoniae infection. J. Immunol. 170: 4432-4436.[Abstract/Free Full Text]
  13. Aggarwal, S., A. L. Gurney. 2002. IL-17: prototype member of an emerging cytokine family. J. Leukocyte Biol. 71: 1-8.[Abstract/Free Full Text]
  14. Ghilardi, N., N. Kljavin, Q. Chen, S. Lucas, A. L. Gurney, F. J. de Sauvage. 2004. Compromised humoral and delayed-type hypersensitivity responses in IL-23 deficient mice. J. Immunol. 172: 2827-2833.[Abstract/Free Full Text]
  15. Langrish, C., Y. Chen, W. Blumenschein, J. Mattson, B. Basham, J. Sedgwick, T. McClanahan, R. Kastelein, D. Cua. 2005. IL-23 drives a pathogenic T cell population that induces autoimmune inflammation. J. Exp. Med. 201: 233-240.[Abstract/Free Full Text]
  16. Nakae, S., Y. Komiyama, A. Nambu, K. Sudo, M. Iwase, I. Homma, K. Sekikawa, M. Asano, Y. Iwakura. 2002. Antigen-specific T cell sensitization is impaired in IL-17-deficient mice, causing suppression of allergic cellular and humoral responses. Immunity 17: 375-387.[Medline]
  17. Wiekowski, M. T., M. W. Leach, E. W. Evans, L. Sullivan, S. C. Chen, G. Vassileva, J. F. Bazan, D. M. Gorman, R. A. Kastelein, S. Narula, et al 2001. Ubiquitous transgenic expression of the IL-23 subunit p19 induces multiorgan inflammation, runting, infertility, and premature death. J. Immunol. 166: 7563-7570.[Abstract/Free Full Text]
  18. Cua, D. J., J. Sherlock, Y. Chen, C. A. Murphy, B. Joyce, B. Seymour, L. Lucian, W. To, S. Kwan, T. Churakova, et al 2003. Interleukin-23 rather than interleukin-12 is the critical cytokine for autoimmune inflammation of the brain. Nature 421: 744-748.[Medline]
  19. Murphy, C. A., C. L. Langrish, Y. Chen, W. Blumenschein, T. McClanahan, R. A. Kastelein, J. D. Sedgwick, D. J. Cua. 2003. Divergent pro- and antiinflammatory roles for IL-23 and IL-12 in joint autoimmune inflammation. J. Exp. Med. 198: 1951-1957.[Abstract/Free Full Text]
  20. Barnden, M. J., J. Allison, W. R. Heath, F. R. Carbone. 1998. Defective TCR expression in transgenic mice constructed using cDNA based {alpha} and {beta} chain genes under the control of heterologous regulatory elements. Immunol. Cell Biol. 76: 34-40.[Medline]
  21. Roberts, A., A. Cooper, J. Belisle, J. Turner, M. Gonzalez-Juarerro, I. Orme. 2002. Murine models of tuberculosis. S. Kaufmann, and D. Kabelitz, eds. In Methods in Microbiology Vol. 32: 433-462 Academic Press, London. .
  22. Andersen, P.. 1997. Host responses and antigens involved in protective immunity to Mycobacterium tuberculosis. Scand. J. Immunol. 45: 115-131.[Medline]
  23. Winslow, G., A. Roberts, M. Blackman, D. Woodland. 2003. Persistence and turnover of antigen-specific CD4 T cells during chronic tuberculosis infection in the mouse. J. Immunol. 170: 2046-2052.[Abstract/Free Full Text]
  24. Overbergh, L., D. Valckx, M. Waer, C. Mathieu. 1999. Quantification of murine cytokine mRNAs using real time quantitative reverse transcription PCR. Cytokine 11: 305-312.[Medline]
  25. Johnson, L. L., K. Betggren, F. M. Szaba, W. Chen, S. T. Smiley. 2003. Fibrin-mediated protection against infection-stimulated immunopathology. J. Exp. Med. 197: 801-806.[Abstract/Free Full Text]
  26. Rhoades, E. R., A. A. Frank, I. M. Orme. 1997. Progression of chronic pulmonary tuberculosis in mice aerogenically infected with virulent Mycobacterium tuberculosis. Tuberc. Lung Dis. 78: 57-66.[Medline]
  27. Lutz, M. B., N. Kukutsch, A. L. Ogilvie, S. Rossner, F. Koch, N. Romani, G. Schuler. 1999. An advanced culture method for generating large quantities of highly pure dendritic cells from mouse bone marrow. J. Immunol. Methods 223: 77-92.[Medline]
  28. MacMicking, J. D., R. J. North, R. LaCourse, J. Mudgett, S. K. Shah, C.F. Nathan. 1997. Indentification of NOS2 as a protective locus against tuberculosis. Proc. Natl. Acad. Sci. USA 94: 5243-5248.[Abstract/Free Full Text]
  29. MacMicking, J., G. Taylor, J. McKinney. 2003. Immune control of tuberculosis by IFN-{gamma}-inducible LRG-47. Science 302: 654-659.[Abstract/Free Full Text]
  30. Linden, A., H. Hoshino, M. Lann. 2000. Airway neutrophils and interleukin-17. Eur. Respir. J. 15: 973-977.[Abstract]
  31. Miyamoto, M., O. Prause, M. Sjostrand, M. Laan, J. Lotvall, A. Linden. 2003. Endogenous IL-17 as a mediator of neutrophil recruitment caused by endotoxin exposure in mouse airways. J. Immunol. 170: 4665-4672.[Abstract/Free Full Text]
  32. Ye, P., F. H. Rodriguez, S. Kanaly, K. L. Stocking, J. Schurr, P. Schwarzenberger, P. Oliver, W. Huang, P. Zhang, J. Zhang, et al 2001. Requirement of interleukin-17 receptor signalling for lung CXC chemokine and granulocyte colony-stimulating factor expression, neutrophil recruitment, and host defense. J. Exp. Med. 194: 519-527.[Abstract/Free Full Text]
  33. Lieberman, L. A., F. Cardillo, A. M. Owyang, D. M. Rennick, D. J. Cua, R. A. Kastelein, C. A. Hunter. 2004. IL-23 provides a limited mechanism of resistance to acute toxoplasmosis in the absence of IL-12. J. Immunol. 173: 1887-1893.[Abstract/Free Full Text]
  34. Altare, F., A. Durandy, D. Lammas, J. F. Emile, S. Lamhamedi, F. Le Deist, P. Drysdale, E. Jouanguy, R. Doffinger, F. Bernaudin, et al 1998. Impairment of mycobacterial immunity in human interleukin-12 receptor deficiency. Science 280: 1432-1435.[Abstract/Free Full Text]
  35. Doffinger, R., S. Dupius, C. Picard, C. Fieschi, J. Feinberg, G. Barcenas-Morales, J.-L. Casanova. 2001. Inherited disorders of IL-12 and IFN-{gamma} mediated immunity: a molecular genetics update. Mol. Immunol. 38: 903-909.
  36. Jouanguy, E., R. Doffinger, S. Dupuis, A. Pallier, F. Altare, J. L. Casanova. 1999. IL-12 and IFN-{gamma} in host defense against mycobacteria and salmonella in mice and men. Curr. Opin. Immunol. 11: 346-351.[Medline]
  37. Lammas, D. A., J. L. Casanova, D. S. Kumararatne. 2000. Clinical consequences of defects in the IL-12-dependent interferon-{gamma} (IFN-{gamma}) pathway. Clin. Exp. Immunol. 121: 417-425.[Medline]
  38. Ottenhof, T., D. Kumararante, J. Casanova. 1998. Novel human immunodeficiencies reveal the essential role of type-1 cytokines in immunity to intracellular bacteria. Immunol. Today 19: 491-494.[Medline]
  39. Verreck, F. A. W., T. de Boer, D. M. L. Langenberg, M. A. Hoeve, M. Kramer, E. Vaisberg, R. Kastelein, A. Kolk, R. de Waal-Malefyt, T. H. M. Ottenhoff. 2004. Human IL-23-producing type 1 macrophages promote but IL-10-producing type 2 macrophages subvert immunity to (myco)bacteria. Proc. Natl. Acad. Sci. USA 101: 4560-4565.[Abstract/Free Full Text]
  40. Hoeve, M. A., T. de Boer, D. M. L. Lagenberg, O. Sanal, F. A. W. Verreck, T. H. M. Ottenhoff. 2003. IL-12 receptor deficiency revisited: IL-23-mediated signaling is also impaired in human genetic IL-12 receptor {beta}1 deficiency. Eur. J. Immunol. 33: 3393-3397.[Medline]
  41. Hellings, P. W., A. Kasran, Z. Liu, P. Vandekerckhove, A. Wuyts, L. Overbergh, C. Mathieu, J. L. Ceuppens. 2003. Interleukin-17 orchestrates the granulocyte influx into airways after allergen inhalation in a mouse model of allergic asthma. Am. J. Respir. Cell Mol. Biol. 28: 42-50.[Abstract/Free Full Text]
  42. Pearl, J. E., B. M. Saunders, S. Ehlers, I. M. Orme, A. M. Cooper. 2001. Inflammation and lymphocyte activation during mycobacterial infection in the interferon-{gamma}-deficient mouse. Cell. Immunol. 211: 43-50.[Medline]
  43. Moudgi, L. K.. 1998. Diversification of response to hsp65 during the course of autoimmune arthritis is regulatory rather than pathogenic. Immunol. Rev. 164: 175-184.[Medline]
  44. Harrington, J.. 1998. Mycobacterial and fungal arthritis. Curr. Opin. Rheumatol. 10: 335-338.[Medline]
  45. McGill, P.. 2003. Geographically specific infections and arthritis, including rheumatic syndromes associated with certain fungi and parasites, Brucella species and Mycobacterium leprae. Best Pract. Res. Clin. Rheumatol. 17: 289-292.[Medline]
  46. Zhang, G., B. Gran, S. Yu, J. Li, I. Siglienti, X. Chen, M. Kamoun, A. Rostami. 2003. Induction of experimental autoimmune encephalomyelitis in IL-12 receptor-{beta}2 deficient mice: IL-12 responsiveness is not required in the pathogenesis of inflammatory demyelination in the central nervous system. J. Immunol. 170: 2153-2160.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Infect. Immun.Home page
D. Carlos, C. Fremond, A. Samarina, V. Vasseur, I. Maillet, S. G. Ramos, F. Erard, V. Quesniaux, H. Ohtsu, C. L. Silva, et al.
Histamine Plays an Essential Regulatory Role in Lung Inflammation and Protective Immunity in the Acute Phase of Mycobacterium tuberculosis Infection
Infect. Immun., December 1, 2009; 77(12): 5359 - 5368.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. D'Angelo, A. De Luca, T. Zelante, P. Bonifazi, S. Moretti, G. Giovannini, R. G. Iannitti, S. Zagarella, S. Bozza, S. Campo, et al.
Exogenous Pentraxin 3 Restores Antifungal Resistance and Restrains Inflammation in Murine Chronic Granulomatous Disease
J. Immunol., October 1, 2009; 183(7): 4609 - 4618.
[Abstract] [Full Text] [PDF]


Home page
CVIHome page
T. C. Thacker, M. V. Palmer, and W. R. Waters
T-Cell mRNA Expression in Response to Mycobacterium bovis BCG Vaccination and Mycobacterium bovis Infection of White-Tailed Deer
Clin. Vaccine Immunol., August 1, 2009; 16(8): 1139 - 1145.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
P. Paidipally, S. Periasamy, P. F. Barnes, R. Dhiman, M. Indramohan, D. E. Griffith, D. Cosman, and R. Vankayalapati
NKG2D-Dependent IL-17 Production by Human T Cells in Response to an Intracellular Pathogen
J. Immunol., August 1, 2009; 183(3): 1940 - 1945.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
P. Kapil, R. Atkinson, C. Ramakrishna, D. J. Cua, C. C. Bergmann, and S. A. Stohlman
Interleukin-12 (IL-12), but Not IL-23, Deficiency Ameliorates Viral Encephalitis without Affecting Viral Control
J. Virol., June 15, 2009; 83(12): 5978 - 5986.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. G. Rothfuchs, J. G. Egen, C. G. Feng, L. R. V. Antonelli, A. Bafica, N. Winter, R. M. Locksley, and A. Sher
In Situ IL-12/23p40 Production during Mycobacterial Infection Is Sustained by CD11bhigh Dendritic Cells Localized in Tissue Sites Distinct from Those Harboring Bacilli
J. Immunol., June 1, 2009; 182(11): 6915 - 6925.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
J. D. Ooi, R. K.S. Phoon, S. R. Holdsworth, and A. R. Kitching
IL-23, not IL-12, Directs Autoimmunity to the Goodpasture Antigen
J. Am. Soc. Nephrol., May 1, 2009; 20(5): 980 - 989.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
R. F. Silver, J. Walrath, H. Lee, B. A. Jacobson, H. Horton, M. R. Bowman, K. Nocka, and J. P. Sypek
Human Alveolar Macrophage Gene Responses to Mycobacterium tuberculosis Strains H37Ra and H37Rv
Am. J. Respir. Cell Mol. Biol., April 1, 2009; 40(4): 491 - 504.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
M. Gonzalez-Juarrero, L. C. Kingry, D. J. Ordway, M. Henao-Tamayo, M. Harton, R. J. Basaraba, W. H. Hanneman, I. M. Orme, and R. A. Slayden
Immune Response to Mycobacterium tuberculosis and Identification of Molecular Markers of Disease
Am. J. Respir. Cell Mol. Biol., April 1, 2009; 40(4): 398 - 409.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. Hamada, M. d. l. L. Garcia-Hernandez, J. B. Reome, S. K. Misra, T. M. Strutt, K. K. McKinstry, A. M. Cooper, S. L. Swain, and R. W. Dutton
Tc17, a Unique Subset of CD8 T Cells That Can Protect against Lethal Influenza Challenge
J. Immunol., March 15, 2009; 182(6): 3469 - 3481.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
E. Karpuzoglu, R. A. Phillips, R. Dai, C. Graniello, R. M. Gogal Jr., and S. A. Ahmed
Signal Transducer and Activation of Transcription (STAT) 4{beta}, a Shorter Isoform of Interleukin-12-Induced STAT4, Is Preferentially Activated by Estrogen
Endocrinology, March 1, 2009; 150(3): 1310 - 1320.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
D. van de Wetering, R. A. de Paus, J. T. van Dissel, and E. van de Vosse
IL-23 modulates CD56+/CD3- NK Cell and CD56+/CD3+ NK-like T Cell function differentially from IL-12
Int. Immunol., February 1, 2009; 21(2): 145 - 153.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. M. Schulz, G. Kohler, N. Schutze, J. Knauer, R. K. Straubinger, A. A. Chackerian, E. Witte, K. Wolk, R. Sabat, Y. Iwakura, et al.
Protective Immunity to Systemic Infection with Attenuated Salmonella enterica serovar Enteritidis in the Absence of IL-12 Is Associated with IL-23-Dependent IL-22, but Not IL-17
J. Immunol., December 1, 2008; 181(11): 7891 - 7901.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
S. Jang, A. Uzelac, and P. Salgame
Distinct chemokine and cytokine gene expression pattern of murine dendritic cells and macrophages in response to Mycobacterium tuberculosis infection
J. Leukoc. Biol., November 1, 2008; 84(5): 1264 - 1270.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. A. Da Silva, D. Hartl, W. Liu, C. G. Lee, and J. A. Elias
TLR-2 and IL-17A in Chitin-Induced Macrophage Activation and Acute Inflammation
J. Immunol., September 15, 2008; 181(6): 4279 - 4286.
[Abstract] [Full Text] [PDF]


Home page
Ann Rheum DisHome page
H Yamada, Y Nakashima, K Okazaki, T Mawatari, J-I Fukushi, N Kaibara, A Hori, Y Iwamoto, and Y Yoshikai
Th1 but not Th17 cells predominate in the joints of patients with rheumatoid arthritis
Ann Rheum Dis, September 1, 2008; 67(9): 1299 - 1304.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
J. M. Jordan, M. E. Woods, J. Olano, and D. H. Walker
The Absence of Toll-Like Receptor 4 Signaling in C3H/HeJ Mice Predisposes Them to Overwhelming Rickettsial Infection and Decreased Protective Th1 Responses
Infect. Immun., August 1, 2008; 76(8): 3717 - 3724.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
P. R. Kroening, T. W. Barnes, L. Pease, A. Limper, H. Kita, and R. Vassallo
Cigarette Smoke-Induced Oxidative Stress Suppresses Generation of Dendritic Cell IL-12 and IL-23 through ERK-Dependent Pathways
J. Immunol., July 15, 2008; 181(2): 1536 - 1547.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
F. Gerosa, B. Baldani-Guerra, L. A. Lyakh, G. Batoni, S. Esin, R. T. Winkler-Pickett, M. R. Consolaro, M. De Marchi, D. Giachino, A. Robbiano, et al.
Differential regulation of interleukin 12 and interleukin 23 production in human dendritic cells
J. Exp. Med., June 9, 2008; 205(6): 1447 - 1461.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
M. D. Woolard, L. L. Hensley, T. H. Kawula, and J. A. Frelinger
Respiratory Francisella tularensis Live Vaccine Strain Infection Induces Th17 Cells and Prostaglandin E2, Which Inhibits Generation of Gamma Interferon-Positive T Cells
Infect. Immun., June 1, 2008; 76(6): 2651 - 2659.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
E. Jasny, M. Eisenblatter, K. Matz-Rensing, K. Tenner-Racz, M. Tenbusch, A. Schrod, C. Stahl-Hennig, V. Moos, T. Schneider, P. Racz, et al.
IL-12-Impaired and IL-12-Secreting Dendritic Cells Produce IL-23 upon CD154 Restimulation
J. Immunol., May 15, 2008; 180(10): 6629 - 6639.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
K. Venkatachalam, S. Mummidi, D. M. Cortez, S. D. Prabhu, A. J. Valente, and B. Chandrasekar
Resveratrol inhibits high glucose-induced PI3K/Akt/ERK-dependent interleukin-17 expression in primary mouse cardiac fibroblasts
Am J Physiol Heart Circ Physiol, May 1, 2008; 294(5): H2078 - H2087.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. J. Scriba, B. Kalsdorf, D.-A. Abrahams, F. Isaacs, J. Hofmeister, G. Black, H. Y. Hassan, R. J. Wilkinson, G. Walzl, S. J. Gelderbloem, et al.
Distinct, Specific IL-17- and IL-22-Producing CD4+ T Cell Subsets Contribute to the Human Anti-Mycobacterial Immune Response
J. Immunol., February 1, 2008; 180(3): 1962 - 1970.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
E. Smith, A. Zarbock, M. A. Stark, T. L. Burcin, A. C. Bruce, P. Foley, and K. Ley
IL-23 Is Required for Neutrophil Homeostasis in Normal and Neutrophilic Mice
J. Immunol., December 15, 2007; 179(12): 8274 - 8279.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
M. Rottman, E. Catherinot, P. Hochedez, J.-F. Emile, J.-L. Casanova, J.-L. Gaillard, and C. Soudais
Importance of T Cells, Gamma Interferon, and Tumor Necrosis Factor in Immune Control of the Rapid Grower Mycobacterium abscessus in C57BL/6 Mice
Infect. Immun., December 1, 2007; 75(12): 5898 - 5907.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
T. Le-Thi-Phuong, G. Thirion, and J.-P. Coutelier
Distinct gamma interferon-production pathways in mice infected with lactate dehydrogenase-elevating virus
J. Gen. Virol., November 1, 2007; 88(11): 3063 - 3066.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
R. A. Moulton, M. A. Mashruwala, A. K. Smith, D. R. Lindsey, R. A. Wetsel, D. L. Haviland, R. L. Hunter, and C. Jagannath
Complement C5a anaphylatoxin is an innate determinant of dendritic cell-induced Th1 immunity to Mycobacterium bovis BCG infection in mice
J. Leukoc. Biol., October 1, 2007; 82(4): 956 - 967.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. G. Rothfuchs, A. Bafica, C. G. Feng, J. G. Egen, D. L. Williams, G. D. Brown, and A. Sher
Dectin-1 Interaction with Mycobacterium tuberculosis Leads to Enhanced IL-12p40 Production by Splenic Dendritic Cells
J. Immunol., September 15, 2007; 179(6): 3463 - 3471.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
X. L. Rudner, K. I. Happel, E. A. Young, and J. E. Shellito
Interleukin-23 (IL-23)-IL-17 Cytokine Axis in Murine Pneumocystis carinii Infection
Infect. Immun., June 1, 2007; 75(6): 3055 - 3061.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
S. Ivanov, S. Bozinovski, A. Bossios, H. Valadi, R. Vlahos, C. Malmhall, M. Sjostrand, J. K. Kolls, G. P. Anderson, and A. Linden
Functional Relevance of the IL-23-IL-17 Axis in Lungs In Vivo
Am. J. Respir. Cell Mol. Biol., April 1, 2007; 36(4): 442 - 451.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Umemura, A. Yahagi, S. Hamada, M. D. Begum, H. Watanabe, K. Kawakami, T. Suda, K. Sudo, S. Nakae, Y. Iwakura, et al.
IL-17-Mediated Regulation of Innate and Acquired Immune Response against Pulmonary Mycobacterium bovis Bacille Calmette-Guerin Infection
J. Immunol., March 15, 2007; 178(6): 3786 - 3796.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
P. J. Dubin and J. K. Kolls
IL-23 mediates inflammatory responses to mucoid Pseudomonas aeruginosa lung infection in mice
Am J Physiol Lung Cell Mol Physiol, February 1, 2007; 292(2): L519 - L528.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. M. Wozniak, A. A. Ryan, and W. J. Britton
Interleukin-23 Restores Immunity to Mycobacterium tuberculosis Infection in IL-12p40-Deficient Mice and Is Not Required for the Development of IL-17-Secreting T Cell Responses
J. Immunol., December 15, 2006; 177(12): 8684 - 8692.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. C. Higgins, A. G. Jarnicki, E. C. Lavelle, and K. H. G. Mills
TLR4 Mediates Vaccine-Induced Protective Cellular Immunity to Bordetella pertussis: Role of IL-17-Producing T Cells
J. Immunol., December 1, 2006; 177(11): 7980 - 7989.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. G. Feng, M. Kaviratne, A. G. Rothfuchs, A. Cheever, S. Hieny, H. A. Young, T. A. Wynn, and A. Sher
NK Cell-Derived IFN-{gamma} Differentially Regulates Innate Resistance and Neutrophil Response in T Cell-Deficient Hosts Infected with Mycobacterium tuberculosis
J. Immunol., November 15, 2006; 177(10): 7086 - 7093.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
A. A. Chackerian, S.-J. Chen, S. J. Brodie, J. D. Mattson, T. K. McClanahan, R. A. Kastelein, and E. P. Bowman
Neutralization or Absence of the Interleukin-23 Pathway Does Not Compromise Immunity to Mycobacterial Infection
Infect. Immun., November 1, 2006; 74(11): 6092 - 6099.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
M. C. Kullberg, D. Jankovic, C. G. Feng, S. Hue, P. L. Gorelick, B. S. McKenzie, D. J. Cua, F. Powrie, A. W. Cheever, K. J. Maloy, et al.
IL-23 plays a key role in Helicobacter hepaticus-induced T cell-dependent colitis
J. Exp. Med., October 30, 2006; 203(11): 2485 - 2494.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
E. Lockhart, A. M. Green, and J. L. Flynn
IL-17 Production Is Dominated by {gamma}{delta} T Cells rather than CD4 T Cells during Mycobacterium tuberculosis Infection
J. Immunol., October 1, 2006; 177(7): 4662 - 4669.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Cruz, S. A. Khader, E. Torrado, A. Fraga, J. E. Pearl, J. Pedrosa, A. M. Cooper, and A. G. Castro
Cutting Edge: IFN-{gamma} Regulates the Induction and Expansion of IL-17-Producing CD4 T Cells during Mycobacterial Infection
J. Immunol., August 1, 2006; 177(3): 1416 - 1420.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
S. A. Khader, S. Partida-Sanchez, G. Bell, D. M. Jelley-Gibbs, S. Swain, J. E. Pearl, N. Ghilardi, F. J. deSauvage, F. E. Lund, and A. M. Cooper
Interleukin 12p40 is required for dendritic cell migration and T cell priming after Mycobacterium tuberculosis infection
J. Exp. Med., July 10, 2006; 203(7): 1805 - 1815.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
H. W. Murray, C. W. Tsai, J. Liu, and X. Ma
Responses to Leishmania donovani in Mice Deficient in Interleukin-12 (IL-12), IL-12/IL-23, or IL-18
Infect. Immun., July 1, 2006; 74(7): 4370 - 4374.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
F. Spensieri, G. Fedele, C. Fazio, M. Nasso, P. Stefanelli, P. Mastrantonio, and C. M. Ausiello
Bordetella pertussis Inhibition of Interleukin-12 (IL-12) p70 in Human Monocyte-Derived Dendritic Cells Blocks IL-12 p35 through Adenylate Cyclase Toxin-Dependent Cyclic AMP Induction.
Infect. Immun., May 1, 2006; 74(5): 2831 - 2838.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
C. M. Tato, A. Laurence, and J. J. O'Shea
Helper T cell differentiation enters a new era: Le Roi est mort; vive le Roi!
J. Exp. Med., April 17, 2006; 203(4): 809 - 812.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. Ordway, M. Harton, M. Henao-Tamayo, R. Montoya, I. M. Orme, and M. Gonzalez-Juarrero
Enhanced Macrophage Activity in Granulomatous Lesions of Immune Mice Challenged with Mycobacterium tuberculosis.
J. Immunol., April 15, 2006; 176(8): 4931 - 4939.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. A. Kleinschek, U. Muller, S. J. Brodie, W. Stenzel, G. Kohler, W. M. Blumenschein, R. K. Straubinger, T. McClanahan, R. A. Kastelein, and G. Alber
IL-23 Enhances the Inflammatory Cell Response in Cryptococcus neoformans Infection and Induces a Cytokine Pattern Distinct from IL-12
J. Immunol., January 15, 2006; 176(2): 1098 - 1106.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Khader, S. A.
Right arrow Articles by Cooper, A. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Khader, S. A.
Right arrow Articles by Cooper, A. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS