The JI PBL Intereron Source
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Anders, R. A.
Right arrow Articles by Fu, Y.-X.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Anders, R. A.
Right arrow Articles by Fu, Y.-X.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Substance via MeSH
The Journal of Immunology, 2005, 175: 1295-1300.
Copyright © 2005 by The American Association of Immunologists

Contribution of the Lymphotoxin {beta} Receptor to Liver Regeneration1

Robert A. Anders*, Sumit K. Subudhi{dagger}, Jing Wang{dagger}, Klaus Pfeffer{ddagger} and Yang-Xin Fu2,*

* Department of Pathology and {dagger} Committee on Immunology, University of Chicago, Chicago, IL 60637; and {ddagger} Institut fur Medizinische Mikrobiologie, Heinrich-Heine-Universit, Dusseldorf, Germany


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The liver has an enormous capacity to regenerate in response to insults, but the cellular events and molecules involved in liver regeneration are not well defined. In this study, we report that ligands expressed on the surface of lymphocytes have a substantial effect on liver homeostasis. We demonstrate that a T cell-restricted ligand, homologous to lymphotoxin, exhibits inducible expression, competes with herpesvirus glycoprotein D for herpesvirus entry mediator on T cells (LIGHT), signaling through the lymphotoxin receptor (LT{beta}R) expressed on mature hepatocytes induces massive hepatomegaly. Using genetic targeting and a receptor fusion protein, we further show that mice deficient in LT{beta}R signaling have a severe defect in their ability to survive partial hepatectomy with marked liver damage and failure to initiate DNA synthesis after partial hepatectomy. We further show that mice deficient in a LT{beta}R ligand, LT{alpha}, also show decreased ability to survive partial hepatectomy with similar levels of liver damage and decreased DNA synthesis. Therefore, our study has revealed an unexpected role of lymphocyte-restricted ligands and defined a new pathway in supporting liver regeneration.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The liver is a vital organ that performs many biological functions including synthesis, metabolism, and storage of carbohydrates, proteins, and lipids. The hepatocytes, which comprise the dominant cell population of the liver, effect these functions. Survival from insults such as viruses and toxins requires maintenance of hepatic mass. Therefore, in addition to the synthetic and metabolic function, the liver must continue to undergo self-renewal (1). Controlling the ability of the liver to regulate its mass has broad clinical implications. Organ shortages continue to press the need for liver transplantation alternatives, and the ability to increase the renewal of the liver would make split liver transplants and cellular transplants more feasible. In addition, flares of necroinflammatory activity seen in chronic hepatitis lead to increased hepatocyte turnover and fibrosis. Further understanding of liver growth control mechanisms offers a possible solution to both liver transplantation and chronic liver disease.

The partial hepatectomy is a particularly useful model for beginning to understand how the liver controls self-renewal (2). Partial hepatectomy, a procedure that removes 70% of the liver, is regarded as the preferred in vivo method to study liver growth due to its synchronized growth response in the liver (3, 4). The understanding of liver regeneration has focused on the cytokine and growth factor network involved in the process (5). These studies have defined TNF-{alpha} and IL-6 as important cytokines that prime the hepatocyte for response to growth factors such as hepatocyte growth factor, epidermal growth factor, and TGF-{alpha} (6, 7).

Besides release of cytokines and growth factors after partial hepatectomy, rapid changes in the cellular composition of the liver occur immediately after partial hepatectomy. For example, as early as 12 h after partial hepatectomy, there is an increase in the number of intrahepatic lymphocytes. This increase is due to an increase in the percentage of CD4-positive and NK T cells (8). However, the contribution of lymphocytes to the regenerative process has not been defined.

The lymphocyte-derived ligand, homologous to lymphotoxin (LT),3 exhibits inducible expression and competes with HSV glycoprotein D for herpesvirus entry mediator, a receptor expressed on T cells (LIGHT) is a TNF family member (TNF superfamily 14) that is expressed on activated T cells (9). LIGHT has two receptors, the LT{beta}R, which is expressed on nonhemopoietic cells, and the herpes virus entry mediator receptor (HVEM), which is expressed on hemopoietic cells (9, 10). The expression of LIGHT on activated T cells can signal to lymphocytes via the HVEM receptor and to nonhemopoietic cells through the LT{beta}R. Therefore, LIGHT performs a unique role in bridging hemopoietic and nonhemopoietic signaling.

In this study, we show that transgenic mice expressing LIGHT (Tg LIGHT) under the control of the T cell-restricted p56lck promoter and CD2 enhancer display a massive increase in liver mass and markedly abnormal hepatocyte histology. The effect of LIGHT is dependent on the LT{beta}R, which we demonstrate is expressed on hepatocytes. Immediately after partial hepatectomy, there is an increase in LIGHT and LT{alpha} from intrahepatic lymphocytes. Furthermore, LT{beta}R-deficient mice (LT{beta}R–/–) show an impaired ability to regenerate their liver after partial hepatectomy, suggesting that the LT{beta}R pathway is required for optimal liver regeneration. We demonstrate the importance of the LT{beta}R signaling in supporting liver biology by demonstrating a deficiency in LT{alpha} also shows an impaired ability to undergo liver regeneration. Finally, we are able to show that treatment with a LT{beta}R human fusion protein (LT{beta}R-hFc) also blocks liver regeneration in wild-type mice. Therefore, this study establishes a key interaction between lymphocyte-derived ligands and hepatocytes and uncovers the LT{beta}R and its ligands as a new pathway during liver regeneration.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 Disclosures
 References
 
Mice and reagents

Mice carrying a transgene for LIGHT have previously been reported (11). Male C57B/L6J, LT{alpha}–/– mice (6–10 wk old) were a gift from D. Chaplin (Washington University, St. Louis, MO) and were backcrossed to a B6 background for 13 generations. LT{beta}R–/– mice were generated by K. Pfeffer (Institute of Medical Microbiology, Immunology, and Hygiene, Technical University of Munich, Munich, Germany) (12) and backcrossed to a B6 background for seven generations. HVEM–/– mice were recently generated in K. Pfeffer’s laboratory and backcrossed to B6 for five generations with genetic targeting confirmed by Southern blot analysis and Ab staining (13). All mice were maintained at the University of Chicago and handled according to National Institutes of Health guideline and approved by the Institutional Animal Care and Use Committee. Bone marrow transplantation was performed by lethally irradiating recipients with 900 rad followed by i.v. injection of 3 million bone marrow cells which were isolated by flushing the femur and humerus of the donor with sterile PBS. Adoptive transfer was performed by harvesting the thymus from 6-wk-old mice and i.v. injection of 20 x 106 cells into RAG1–/– mice (The Jackson Laboratory). Treatment with LT{beta}R-hFc (Biogen), was performed by i.v. injection of 200 µg of fusion protein 24 h before and immediately after partial hepatectomy. Anti-LT{beta}R (ACH6) and negative control (Ha4/8) hamster Ab were kindly provided by J. Browning (Biogen).

Partial hepatectomy

The procedure was performed as originally described by Higgins and Anderson (4). The mice were anesthetized with ketamine and xylazine (100 mg/kg/10 mg/kg i.p.), the liver was exposed through a midline incision, and the median and left lobes were mobilized and delivered after ligature with a single silk 4-0 suture. Sham procedures consist of anesthetizing mice followed by opening of the skin and peritoneum and manipulating but not resecting the liver. Serum transaminase activity was determined by the method of Karmen using an Elan Diagnostics analyzer according to the manufacturer’s protocols in the University of Chicago Animal Research Core laboratory.

Cell purification

Intrahepatic lymphocytes were purified from the liver by pressing the liver through a steel mesh (no. 200) into PBS, centrifuged at 800 x g for 5 min with the resulting pellet suspended in a 35% Percoll-PBS-heparin (100 U/ml) solution and centrifuged at 800 x g for 20 min at room temperature. The pellet of mononuclear cells is cleared of RBC with a 5-min osmotic lysis (0.15 M NH4Cl, 1 mM KHCO3, 0.1 mM Na2-EDTA, pH 7.3) and washed twice in PBS.

Real-time RT-PCR

Lymphocyte RNA was extracted according to the manufacturer’s protocol and further purified using the RNeasy kit. cDNA was generated from 1 µg of total RNA after DNase treatment and combined with 200 U of Moloney murine leukemia virus reverse transcriptase (Promega), 750 nM dNTP, and 3 µg of random primers. LIGHT (forward, TCCGCGTGCCTGGAAA; reverse, AAGCTCCGAAATAGGACCTGG; probe, CGCCGGGTCAGACCACGTGACG), LT{beta} (forward, CACCTCATAGGCGCTTGGAT; reverse, ACGCTTCTTCTTGGCTCGC; probe, AGTGGGCAAGGGCTCAGCTGGG), LT{alpha} (forward, CCGACCTAGACCCACAAAAA; reverse, CTCCATCCTGACCGTTGTTT; probe, ATGCTCAGGGGACGACTCAAGCCTA), and GAPDH (forward, TCCACCACCATGGAGAAGGC; reverse, GGCATGGACTGTGGTCATGA; probe, TGCATCCTGCACCACCAACTGCTTAG) were detected by quantitative PCR using the TaqMan universal PCR master mixture (Applied Biosystems) combined with 300 nM either forward or reverse primer and 100 nM fluorescent oligonucleotide probe. The cycle threshold of amplification was determined using a Smartcycler and software (Cepheid). After generation of a standard curve for each gene, the expression levels for each gene were normalized to the expression of GADPH.

Fluorescent staining

Frozen sections were cut from livers, allowed to air dry for 15 min, and incubated in PBS, 0.2% saponin, 5% normal goat serum for 15 min. Primary anti-LT{beta}R Ab (clone ACH6) or control primary Ab (Ha 4/8), 10 µg/ml in 1% normal goat serum in PBS, was incubated on the tissue in a humid chamber for 2 h at room temperature. Secondary Ab consisted of goat anti-hamster IgG Alex 594 (Molecular Probes), 10 µg/ml, and Alexa 488 phalloidin (Molecular Probes) in 1% normal goat serum in PBS for 1 h at room temperature.

Histology, BrdU, and TUNEL labeling

Tissue sections were fixed in 70% alcohol for 2 h followed by buffered formalin and processed either for routine H&E staining or for BrdU and immunohistochemical studies as per the manufacturer’s instructions (Zymed Laboratories). TUNEL staining was performed on paraffin-embedded, formalin-fixed tissue using the ApopTag Plus Peroxidase In Situ Apoptosis Detection kit (Chemicon International) according to the manufacturer’s directions. BrdU incorporation and TUNEL-positive nuclei were scored in 20 nonoverlapping high power fields (x40).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 Disclosures
 References
 
Increase in T cell-restricted ligand, LIGHT, leads to hepatomegaly in a LT{beta}R-dependent manner

The liver regulates its mass through a strict homeostatic mechanism which maintains a 4–8% liver-body weight ratio (1). Much to our surprise, a TNF superfamily ligand, LIGHT (TNSF14), expressed under the proximal p56lck promoter and CD2 enhancer, has a substantially increased liver size compared with littermate wild-type control mice (Fig. 1A). When expressed as a percentage of total body weight, Tg LIGHT mice have significantly higher liver-body weigh ratios (Fig. 1B). Liver histology reveals markedly enlarged hepatocytes and frequent mitotic figures in Tg LIGHT mice compared with age matched wild-type livers (Fig. 1, C and D). The hepatomegaly, abnormal histology, and frequent mitotic figures in Tg LIGHT mice raise the possibility that a T cell-derived cytokine disrupts the mechanisms that normally balance hepatocyte proliferation and death.



View larger version (43K):
[in this window]
[in a new window]
  		FIGURE 1. T cell-derived TNF superfamily member, LIGHT, has a profound effect on the liver mass and cell size. A, Tg mice expressing LIGHT under the control of a T cell lineage-specific promoter and enhancer have a substantially increased liver size compared with age-matched wild-type (WT) littermates. Horizontal bar, 1 cm. B, There is a significant increase in liver weight relative to total body weight compared with age-matched wild-type littermates (n = 4 each genotype) (*, p < 0.05). Liver histology reveals markedly enlarged hepatocytes and frequent mitotic figures (white arrows) in Tg LIGHT mice (C; x40) compared with wild-type livers (D; x40).

 
Next, we determine whether the effects of LIGHT on the liver could be transferred through bone marrow transplantation. The Tg LIGHT bone marrow transplanted into lethally irradiated wild-type mice resulted in massive hepatomegaly and abnormal liver histology. As expected, wild-type bone marrow transplant controls show normal liver size and histology (Fig. 2, A and B). To confirm that the changes in the liver were dependent on T cell-specific expression of LIGHT, adoptive transfer of T cells was performed. Twenty million thymocytes from 6-wk-old LIGHT Tg mice were transferred into RAG1–/– mice. A similar substantial effect on the liver is seen in these mice with enlargement of hepatocytes compared with control RAG1–/– mice that received 20 x 106 wild-type thymocytes (Fig. 2, C and D). These findings support a novel idea that a T cell-derived ligand can have a profound effect on the liver homeostasis.



View larger version (157K):
[in this window]
[in a new window]
  		FIGURE 2. LIGHT effect on the liver is dependent on the LT{beta}R and can be transferred through bone marrow-derived cells and T cells. Wild-type bone marrow transplanted into lethally irradiated wild-type recipients results in the normal liver size and histology (A), whereas Tg LIGHT bone marrow transplanted into irradiated wild-type recipients results in enlarged hepatocytes (B). Adoptive transfer of 20 x 106 wild-type (C) or Tg LIGHT (D) thymocytes into RAG1–/– recipients demonstrates enlarged hepatocytes. The liver histology and size return to normal when Tg LIGHT mice are crossed with mice deficient in LT{beta}R (LT{beta}R–/–), one of LIGHT’s putative receptors (E). However, Tg LIGHT mice crossed to the other putative receptor of LIGHT, HVEM, did not have an effect on the development of abnormal liver histology because the Tg LIGHT x HVEM–/– mice still have markedly enlarged hepatocytes (F). All histology shown is x40.

 
Given the effect of LIGHT on liver homeostasis, we wished to determine which of the two known putative receptors of LIGHT mediate this effect. Tg LIGHT mice were crossed to mice deficient in each of these receptors. The substantial effect of LIGHT on liver size and histology was lost when the Tg LIGHT mice were crossed with LT{beta}R–/– mice but not HVEM–/– mice (Fig. 2, E and F). The LT{beta}R-dependent effects of LIGHT on liver cells indicated the LT{beta}R signaling pathway uniquely links lymphocyte-derived ligands to liver homeostasis. Therefore, it appears as though LT{beta}R expression in the liver mediates the effect of LIGHT on the liver.

The LT{beta}R is expressed on hepatocytes, whereas LIGHT and LT expression increases in response to acute reduction in hepatic mass

Next, we wished to determine whether the LT{beta}R is expressed in the liver. An Ab to the LT{beta}R and fluorescent secondary was used to detect LT{beta}R expression in frozen sections of the mouse liver. Compared with LT{beta}R–/– liver, there was strong membranous expression of the LT{beta}R on the hepatocytes (Fig. 3). Simultaneous staining with phalloidin was also performed to highlight the F-actin in the cytoskeleton of the hepatocyte. Merging the LT{beta}R and phalloidin images confirms that the LT{beta}R is expressed along the hepatocyte cellular membrane.



View larger version (68K):
[in this window]
[in a new window]
  		FIGURE 3. LT{beta}R is expressed on hepatocytes. Adult wild-type and LT{beta}R–/– livers were stained with a hamster anti-LT{beta}R Ab (clone ACH6). Expression of LT{beta}R on the basolateral surface of wild-type hepatocytes (white arrows) is evident in wild-type but not LT{beta}R–/– mice. F-actin is highlighted with phalloidin staining and defines the cytoskeleton of the cell. Merged images of LT{beta}R and phalloidin staining demonstrate the colocalization of the LT{beta}R to the cell membrane. Oil, x63.

 
Because it appears as though signaling through the LT{beta}R has a dominant effect on hepatocyte growth, we determined whether LIGHT and lymphotoxin expression was induced after a strong hepatocyte growth stimulus, partial hepatectomy. After the surgical removal of 70% of the liver mass in wild-type mice, lymphocytes were purified from the remnant liver, and RNA was isolated. There was an ~3-fold induction of LIGHT mRNA expression in the intrahepatic lymphocytes, which is sustained from 4 to 12 h after partial hepatectomy (Fig. 4, {square}). LT{alpha} mRNA expression peaks at 4 h and begins to decline 12 h after partial hepatectomy (Fig. 4,

{cjs2108}

). As expected, the expression of LT{beta} mRNA remains at constant basal levels after partial hepatectomy with a slight increase at 12 h (Fig. 4, {blacksquare}). The induction of the LT{beta}R ligand expression suggests that these ligands function in the inflammatory milieu that is rapidly induced after partial hepatectomy. These results indicate that hepatocytes express the LT{beta}R and that the mRNA expression of LT{beta}R ligands, LIGHT and LT{alpha}, are sharply induced in lymphocytes after partial hepatectomy.



View larger version (19K):
[in this window]
[in a new window]
  		FIGURE 4. Induction of LIGHT and LT{alpha} mRNA after partial hepatectomy. Wild-type mice were challenged with partial hepatectomy, lymphocytes were isolated from the liver, and mRNA was purified at 0-, 4-, and 12-h time points. LIGHT ({square}), LT{alpha} ({cjs2108}), and LT{beta} ({blacksquare}) mRNA expression was determined using real-time RT-PCR (n = 3 for each time point). Gene expression was normalized to GAPDH, and fold change is reported relative to expression at 0 h.

 
LT{beta}R signaling is essential for surviving partial hepatectomy

Because the LT{beta}R expression on the hepatocytes mediates liver proliferation in response to a T cell-derived ligand and LT{beta}R ligands increase after partial hepatectomy, the relative contribution of LT{beta}R to restoration of liver mass after partial hepatectomy was explored. Wild-type mice showed no significant increase in morbidity or mortality after partial hepatectomy, whereas there was a substantially increased morbidity and mortality of LT{beta}R–/– after partial hepatectomy (Fig. 5). We further examined the role of LT{beta}R signaling after partial hepatectomy by determining whether mice deficient in another ligand known to signal through the LT{beta}R, LT{alpha}, is also essential for liver regeneration. Mice deficient in LT{alpha}–/– also displayed a significant decrease in survival after partial hepatectomy (Fig. 5). It suggests the essential role of LT{beta}R signaling by LT during liver regeneration.



View larger version (21K):
[in this window]
[in a new window]
  		FIGURE 5. Increased mortality of LT{beta}R and lymphotoxin-deficient mice after partial hepatectomy. Wild-type mice ({blacktriangleup}) survive partial hepatectomy whereas mice deficient in either the LT{beta}R ({triangleup}) or LT{alpha} ligand ({diamondsuit}) show an increased mortality.

 
These data led us to consider whether decreased survival in the absence of LT{beta}R signaling had a direct effect on the liver. LT{beta}R–/– and LT{alpha}–/– mice showed evidence of liver damage 48 h after partial hepatectomy with significantly elevated serum aminotransferase levels compared with similarly treated wild-type mice (Fig. 6A). Histological examination of the livers showed larger areas of necrosis in the LT{beta}R–/– and LT{alpha}–/– mice 48 h after partial hepatectomy compared with wild-type mice (Fig. 6B).



View larger version (60K):
[in this window]
[in a new window]
  		FIGURE 6. LT{beta}R- and LT-deficient mice show evidence of liver damage and decreased DNA synthesis after partial hepatectomy. A, After partial hepatectomy, serum aminotransferase levels are significantly elevated in either the LT{beta}R- or LT{alpha}-deficient mice compared with similarly treated wild-type mice at 48 h (*, p < 0.05). B, There are larger areas of necrosis (pale hepatocytes outlined without a nucleus) in the LT{beta}R- or LT{alpha}-deficient mice at 48 h after partial hepatectomy compared with wild-type mice. C, As a measure of hepatocytes apoptosis at 24, 48, and 72 h after partial hepatectomy, liver sections from wild-type ({blacksquare}) and LT{beta}R–/– ({square}) were TUNEL stained. The number of hepatocyte TUNEL-positive nuclei were counted in 20 nonoverlapping x40 fields (n = 3/time point). hpf, high power field.

 
We also investigated whether there is an increase in the number of apoptotic hepatocytes using TUNEL staining. We could clearly demonstrate the number of TUNEL-positive nuclei were significantly increased in LT{beta}R–/– compared with wild-type mice at 24 and 48 h after partial hepatectomy (Fig. 6C). Evidence that LT{beta}R–/– mice develop extensive areas of hepatocyte death when challenged with partial hepatectomy is consistent with an in vitro analysis that the LT{beta}R-mediated microenvironment transduces viability signals in hepatocytes (14).

LT{beta}R signaling is essential in initiating DNA synthesis after partial hepatectomy

Next, we wanted to determine whether LT{beta}R signaling was involved in initiating DNA synthesis after partial hepatectomy. Mice received a 2-h pulse with a thymidine analog, BrdU, 48 h after partial hepatectomy or a sham procedure. This allowed us to carefully examine the proliferation of the hepatocyte after partial hepatectomy by counting the number of BrdU-positive hepatocyte nuclei after immunohistochemical staining. There was significantly more DNA synthesis in the wild-type mice than in either LT{beta}R–/– or LT{alpha}–/– mice (Fig. 7A). As expected, sham procedures did not induce DNA synthesis.



View larger version (16K):
[in this window]
[in a new window]
  		FIGURE 7. Decreased DNA synthesis after partial hepatectomy in LT{beta}R–/–, LT{alpha}–/–, and LT{beta}R-hFc-treated wild-type mice. The amount of DNA synthesis after partial hepatectomy was determined using a 2-h pulse with BrdU followed by immunohistochemical staining and counting the number of positively stained nuclei in 20 high power fields (hpf). There was significantly more active DNA synthesis in the wild-type mice compared with LT{beta}R–/–, LT{alpha}–/– or sham treated mice (A). Wild-type mice treated with the LT{beta}R fused to the human Ig FcR (LT{beta}R-hFc) also showed a significant decrease in the number of BrdU positive hepatocytes compared with wild-type control mice (*p < 0.05).

 
The inability of the LT{beta}R–/– mice to synthesize DNA after partial hepatectomy was not due to a developmental lesion because short term treatment with LT{beta}R-hFc also blocked the initiation of DNA synthesis in wild-type mice (Fig. 7B). This indicated that signaling through the LT{beta}R as well as a LT{beta}R ligand(s) was important for the ability of the liver to regenerate hepatic mass. The combination of increased liver damage and a reduced regenerative response after partial hepatectomy induces significant mortality in mice that cannot activate the LT{beta}R. Together, these data suggest that LT{beta}R signaling through T cell-restricted ligands is critical for liver homeostasis.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
Disclosures
 References
 
In this study, we have revealed for the first time that signaling through the LT{beta}R can have a substantial effect on the liver and that lymphocytes can play a novel role in liver regeneration. Our initial observation of proliferative and massively enlarged livers in Tg LIGHT mice led us to investigate two major questions. We wanted to know 1) whether a T cell-restricted ligand could have a dramatic liver phenotype and 2) what effect the ligand and receptor pathway has on the liver after partial hepatectomy.

We have previously demonstrated the expression of LIGHT on the T cells of Tg LIGHT mice; this agrees with what is known about the p56lck promoter and CD2 enhancer that drives the LIGHT transgene (11, 15, 16, 17). Tg LIGHT mice have marked T cell infiltration of peripheral organs. Because there was a correlation between the presence of increased LIGHT expressing T cells and enlargement of the liver, we sought to determine whether this was a direct or indirect effect. In support of the direct action of T cell-derived LIGHT, we have found that either bone marrow transplantation or transfer of thymocytes from Tg LIGHT mice into wild-type or RAG1–/– mice recipients resulted in the transfer of the abnormal liver phenotype. In addition, the direct effect of LIGHT on the liver was dependent on LT{beta}R expressed on mature hepatocytes, but not on the HVEM receptor. This suggests that LIGHT was directly mediating effects on the liver. Therefore, based on our observations, it appears as though the LT{beta}R functions as a bridge between LIGHT-expressing T cells and LT{beta}R expression on hepatocytes.

In the Tg LIGHT mice, there exists a strong likelihood of a direct interaction between the T cell and the hepatocyte. The Tg LIGHT mice were engineered to retain LIGHT on the surface of the T cell through the introduction of a mutation at a suspected cleavage site. In the nontransgenic system, LIGHT is expressed on activated T cells, with few other cell types expressing LIGHT. It is possible that activated T cells deliver LIGHT to the liver and that LIGHT is then cleaved from the T cell membrane. Soluble LIGHT could then interact with the LT{beta}R expressed on hepatocytes. The latter scenario is analogous to what occurs with other TNF superfamily ligands (18).

The physiological role of LIGHT and LT{beta}R in liver has not been defined. The increased expression of LIGHT in our Tg mice was used to hint at LIGHT’s potential role during inflammation. There is in vitro evidence to suggest LIGHT does have a direct role on hepatocytes. Treatment of cultured human hepatocytes with LIGHT protects against TNF-mediated apoptosis (14). LIGHT and the LT{beta}R does not appear to be essential for liver development during embryogenesis because mice deficient in LIGHT or LT{beta}R appear to have normal liver histology (data not shown).

LT{beta}R signaling by LIGHT appeared to mediate a proliferative environment in the liver, so we sought to define the role of the LT{beta}R in liver growth. Partial hepatectomy is an in vivo method to deliver a strong growth stimulus to hepatocytes. First, we were able to show an increase in the mRNA of lymphocyte-derived LT{beta}R ligands, LT{alpha} and LIGHT, immediately after partial hepatectomy. Second, a deficiency in the LT{beta}R had a profound effect on the liver following partial hepatectomy. Not only was there a reduction in hepatocyte DNA synthesis but also there was significant liver damage and high mortality after partial hepatectomy. Third, the impaired liver-regenerative response could be replicated in wild-type mice treated with LT{beta}R-Fc, suggesting a direct role for the LT{beta}R. The LT{beta}R appears to be uniquely situated to balance cellular death and DNA synthesis in hepatocytes after partial hepatectomy. LT{beta}R signaling and the relative contribution of LIGHT and LT{alpha} to normal liver cell turnover will have to be explored.

With this study, we have been able to uncover an unexpected role of lymphocyte-restricted ligands and defined a new pathway in supporting liver regeneration. This system will allow us to 1) explore the environment created by activated lymphocytes during liver regeneration, 2) explore the events downstream of the LT{beta}R that either protect hepatocytes from cell death, or 3) promote proliferation after partial hepatectomy.


   Disclosures
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
References
 
The authors have no financial conflict of interest.


   Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This research was supported by National Institutes of Health Grants R01-DK58897 and AI062026. R.A.A. was in part supported by a National Institutes of Health Training Grant (AI07090) and K08 DK067187. Back

2 Address correspondence and reprint requests to Dr. Yang-Xin Fu, Department of Pathology, University of Chicago, Chicago, IL 60637. E-mail address: yfu{at}uchicago.edu Back

3 Abbreviations used in this paper: LT, lymphotoxin; LIGHT, homologous to lymphotoxin, exhibits inducible expression, competes with herpesvirus glycoprotein D for herpesvirus entry mediator on T cells, a receptor expressed on T cells; HVEM, herpes virus entry mediator; Tg, transgenic; RAG1, recombinase-activating gene 1; LT{beta}R-hFc, LT{beta}R human fusion protein. Back

Received for publication February 25, 2005. Accepted for publication April 30, 2005.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Michalopoulos, G. K., M. C. DeFrances. 1997. Liver regeneration. Science 276: 60-66.[Abstract/Free Full Text]
  2. Diehl, A. M.. 2002. Liver regeneration. Front Biosci. 7: e301-e314.[Medline]
  3. Fausto, N., J. S. Campbell. 2003. The role of hepatocytes and oval cells in liver regeneration and repopulation. Mech. Dev. 120: 117-122.[Medline]
  4. Higgins, G. M., R. M. Anderson. 1931. Restoration of the liver of the white rat following partial surgical removal. Arch. Pathol. 12: 186-202.
  5. Galun, E., J. H. Axelrod. 2002. The role of cytokines in liver failure and regeneration: potential new molecular therapies. Biochim. Biophys. Acta 1592: 345-358.[Medline]
  6. Cressman, D. E., L. E. Greenbaum, R. A. DeAngelis, G. Ciliberto, E. E. Furth, V. Poli, R. Taub. 1996. Liver failure and defective hepatocyte regeneration in interleukin-6-deficient mice. Science 274: 1379-1383.[Abstract/Free Full Text]
  7. Akerman, P., P. Cote, S. Q. Yang, C. McClain, S. Nelson, G. J. Bagby, A. M. Diehl. 1992. Antibodies to tumor necrosis factor-{alpha} inhibit liver regeneration after partial hepatectomy. Am. J. Physiol. 263: G579-G585.
  8. Minagawa, M., H. Oya, S. Yamamoto, T. Shimizu, M. Bannai, H. Kawamura, K. Hatakeyama, T. Abo. 2000. Intensive expansion of natural killer T cells in the early phase of hepatocyte regeneration after partial hepatectomy in mice and its association with sympathetic nerve activation. Hepatology 31: 907-915.[Medline]
  9. Mauri, D. N., R. Ebner, R. I. Montgomery, K. D. Kochel, T. C. Cheung, G. L. Yu, S. Ruben, M. Murphy, R. J. Eisenberg, G. H. Cohen, et al 1998. LIGHT, a new member of the TNF superfamily, and lymphotoxin {alpha} are ligands for herpesvirus entry mediator. Immunity 8: 21-30.[Medline]
  10. Force, W. R., B. N. Walter, C. Hession, R. Tizard, C. A. Kozak, J. L. Browning, C. F. Ware. 1995. Mouse lymphotoxin-{beta} receptor: molecular genetics, ligand binding, and expression. J. Immunol. 155: 5280-5288.[Abstract]
  11. Wang, J., J. C. Lo, A. Foster, P. Yu, H. M. Chen, Y. Wang, K. Tamada, L. Chen, Y. X. Fu. 2001. The regulation of T cell homeostasis and autoimmunity by T cell-derived LIGHT. J. Clin. Invest. 108: 1771-1780.[Medline]
  12. Futterer, A., K. Mink, A. Luz, M. H. Kosco-Vilbois, K. Pfeffer. 1998. The lymphotoxin {beta} receptor controls organogenesis and affinity maturation in peripheral lymphoid tissues. Immunity 9: 59-70.[Medline]
  13. Wang, Y., S. K. Subudhi, R. A. Anders, J. Lo, Y. Sun, S. Blink, J. Wang, X. Liu, K. Mink, D. Degrandi, et al 2005. The role of herpesvirus entry mediator as a negative regulator of T cell-mediated responses. J. Clin. Invest. 115: 711-717.[Medline]
  14. Matsui, H., Y. Hikichi, I. Tsuji, T. Yamada, Y. Shintani. 2002. LIGHT, a member of the tumor necrosis factor ligand superfamily, prevents tumor necrosis factor-{alpha}-mediated human primary hepatocyte apoptosis, but not Fas-mediated apoptosis. J. Biol. Chem. 277: 50054-50061.[Abstract/Free Full Text]
  15. Wang, J., T. Chun, J. C. Lo, Q. Wu, Y. Wang, A. Foster, K. Roca, M. Chen, K. Tamada, L. Chen, et al 2001. The critical role of LIGHT, a TNF family member, in T cell development. J. Immunol. 167: 5099-5105.[Abstract/Free Full Text]
  16. Allen, J. M., K. A. Forbush, R. M. Perlmutter. 1992. Functional dissection of the lck proximal promoter. Mol. Cell Biol. 12: 2758-2768.[Abstract/Free Full Text]
  17. Greaves, D. R., F. D. Wilson, G. Lang, D. Kioussis. 1989. Human CD2 3'-flanking sequences confer high-level, T cell-specific, position-independent gene expression in transgenic mice. Cell 56: 979-986.[Medline]
  18. Idriss, H. T., J. H. Naismith. 2000. TNF {alpha} and the TNF receptor superfamily: structure-function relationship(s). Microsc. Res. Tech. 50: 184-195.[Medline]



This article has been cited by other articles:


Home page
 J. Exp. Med.Home page
M. W. Steinberg, O. Turovskaya, R. B. Shaikh, G. Kim, D. F. McCole, K. Pfeffer, K. M. Murphy, C. F. Ware, and M. Kronenberg
A crucial role for HVEM and BTLA in preventing intestinal inflammation
J. Exp. Med., June 9, 2008; 205(6): 1463 - 1476.
[Abstract] [Full Text] [PDF]

Home page
 ScienceHome page
J. C. Lo, Y. Wang, A. V. Tumanov, M. Bamji, Z. Yao, C. A. Reardon, G. S. Getz, and Y.-X. Fu
Lymphotoxin {beta} Receptor-Dependent Control of Lipid Homeostasis
Science, April 13, 2007; 316(5822): 285 - 288.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
J. S. Campbell, K. J. Riehle, J. T. Brooling, R. L. Bauer, C. Mitchell, and N. Fausto
Proinflammatory Cytokine Production in Liver Regeneration Is Myd88-Dependent, but Independent of Cd14, Tlr2, and Tlr4
J. Immunol., February 15, 2006; 176(4): 2522 - 2528.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Anders, R. A.
Right arrow Articles by Fu, Y.-X.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Anders, R. A.
Right arrow Articles by Fu, Y.-X.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Substance via MeSH

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS