The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rowley, A. H.
Right arrow Articles by Baker, S. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rowley, A. H.
Right arrow Articles by Baker, S. C.
Right arrowPubmed/NCBI databases
*Protein
*Substance via MeSH
Medline Plus Health Information
*Kawasaki Disease
The Journal of Immunology, 2005, 175: 8386-8391.
Copyright © 2005 by The American Association of Immunologists

Cloning the Arterial IgA Antibody Response during Acute Kawasaki Disease1

Anne H. Rowley2,*,{dagger}, Stanford T. Shulman*, Francesca L. Garcia*, Judith A. Guzman-Cottrill*, Masaru Miura*, Hannah L. Lee* and Susan C. Baker{ddagger}

Departments of * Pediatrics and {dagger} Microbiology/Immunology, The Feinberg School of Medicine, Northwestern University, The Children’s Memorial Hospital, Chicago, Illinois 60611; and {ddagger} Department of Microbiology/Immunology, Stritch School of Medicine, Loyola University, Maywood, IL 60153


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Kawasaki disease (KD) is the most common acquired cardiac disease in children in developed nations. The etiology of KD is unknown but likely to be a ubiquitous microbial agent. Previously, we showed that oligoclonal IgA plasma cells infiltrate coronary arteries and other inflamed tissues in acute KD. We demonstrated that a synthetic Ab made using an {alpha} H chain sequence prevalent in acute KD arterial tissue detected Ag in acute KD coronary arteries, lung, and other inflamed tissues and that Ag localized to cytoplasmic inclusion bodies in the acute KD ciliated bronchial epithelium. In this study, we synthesized a panel of mAbs from {alpha} and {kappa} chain sequences present in the KD arterial wall and tested the Abs for binding to acute KD tissues. We report that all of the synthetic mAbs that bind to acute KD tissues detect Ag in cytoplasmic inclusion bodies in the acute KD ciliated bronchial epithelium. Abs made from {alpha} sequences that were prevalent in KD arterial tissue show stronger binding to acute KD tissues than Abs made from less prevalent sequences. These findings highlight the likely importance of the inclusion bodies in the etiopathogenesis of acute KD, confirm that the IgA Ab response in acute KD is Ag driven, and demonstrate the usefulness of cloning the Ab response in diseased tissues to identify disease-relevant Ags.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Kawasaki disease (KD)3 is the most common cause of acquired heart disease in children in developed nations (1). Clinical and epidemiological features support an infectious etiology, but the cause remains unknown (1). The Ags involved in the pathogenesis of many human diseases associated with vasculitis, including KD, are uncertain. We reported that IgA plasma cells infiltrate coronary artery and other inflamed tissues in acute KD (2, 3) and that the IgA Abs are oligoclonal (4), leading to the hypothesis that these Abs are being produced in the KD arterial wall to target specific Ags present in the tissue. To determine whether oligoclonal KD Abs bind to Ag(s) in acute KD tissues, we synthesized Abs in vitro using H and L chain variable region sequences identified in acute KD arterial tissue and performed immunohistochemistry experiments on acute KD and control tissues. One of four initially synthesized Abs, Ab A, showed strong binding to an Ag in the acute KD bronchial epithelium and in a subset of macrophages in inflamed acute KD tissues; two of the four showed weak binding with the same localization of Ag (5). Light and electron microscopic studies reveal that the Ag detected by KD synthetic Abs in acute KD ciliated bronchial epithelial cells resides in cytoplasmic inclusion bodies (6).

In this study, we sought to determine whether different KD synthetic Abs would detect Ags with diverse localization in KD tissues (to determine whether multiple different Ags, human and/or microbial, might be involved in pathogenesis) and to determine whether {alpha} sequences that were prevalent in acute KD arterial tissue would yield synthetic Abs that bind more strongly to KD Ag(s) than synthetic Abs made from {alpha} sequences that were less prevalent (to confirm an Ag-driven IgA response in acute KD). Therefore, we synthesized nine additional Abs from both prevalent and less prevalent IgA sequences in acute KD arterial tissue for a total of 13 KD synthetic mAbs, and we tested binding of the Abs to acute KD tissues. We show the first example of cloning the arterial Ab response in a human vasculitis to determine the potential antigenic targets of Abs produced by plasma cells infiltrating the inflamed vascular tissue.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Patients and specimens

Formalin-fixed, paraffin-embedded lung sections from KD patients 2, 7, and 8 (as described in Ref. 5) and patient 3 (as described in Ref. 6) with acute fatal KD were tested; the patients had coronary artery aneurysms at autopsy and died within 8 wk of illness onset. Abs A–J were also tested on coronary artery and lymph node sections from acute KD fatalities (5, 6). The present study was approved by the Institutional Review Board of The Children’s Memorial Hospital.

Isolation of {kappa} clones and DNA sequencing

The {kappa} clones were isolated from a KD arterial cDNA library as described previously for {alpha} clones (4), except a human {kappa} probe (graciously provided by Dr. H.-M. Jäck, University of Erlangen, Erlangen, Germany) was used. Isolated phage clones were amplified using a primer in the pBluescript vector and a primer in the 5' constant region of {kappa}, as described previously for {alpha} clones (4) (primer sequence 5'->3' CACTCTCCCCTGTTGAAGCTC). Clones that yielded a large enough product to contain a variable region (>300 bp) were sequenced as described previously (4), using a primer in the 5' constant region of {kappa}; primer sequence 5'->3' AGCAGGCACACAACAGAGGCAGT.

Synthetic Ab production and labeling

KD synthetic Abs were derived from cDNA library clones containing {alpha} H chain sequences detailed previously (4) and either L chain 9-8 or L chain 6-11 (Table I) using {gamma}1 and {kappa} expression vectors (7). For Abs A–J, {alpha} H chain sequences were used with L chain sequence 9-8. Abs K, L, and M used H chains 2-2, C2, and 11-5, respectively, in combination with L chain 6-11 (Table II). Abs were synthesized and biotinylated as reported previously (5).


View this table:
[in this window]
[in a new window]
 
Table I. {kappa} Sequences Cloned from Acute KD Arterial Tissue (n = 61)

 

View this table:
[in this window]
[in a new window]
 
Table II. KD Synthetic Antibodies

 
Immunohistochemistry experiments

Immunohistochemistry was performed as reported previously (5), using 10–50 µg/ml biotinylated synthetic Ab and a Vectastain Elite ABC kit (Vector Laboratories). Diaminobenzidine tetrahydrochloride was used as a reaction product, to generate a brown stain, and sections were lightly stained with hematoxylin. Synthetic Ab staining was recorded as strong if the distinctive brown spheroid bodies were easily observed in the ciliated bronchial epithelium, comparable to results with KD Ab A: weak if they were present but appeared smaller/sparser than with Ab A, and none if no staining could be visualized (Fig. 1). Blocking experiments were performed by incubating tissue sections with one unlabeled synthetic Ab, followed by incubation with the second labeled synthetic Ab and the DAB-based staining procedure as above.



View larger version (88K):
[in this window]
[in a new window]
 
FIGURE 1. A–C, Binding of KD synthetic Abs to triplicate sections of the ciliated bronchial epithelium from a child with acute fatal KD. A, Ab J shows strong staining (arrows). B, Ab F shows weak staining (arrows). C, Ab I does not bind. D, Ab J does not bind to the control bronchial epithelium from a 3 mo old with pneumonia due to respiratory syncytial virus (eyepiece x10, objective x40).

 
Immunoprecipitation

Lysates from acute KD spleen tissue that was positive by immunohistochemistry using synthetic Abs were subjected to immunoprecipitation with synthetic Abs A–F and J using the Seize X immunoprecipitation kit (Pierce) according to the manufacturer’s instructions, and Western blots of the immunoprecipitated material were probed with biotinylated synthetic Ab at 1–5 µg/ml, followed by avidin-HRP (Pierce) and Super Signal West Pico chemiluminescence substrate (Pierce) according to the manufacturer’s instructions.

Enzyme-linked immunosorbent assays

To determine whether synthetic Abs were anti-Ig Abs, ELISA wells were coated with 100 ng of human IgG (from human serum; Sigma-Aldrich), IgM (myeloma; Jackson ImmunoResearch Laboratories), IgA (from human serum; Jackson ImmunoResearch Laboratories), IgG1 {kappa} (myeloma; Sigma-Aldrich), IgG2 {kappa} (myeloma; Sigma-Aldrich), IgG1 {lambda} (myeloma; Sigma-Aldrich), or purified human {kappa} L chains (myeloma; Sigma-Aldrich) and incubated with biotinylated synthetic Ab at both 0.5 and 5 µg/ml. Wells were then incubated with avidin-HRP (Pierce) and Turbo TMB (Pierce) according to the manufacturer’s instructions, and absorbance at 450 nm was recorded. Positive control wells were incubated with goat anti-human IgG, IgM, and IgA (H and L chains) (Pierce) at 0.5 µg/ml instead of synthetic Ab.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
We synthesized 13 mAbs using prevalent and less prevalent {alpha} H chain sequences reported previously (4) in combination with one of two {kappa} L chain sequences and tested their binding to acute KD tissues.

Analysis of {kappa} L chains

Sixty-one {kappa} L chains were sequenced; these {kappa} sequences were more polyclonal than the {alpha} H chains and are shown in Table I; potential clonally related sequences appear in italic type, as defined by sequences with the same CDR3 length and JK usage with few amino acid differences. The polyclonal nature of the {kappa} sequences is likely explained by the presence of IgM Abs in addition to IgA Abs in the arterial tissue, as described previously (2), potentially increasing the diversity of the L chain sequences in the tissue. The {kappa} sequences 9-8 and 6-11 were selected for Ab production because there appeared to be multiple potentially clonally related sequences corresponding to these variable chains in the tissue; these sequences are indicated in bold type. Although apparent selection of 11 aa CDR3 domains was reported previously among V {kappa} III sequences in the peripheral blood of children with acute KD (8), we found only one 11 aa CDR3 domain among 23 V {kappa} III sequences in the KD arterial wall.

Expression of KD synthetic Abs

Successful Ab production was achieved for three of the five most prevalent {alpha} H chain sequences in KD arterial tissue (2-2, C2, and 11-5) (Table II). We hypothesized that these Abs would be more likely to show strong binding to acute KD tissues than Abs containing less prevalent {alpha} H chain sequences. To test this hypothesis, we also made Abs using seven {alpha} H chain sequences that were represented only once each in the original group of 44 {alpha} sequences (Table II). Singly represented full-length clones were selected at random for Ab production, although H chain clone E1 was chosen for Ab production because the sequence was identified in a limited number of clones in both spleen and arterial tissue from an acute KD patient (4).

Ab production was unsuccessful for the other two prevalent {alpha} H chains. H chain E2, the most prevalent sequence identified in acute KD arterial tissue, was used in multiple transfection experiments with L chains 9-8 and 6-11, but yields of Ab in tissue culture supernatants were too low to allow for successful production, possibly because the L chains did not interact appropriately with the H chain. The three H chain clones obtained from the VH7 group 1 family were not full length; screening the original cDNA library for a full-length VH7 group 1 clone was not successful (data not shown).

Immunohistochemistry results

Abs A, J, K, and M were synthesized from prevalent H chains 2-2 and 11-5 and showed strong binding to acute KD tissues; Abs D and L, made from prevalent H chain C2, did not bind. Of all the Abs synthesized, Abs J and M showed the strongest binding to acute KD tissues. None of seven Abs made from less prevalent sequences found only once each in the original 44 {alpha} sequences as detailed previously (4) showed strong binding to acute KD tissues. Four of the seven less prevalent Abs showed weak binding, and three showed no binding. Immunohistochemistry results using Abs A–D and J on the acute KD bronchial epithelium were demonstrated in our previous reports (5, 6). Results using Abs F, I, and J on the acute KD bronchial epithelium are shown in Fig. 1, and results using Abs K and M are shown in Fig. 2. None of the Abs showed binding to the control bronchial epithelium (results using Ab J are shown in Fig. 1D).



View larger version (79K):
[in this window]
[in a new window]
 
FIGURE 2. Inclusion bodies (arrows) are detected by synthetic Abs M and K in ciliated bronchial epithelium from four different children with acute fatal KD: KD patient 3 (A; Ref. 6 ) and KD patient 7 (B; Ref. 5 ) using synthetic Ab M and KD patient 2 (C; Ref 5 ) and KD patient 8 (D; Ref. 5 ) using synthetic Ab K. Objective x40 or x400.

 
Notably, all Abs that detected Ag in acute KD tissues showed the same pattern of binding as Ab A, to spheroid inclusion bodies in the acute KD ciliated bronchial epithelium and to a subset of macrophages in the inflamed acute KD coronary artery and lymph node (5). Ab E stained KD Ag and a subset of plasma cells in KD and control tissues; none of the other Abs stained plasma cells.

Blocking experiments were performed by incubation of duplicate tissue sections with biotinylated synthetic Ab A and with unlabeled Ab A, followed by biotinylated Ab J. A similar experiment was performed using Ab J as the blocking Ab. These results were somewhat difficult to interpret because duplicate sequential sections incubated with the same synthetic Ab can show somewhat variable intensity of staining. Neither A nor J completely blocked binding of the other Ab, but a partial blocking effect could not be excluded. Because of the limited quantity of tissue samples available from patients with acute fatal KD, blocking experiments could not be performed with every synthetic Ab combination.

Substituting the L chain partner

Substituting L chain 9-8 for L chain 6-11 had minor effects on Ag binding when used in combination with H chains 2-2, C2, and 11-5. Abs D and L both showed negative results, and A and K both showed strong binding. J and M both showed strong binding; J appeared to have overall stronger binding characteristics than M, but this was subtle.

Immunoprecipitation

All Abs gave negative results, with the exception of Ab E. This Ab immunoprecipitated a 22 kDa protein that was identified as Ig {kappa} L chain by MALDI-mass spectrometry (performed at the core protein facility at Columbia University, New York, NY; data not shown).

Enzyme-linked immunosorbent assay

Because synthetic Ab E showed binding to a subset of plasma cells in KD and control lung tissue as well as to KD Ag in the acute KD bronchial epithelium but not control bronchial epithelium, and because it appeared to bind to {kappa} L chain in immunoprecipitation experiments, it was tested in ELISAs to determine whether it was an anti-Ig Ab. Ab E gave positive results in ELISAs using polyclonal IgG and IgA from human serum and negative results using myeloma Abs IgM {kappa}, IgG1 {kappa}, and IgG1 {lambda}. It gave weakly positive results using myeloma IgG2 {kappa} and purified {kappa} chains. Abs A, D, and H, which show binding to KD Ag but not to plasma cells, were also tested and did not demonstrate any binding to any of the above Igs. Ab E did not react with Ab A when A was used to coat ELISA wells. From these results, we concluded that Ab E binds to a subset of {kappa} L chains and therefore more likely interacts with the variable region of {kappa} than the constant region. Because Ab E binds to both a subset of {kappa} Abs and to KD Ag, it most likely reacts with immune complexes, probably directed at a conformational epitope of an Ag-Ab complex in which KD Ag interacts with the {kappa} L chain.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
In this study, we cloned the IgA immune response using Ig {alpha} sequences that we identified previously in the KD arterial wall (4) and obtained the somewhat unexpected result that the synthetic Abs made from these sequences that bind to acute KD tissues all appear to bind to cytoplasmic inclusion bodies in the acute KD ciliated bronchial epithelium. This result emphasizes the likely importance of these inclusions in disease etiopathogenesis. We also found that Abs made from two prevalent {alpha} H chains, 2-2 and 11-5, bind more strongly to acute KD tissues than do Abs made from less prevalent {alpha} chains, as would be expected in an Ag-driven response.

Although we did not originally anticipate that all synthetic Abs that detected Ags in acute KD tissues would show the same pattern of binding, this result is consistent with the detection of a microbial pathogen. Abs to certain microbial Ags can dominate the immune response. For example, Burgoon et al. (9, 10) prepared synthetic Abs from overrepresented IgG sequences in the brains of patients with subacute sclerosing panencephalitis (SSPE) and demonstrated that all of the synthetic Abs that bound to SSPE brain tissue reacted with measles virus nucleocapsid.

Because the H chain is more important than the L chain for Ag binding (11, 12), we performed these studies with {alpha} H chain sequences in random combination with one of two {kappa} L chains. However, on occasion, changing an L chain partner can drastically affect Ag binding (13); it is possible that H chain C2 (Abs D and L) requires an L chain partner other than 9-8 or 6-11 (either a {kappa} or a {lambda} L chain) to assume the optimal conformation for Ag binding. Moreover, the affinity of a synthetic Ab for its Ag can be reduced significantly with the wrong L chain partner, even if some binding is preserved. Burgoon et al. (9) prepared synthetic Abs from SSPE patients using random combinations of L and H chains, similar to our study. They found that these Abs all detected measles virus nucleocapsid Ag in infected cells but did not bind to Ag in immunoblots or immunoprecipitations (9). However, when they isolated single plasma cells and performed RT-PCR to determine correct L and H chain partners, Abs made from the correct pairing detected measles virus nucleocapsid Ag in infected cells and also bound to Ag in immunoblot assays (10). In limited Western blot and immunoprecipitation studies on acute KD spleen tissue that gave positive results by immunohistochemistry, and more extensive screening of a cDNA expression library made from this tissue (data not shown), we have not detected Ag using our synthetic Abs (except for {kappa} L chain as described above for Ab E). This interesting parallel between our work and the work of Burgoon et al. (9, 10) of measles in patients with SSPE, in which synthetic Abs made from random pairing of L and H chains detect Ag in cells but not in immunoblots and immunoprecipitations, has led us to begin studies to perform RT-PCR on single isolated plasma cells in acute KD arterial tissue, to obtain the correct L and H chain pairings, so that we can test these new Abs in immunohistochemistry, immunoblot, immunoprecipitation, and cDNA library screening experiments.

Interestingly, one of the 13 synthetic Abs, Ab E, appeared to bind to both KD Ag and to a subset of Ig {kappa} molecules. It is possible that the binding features of this Ab were the result of an incorrect L chain (9-8) used with H chain 2-1 and that pairing H chain 2-1 with the correct L chain would have resulted in an Ab that only bound to KD Ag. However, anti-Ab responses have been linked to infectious agents, particularly those that expose highly ordered repetitive antigenic epitopes and form immune complexes in vivo (14). It has been postulated that anti-idiotypic Abs formed during infection may enhance the immunopathology of disease (14).

The panel of monoclonal KD Abs synthesized in this study have been useful in demonstrating that the IgA immune response in the acute KD arterial wall is Ag driven and that Ag(s) localized to cytoplasmic inclusion bodies in the acute KD ciliated bronchial epithelium appear to be a primary target of the IgA immune response in acute KD, emphasizing the importance of identifying these Ags. The extreme scarcity of fresh or frozen tissue samples from acute KD patients has slowed progress considerably in identifying the Ag(s) present in the inclusions. These inclusion bodies can be visualized using a variety of light microscopy stains and are revealed by transmission electron microscopy to be regular, homogeneous inclusion bodies that resemble aggregates of viral proteins and nucleic acids, such as nucleocapsid aggregates of the Paramyxoviridae (6). We cannot find a precedent for a human Ag to localize to intracellular inclusion bodies during an acute human illness, but numerous infectious agents (mostly viral) can result in inclusion body formation in acutely infected cells (15, 16, 17, 18, 19).

Identification of the Ags important in KD pathogenesis is critical to understanding the etiology and pathogenesis of this potentially fatal illness of childhood. In vitro synthesis of Abs made by plasma cells that infiltrate diseased tissue and their use as reagents to detect target Ags, as in our studies of KD and in those of Burgoon et al. (9, 10) to study SSPE, may also prove useful in determining the pathogenesis of other infectious and inflammatory disorders, including other vascular diseases in which plasma cell infiltration into vascular tissues is observed.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by National Institutes of Health Grants K02 HL67011 and R01 HL63771 (to A.H.R.) and the Kawasaki Disease Research Fund of The Children’s Memorial Hospital. Back

2 Address correspondence to Dr. Anne H. Rowley, Feinberg School of Medicine, Northwestern University, Pediatrics W140, Ward 12-204, 303 East Chicago Avenue, Chicago, IL 60611. E-mail address: a-rowley{at}northwestern.edu Back

3 Abbreviations used in this paper: KD, Kawasaki disease; SSPE, subacute sclerosing panencephalitis. Back

Received for publication August 2, 2005. Accepted for publication October 3, 2005.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Rowley, A. H., S. T. Shulman. 2004. Kawasaki disease. R. E. Behrman, and R. M. Kliegman, and H. B. Jenson, eds. Nelson Textbook of Pediatrics 17th Ed.823-826. Saunders, Philadelphia.
  2. Rowley, A. H., C. A. Eckerley, H. M. Jack, S. T. Shulman, S. C. Baker. 1997. IgA plasma cells in vascular tissue of patients with Kawasaki syndrome. J. Immunol. 159: 5946-5955. [Abstract]
  3. Rowley, A. H., S. T. Shulman, C. A. Mask, L. S. Finn, M. Terai, S. C. Baker, et al 2000. IgA plasma cell infiltration of proximal respiratory tract, pancreas, kidney, and coronary artery in acute Kawasaki disease. J. Infect. Dis. 182: 1183-1191. [Medline]
  4. Rowley, A. H., S. T. Shulman, B. T. Spike, C. A. Mask, S. C. Baker. 2001. Oligoclonal IgA response in the vascular wall in acute Kawasaki disease. J. Immunol. 166: 1334-1343. [Abstract/Free Full Text]
  5. Rowley, A. H., S. C. Baker, S. T. Shulman, F. L. Garcia, J. A. Guzman-Cottrill, P. Chou, et al 2004. Detection of antigen in bronchial epithelium and macrophages in acute Kawasaki disease by use of synthetic antibody. J. Infect. Dis. 190: 856-865. [Medline]
  6. Rowley, A. H., S. C. Baker, S. T. Shulman, L. M. Fox, K. Takahashi, F. L. Garcia, S. E. Crawford, P. Chou, J. M. Orenstein. 2005. Cytoplasmic inclusion bodies are detected by synthetic antibody in ciliated bronchial epithelium during acute Kawasaki disease. J. Infect. Dis. 192: 1757-1766. [Medline]
  7. Persic, L., P. Roberts, J. Wilton, A. Cattaneo, A. Bradbury, H. R. Hoogenboom. 1997. An integrated vector system for the eukaryotic expression of antibodies or their fragments after selection from phage display libraries. Gene 187: 9-18. [Medline]
  8. Kim, D. S., B. H. Han, S. K. Lee, H. K. Lee, Y. J. Chwae, K. Y. Lee. 1997. Evidence for selection of 11 amino acid CDR3 domains in V{kappa}III-derived immunoglobulin light chains in Kawasaki disease. Scand. J. Rheumatol. 26: 350-354. [Medline]
  9. Burgoon, M. P., G. P. Owens, T. Smith-Jensen, D. Walker, D. H. Gilden. 1999. Cloning the antibody response in humans with inflammatory central nervous system disease: analysis of the expressed IgG repertoire in subacute sclerosing panencephalitis brain reveals disease-relevant antibodies that recognize specific measles virus antigens. J. Immunol. 163: 3496-3502. [Abstract/Free Full Text]
  10. Burgoon, M. P., K. M. Keays, G. P. Owens, A. M. Ritchie, P. R. Rai, C. D. Cool, D. H. Gilden. 2005. Laser-capture microdissection of plasma cells from subacute sclerosing panencephalitis brain reveals intrathecal disease-relevant antibodies. Proc. Natl. Acad. Sci. USA 102: 7245-7250. [Abstract/Free Full Text]
  11. Hoogenboom, H. R., G. Winter. 1992. By-passing immunization: human antibodies from synthetic repertoires of germline VH segments rearranged in vitro. J. Mol. Biol. 227: 381-388. [Medline]
  12. Xu, J. L., M. M. Davis. 2000. Diversity in the CDR3 region of VH is sufficient for most antibody specificities. Immunity 13: 37-45. [Medline]
  13. Brown, M., M. Stenzel-Poore, S. Stevens, S. K. Kondoleon, H. P. Bachinger, M. B. Rittenberg. 1992. Immunologic memory to phosphocholine keyhole limpet hemocyanin. Recurrent mutations in the lambda 1 light chain increase affinity for antigen. J. Immunol. 148: 339-346. [Abstract]
  14. Fehr, T., M. F. Bachmann, E. Bucher, U. Kalinke, F. E. DiPadova, A. B. Lang, H. Hengartner, R. M. Zinkernagel. 1997. Role of repetitive antigen patterns for induction of antibodies against antibodies. J. Exp. Med. 185: 1785-1792. [Abstract/Free Full Text]
  15. Bryson, D. G., M. S. McNulty, R. M. McCracken, P. F. Cush. 1983. Ultrastructural features of experimental parainfluenza type 3 virus pneumonia in calves. J. Comp. Pathol. 93: 397-414. [Medline]
  16. Goldsmith, C. S., K. M. Tatti, T. G. Ksiazek, P. E. Rolin, J. A. Comer, W. W. Lee, P. A. Roat, B. Bankamp, W. J. Bellini, S. R. Zaki. 2004. Ultrastructural characterization of SARS coronavirus. Emerging Infect. Dis. 10: 320-326. [Medline]
  17. Gilka, F., J. Spencer. 1985. Viral matrix inclusion bodies in myocardium of lymphoid leukosis virus-infected chickens. Am. J. Vet. Res. 46: 1953-1960. [Medline]
  18. Hyatt, A. D., P. W. Selleck. 1996. Ultrastructure of equine morbillivirus. Virus Res. 43: 1-15. [Medline]
  19. Wong, K. T., W. J. Shieh, S. Kumar, K. Norain, W. Abdullah, J. Guarner, C. S. Goldsmith, K. B. Chua, S. K. Lam, C. T. Tan, et al 2002. Nipah virus infection. Pathology and pathogenesis of an emerging paramyxoviral zoonosis. Am. J. Pathol. 161: 2153-2167. [Abstract/Free Full Text]



This article has been cited by other articles:


Home page
CirculationHome page
H. Senzaki
Long-Term Outcome of Kawasaki Disease
Circulation, December 16, 2008; 118(25): 2763 - 2772.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rowley, A. H.
Right arrow Articles by Baker, S. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rowley, A. H.
Right arrow Articles by Baker, S. C.
Right arrowPubmed/NCBI databases
*Protein
*Substance via MeSH
Medline Plus Health Information
*Kawasaki Disease


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS