|
|
||||||||


* Department of Pharmacology and
Division of Gastroenterology, Department of Internal Medicine and Primary Care Medicine, College of Medicine, National Taiwan University and National Taiwan University Hospital, Taipei, Taiwan
| Abstract |
|---|
|
|
|---|
B on the COX-2 promoter, are involved in MAPKs-regulated COX-2 expression. Differential bindings of the CREB-1, ATF-2, c-jun to the CRE site, and the c-fos, c-jun, ATF-2 to the AP1 site are demonstrated by DNA affinity protein-binding, supershift, and chromatin immunoprecipitation assays. Activations of these transcription factors were attenuated by different MAPKs inhibitors. The mutants of TLR2, TLR9, or MAPKs inhibited H. pylori-induced COX-2 promoter, CRE, and AP-1 activities. MAPKs inhibitors attenuated the H. pylori-induced COX-2 mRNA and protein expressions. These results indicate that H. pylori acts through TLR2 and TLR9 to activate MAPKs, especially p38, and their downstream transcription factors (CREB-1, ATF-2, c-jun, and c-fos), resulting in the activations of CRE and AP-1 on the COX-2 promoter. These intracellular networks drive the COX-2-dependent PGE2 release and contribute to cell invasion and angiogenesis. | Introduction |
|---|
|
|
|---|
Epithelial cells, like macrophages, recognize microbial infections through TLRs, which recognize conserved motifs on pathogens that are not found in higher eukaryotes (12). All TLRs activate a common signaling pathway that culminates into the activation of NF-
B and MAPKs (13). The involvement of TLR2 and TLR9 in H. pylori-induced COX-2 expression via the PKC/c-Src/NF-
B activation pathway has been reported from this lab (14). Activations of MAPKs by H. pylori have been reported and found to regulate the expressions of many genes such as matrix metalloproteinase 7 and IL-8 (15, 16). Therefore, the role of TLR2 and TLR9 in MAPKs activation induced by H. pylori leading to COX-2 expression is further investigated in this study.
Our recent study has demonstrated that H. pylori strains isolated from gastric cancer patient (HC) induced a higher COX-2 expression than those from gastritis and peptic ulcer. However, the virulence genes of iceA, vacA, babA2, cagA 3' repeat region and hrgA among various H. pylori strains failed to show any association with COX-2 expression despite a higher COX-2 induction capability of HC (14). Involvement of cAMP response element (CRE) site in the H. pylori-induced COX-2 expression was demonstrated (14). The importance of CRE and/or AP-1 sites in mediating COX-2 transcription, particularly on the murine and human promoter has been reported (17, 18, 19, 20). The AP-1 site (67/61) on the human COX-2 promoter adjacent to the downstream CRE site (59/53) and to the upstream pNFAT site (76/68) was first mentioned by Fresno and colleagues (17) and Flamand and colleagues (18). By probing consensus sequences containing both CRE and AP-1 sites, Dannenberg and colleagues (21, 22) demonstrated that AP-1 components bind to the CRE site. However, the individual role of CRE and AP-1 could not be clearly differentiated because AP-1 components probably bind to the AP-1 and/or CRE sites. In the present study, DNA affinity protein-binding and gel shift assays were performed using probes containing CRE and AP-1 site consensus sequences, respectively. Thus, the components binding to the CRE or AP-1 site could be clearly distinguished.
The investigation of the relationship between H. pylori infection, COX-2 overexpression, and gastric cancer development is still lacking. In this study, we explored a novel intracellular network involving TLRs, MAPKs, and transcription factors binding to the CRE and AP1 sites on the human COX-2 promoter, leading to COX-2 expression and PGE2 release, which in turn promote gastric cancer cell invasion and angiogenesis.
| Materials and Methods |
|---|
|
|
|---|
H. pylori strains were isolated from patients undergoing gastroscopy for the evaluation of upper gastrointestinal symptoms. At the time of endoscopy, two biopsy specimens were taken from the antrum for bacterial culture. Different strains of clinical H. pylori isolates from patients with nonulcer dyspepsia with gastritis, duodenal ulcer, and gastric cancer were termed as HS, HD, and HC, respectively. Columbia agar with 5% sheep blood was used for H. pylori culture. The bacterial cells were cultured at 37°C in a microaerophilic chamber (Don Whitley) containing 10% CO2, 5% O2, and 85% N2. Bacterial cells were grown for 48 h on Columbia agar plates, which were collected and washed with PBS buffer (pH 7.4). Finally, the bacterial cells were pelleted. Cell pellets were then resuspended in PBS buffer (pH 7.4) and used for the infection experiment (14).
Cell culture and H. pylori infection experiments
The human gastric cancer epithelial cell lines AGS (American Type Culture Collection (ATCC) no. CRL-1739) and MKN45 (Japanese Cancer Research Bank no. 0254) were obtained from the ATCC and RIKEN, respectively. Both of them were cultured in RPMI 1640 supplemented with 10% FCS, 100 U/ml penicillin, and 100 µg/ml streptomycin. AGS and MKN45 cells were cocultured with H. pylori in the antibiotics-free RPMI 1640 supplemented with 10% FCS. Bacterial cells were resuspended in PBS (pH 7.4) and diluted to the multiplicity of infection (MOI) of 150:1. Cells were cocultured with bacteria for 16 h. Media were collected from the cells cocultured with bacteria from different time points.
AGS cells were transfected with the COX-2-expressing pcDNA3 vector containing a 1.9-kbp cDNA fragment of human COX-2 or pcDNA3 control vector only using liposomal transfection reagent TransFast (Promega) according to the manufacturers instructions. After 24 h of transfection, cells were replaced in the complete medium with 600 µg/ml G418. Stable G418-resistant transfectants (the COX-2-expressing clone AGS/COX-2 and the control clone AGS/pcDNA3) were selected and expanded.
Preparation of cell extracts and Western blot analysis
After incubation with H. pylori, cells were rapidly washed with PBS to remove bacteria and lysed with the ice-cold lysis buffer (50 mM Tris-HCl (pH 7.4), 1 mM EGTA, 1 mM NaF, 150 mM NaCl, 1 mM PMSF, 5 µg/ml leupeptin, 20 µg/ml aprotinin, 1 mM Na3VO4, 10 mM
-glycerophosphate, 5 mM sodium-pyrophosphate, 1% Triton X-100). The cell lysate was subjected to SDS-PAGE using 10% for the running gel. The proteins were transferred to the nitrocellulose paper, and Western blot was performed as described previously (23).
PGE2 release ELISA
PGE2 was quantified from the collected media using ELISA by a commercial kit from Amersham Biosciences according to the manufacturers instructions.
In vitro invasion assay
The invasion assay was conducted using the Transwell cell culture chambers (Corning Costar; No. 3422) according to the manufacturers recommendation with some modifications. Briefly, polyvinylpyrrolidone-free polycarbonate filters (8.0 µm pore size; Nuclepore) were precoated with 5 µg of Matrigel (BD Biosciences) on the upper surface. AGS or MKN45 cells were harvested with 1 mM EDTA and resuspended in the antibiotics-free RPMI 1640 supplemented with 0.1% FBS. The cell suspension (2.5 x 104 cells) was added to the upper compartment of the chamber. Six hours later, cells were cocultured with H. pylori after the pretreatment with either NS-398, celecoxib, or PGE2 for 30 min. After 48 h incubation, the top side of the insert membrane was scrubbed free of cells with a cotton swab. The bottom side was fixed with 3.7% paraformaldehyde and stained with 0.5% crystal violet in 20% methanol. The crystal violet dye retained on the filters was extracted with DMSO and colorimetrically assessed by measuring its absorbance at 590 nm on an ELISA reader (Bio-Tek).
In vitro tube formation assay
HUVECs, between passages 2 and 4, were plated on a 10-cm dish and grown to confluence. The cells were synchronized in 2% serum containing M199 for 24 h before they were plated in 24-well plates (5 x 104/well) coated with 240 µl of Matrigel (diluted 1/1 in serum-free RPMI 1640). The condition media, which were serum-free supernatants collected from either AGS or MKN45 cells infected with H. pylori for 16 h, were added to the HUVECs and incubated for 5 h. Subsequently, the cells were fixed by 3.7% paraformaldehyde and visualized with the microscope using a x10 objective. Endothelial cells form the connective and complete tube-like structures with branches when cultured in the appropriate media. The number of tubes was quantified in six different fields for each culture (24). Quantification of tube formation was shown as relative to the control.
DNA affinity protein-binding assay (DAPA)
Binding of transcriptional factors to the COX-2 promoter DNA sequences was assayed. After coculture with H. pylori for the indicated time, nuclear extracts were prepared. The biotin-labeled double-stranded oligonucleotides were synthesized based on the human COX-2 promoter sequence (25). "CRE + AP1 wt" (sense, 5'-biotin-AAGAAACAGTCATTTCGTCACATGG-3'; antisense, 5'-CCATGTGACGAAATGACTGTTTCTT-3') contains the CRE and AP1 binding sites; "CRE mut" (sense, 5'-biotin-AAGAAACAGTCATTTGAGCTCATGG-3'; antisense, 5'-CCATGAGCTCAAATGACTGTTTCTT-3') contains wild-type (wt) AP1 and mut CRE; "AP1 mut" (sense, 5'biotin-AAGAAACAGCTGTTTCGTCACATGG-3'; antisense, 5'-CCATGTGACGAAACAGCTGTTTCTT-3') contains mut AP1 and wt CRE. The sequence underlined means the "core region" for the transcription factor binding sites, and the sequence with italic type means the "mutated base pair." The binding assay was performed by mixing 200 µg of nuclear extract proteins, 2 µg of biotin-labeled DNA oligonucleotides, and 20 µl of streptavidin agarose beads (4%) with 70% slurry. The mixture was incubated at room temperature for 1 h with shaking. Beads were pelleted and washed with cold PBS three times. The bound proteins were separated by SDS-PAGE, followed by Western blot analysis, and finally probed with specific Abs.
Preparation of nuclear extracts and the EMSA
AGS cells cocultured with H. pylori for the indicated time were washed with PBS several times, and nuclear extracts were prepared as described previously (14). Oligonucleotides corresponding to the consensus sequences on the human COX-2 promoter, including "AP1 + CRE wt" (5'-AAGAAACAGTCATTTCGTCACATGG-3'), which contains the AP1 and CRE binding site; "AP1" (5'-AGAAACAGTCATTTC-3'), which contains the AP1 binding site; "CRE" (5'-CATTTCGTCACATGG-3'), which contains the CRE binding site, were synthesized, annealed, and end-labeled with [
-32P]ATP using T4 polynucleotide kinase. EMSA was performed as described previously (23). When supershift assays were performed, polyclonal Abs specific to c-fos, c-jun, CREB-1, ATF-2, and p65 were added to the nuclear extracts 30 min prior the binding reaction, and the DNA/nuclear protein complexes were separated on a 4.5% polyacrylamide gel.
Chromatin immunoprecipitation (ChIP) assay
ChIP analysis was performed as described (26). Immunoprecipitated DNA was purified and amplified across the COX-2 promoter region using the 5' primers 119TAAGGGGAGAGGAGGGAAAAAT97 and 3' primer +6ACAATTGTCGCTAACCGAG14. PCR products were then resolved in a 1.5% agarose gel.
RT-PCR
Total RNA was isolated from AGS cells using TRIzol Reagent (Invitrogen Life Technologies). The reverse transcription reaction was performed using 2 µg of total RNA, which was reverse transcribed into cDNA using the oligo dT primer, then the cDNA was amplified for 30 cycles using two oligonucleotide primers derived from a published COX-2 sequence (5'-CAGCACTTCACGCATCAGTT-3' and 5'-TCTGGTCAATGGAAGCCTGT-3'), c-fos sequence (5'-GAATAACATGGCTGTGCAGCCAAATGCCGCAA-3' and 5'-CGTCAGATCAAGGGAAGCCACAGACATCT-3'), c-jun sequence (5'-GGAAACGACCTTCTATGACGATGCCCTCAA-3' and 5'-GAACCCCTCCTGCTCATCTGTCACGTTCTT-3'), and two oligonucleotide primers from a
-actin sequence (5'-TGACGGGGTCACCCACACTGTGCCCATCTA-3' and 5'-CTAGAAGCATTTGCGGGGACGATGGAGGG-3'). For COX-2, a PCR cycle consisted of a denaturation step (94°C, 1 min), an annealing step (60°C, 1 min for COX-2 and actin; 58°C, 1 min for c-fos and c-jun), and an elongation step (72°C, 1.5 min). The total reaction took 35 cycles, which was followed by an additional extension step (72°C, 7 min). For
-actin, PCR cycle was conducted for 30 s at 94°C, 30 s at 65°C, and 1 min at 70°C. The PCR products were subjected to electrophoresis in a 1.5% agarose gel. Quantitative data was obtained using a computing densitometer and ImageQuant software (Molecular Dynamics).
Plasmids
The COX-2 promoter construct pGS459 (459/+9) was a generous gift from Dr. L. H. Wang (University of Texas, Houston, TX). CRE (CRE-Luc), AP1 (AP1-Luc), and NF-
B (
B-Luc) luciferase reporters were from Stratagene. The dominant-negative mutant of ERK2 was from Dr. M. Cobb (South-Western Medical Center, Dallas, TX). p38 (T180A/T182F) was from Dr. J. Han (The Scripps Research Institute, San Diego, CA). JNK (T183A/Y185F) was from Dr. M. Karin (University of California, San Diego, CA). The mutant of TLR2 (P/H) was from Dr. T. Muta (Kyushu University, Fukuoka, Japan) was generated as described previously (27). The mutant of TLR9 (ICD) was from Dr. K. J. Ishii (Food and Drug Administration, Bethesda, MD).
Transient transfection and luciferase activity assay
AGS cells grown to 60% confluence in 12-well plates were transfected with either the human COX-2 pGS-459 or Luc-reporters using SuperFect (Qiagen) according to the manufacturers instructions. Briefly, reporter DNA (0.3 µg) and
-galactosidase DNA (0.15 µg; pRK plasmid containing the
-galactosidase gene driven by the constitutively active SV40 promoter was used to normalize the transfection efficiency) were mixed with 0.45 µl of SuperFect in 0.4 ml of serum-free RPMI 1640. After 1015 min of incubation at room temperature, the mixture was applied to the cells. Six hours later, 0.4 ml of RPMI 1640 with 20% FCS was added. Twenty four hours after transfection, the cells were changed into an antibiotic-free medium, and the cells were treated with inhibitors (as indicated) for 30 min and incubated with H. pylori for 6 h. Cell extracts were then prepared, and the luciferase and
-galactosidase activities were measured. The luciferase activity was normalized to the
-galactosidase activity.
In experiments using dominant-negative mutants, cells were cotransfected with reporter (0.3 µg),
-galactosidase (0.15 µg), and the mutant of TLR2 or TLR9, the dominant-negative mutant of ERK, p38, or JNK, or the empty vector (0.6 µg). In experiments using the wt plasmids, cells were cotransfected with 0.3 µg of reporter plasmid, 0.15 µg of
-galactosidase plasmid, 0.45 µg of the wt TLR2, 0.6 µg of the dominant-negative mutant of ERK, p38, or JNK, or the empty vector.
Statistical analysis
Data were analyzed using Students t test. Values of p < 0.05 were considered significant.
| Results |
|---|
|
|
|---|
Different strains of H. pylori from patients with gastric cancer (HC), gastritis (HS), and duodenal ulcer (HD) were analyzed for their capability to induce COX-2 expression and PGE2 release in the gastric epithelial cells, AGS and MKN45. As in our previous report (14) and as shown in Fig. 1, A and C, HC induced a time-dependent increase of COX-2 expression and PGE2 release in AGS cells. It was evident at 6 h after H. pylori infection and reached maximum at 24 h. A similar result was also observed in MKN45 cells after coculture with HC (Fig. 1, B and D). COX-2 expression and PGE2 release were seen in MKN45 cells induced by HD. However, the extent was smaller than that of HC. To evaluate the role of H. pylori-induced COX-2 expression in malignant gastric cell invasion, a Matrigel assay was performed. The invasion of AGS cells was induced by HC, but not HS and HD, and HC-induced AGS cell invasion was inhibited by two COX-2 inhibitors, NS-398 and celecoxib (Fig. 1E). To investigate the mechanism of COX-2-dependent gastric tumor cell invasion, exogenous PGE2 was added. PGE2 (50 nM) enhanced cell invasion and reversed the inhibition of NS-398 (Fig. 1E). Similar results were seen in MKN45 cells cocultured with HC (Fig. 1F). HD, which induced COX-2 expression and PGE2 release in the MKN45 cells, also elicited MKN45 cell invasion (Fig. 1F).
|
H. pylori acts through TLR2/TLR9-mediated COX-2 to induce tumor cell invasion and tube formation
Because TLR2 and TLR9 were demonstrated to be involved in the H. pylori-induced COX-2 expression (14), their role in the H. pylori-induced cell invasion was examined. The AGS cell line overexpressing COX-2, AGS/COX-2, was established and used to examine the role of COX-2 in cell invasion and angiogenesis. As shown in Fig. 2A, this stable clone had an abundant expression of COX-2 and showed high invasiveness comparing to the mock, AGS/pcDNA3. Neutralizing Abs to TLR2 and TLR9 attenuated the H. pylori-induced cell invasion, but they did not affect the invasiveness of AGS/COX-2 cells (Fig. 2A). These results demonstrated that H. pylori induced cell invasion via TLR2/TLR9-mediated COX-2 expression in AGS cells.
|
Bindings of CREB-1, ATF-2, c-jun, and c-fos to the CRE and AP-1 elements on the COX-2 promoter
The CRE site (59/53) on the human COX-2 promoter is adjacent to the upstream AP-1 site (67/61) (Fig. 3A). DAPA experiments were performed to analyze the transcription factor binding to the respective CRE and AP-1 elements after H. pylori infection. A time-dependent increase in the bindings of CREB1, ATF-2, c-jun, and c-fos to the CRE plus AP1 site were found. The p65, which is a component of NF-
B, did not bind to the CRE plus AP1 site (Fig. 3B). Probes containing consensus sequences of CRE plus AP1, with CRE mutation (CRE mut) or AP1 mutation (AP1 mut) were used to clarify the component binding to the CRE and AP1 sites, respectively. Increases in the binding of CREB-1, ATF-2, and c-jun to the CRE site (Fig. 3C, compare lanes 6 and 5), and c-fos, c-jun, and ATF-2 to the AP1 site (Fig. 3C, compare lanes 4 and 3) after H. pylori infection were identified.
|
The in vivo recruitments of CREB1, ATF-2, c-jun, and c-fos to the COX-2 promoter induced by H. pylori were demonstrated by ChIP assay. As shown in Fig. 3F, time-dependent increases in the binding of these transcription factors to the promoter region 109/+7 containing CRE and AP1 sites were found.
Regulation of H. pylori-induced c-fos and c-jun mRNA expressions, and CREB-1 and ATF-2 activations by MAPKs
Because c-fos and/or c-jun were demonstrated to be the components binding to the CRE and AP1 sites, their transcriptional regulations were examined. Time-dependent increases in the c-fos and c-jun mRNA expressions in AGS cells infected by H. pylori were seen (Fig. 4A). Because the expressions of c-fos and c-jun were regulated by MAPKs (28), the roles of ERK1/2, p38, and JNK in this event were examined. Similar to our previous findings (28), PD98059 (50 µM) blocked TNF-
-induced ERK1/2 activation without having any effect on the p38 and JNK activations, and SB 203580 (30 µM) caused complete inhibition on p38 activation without affecting ERK1/2 and JNK activations. SP600125 inhibited JNK1/2 activation in a dose-dependent manner without any effect on ERK1/2 and p38 activations (data not shown). PD98059 and SB203580 were shown to inhibit the H. pylori-induced c-fos mRNA expression, whereas SB203580 and SP600125 inhibited the c-jun mRNA expression (Fig. 4B, lanes 3 and 4; lanes 46). Taken together, these results indicated the involvement of ERK and p38, not JNK, in the regulation of c-fos mRNA expression and p38 and JNK, not ERK, in the c-jun mRNA expression.
|
Involvements of TLR2/9, ERK, p38, and JNK in H. pylori-mediated COX-2 promoter activity via activations of CRE and AP-1
Because TLR2/9 and CRE and AP-1 sites on the COX-2 promoter were demonstrated to be involved in the H. pylori-induced COX-2 expression, H. pylori-induced CRE and AP-1 activation through TLR2/9 was examined. As shown in Fig. 5, A and B, H. pylori-induced CRE and AP-1 luciferase activities were inhibited by the TLR2 and TLR9 mutants, suggesting the involvements of these two TLRs. Because the binding components of CRE and AP-1 sites and their regulations by MAPKs were demonstrated, the roles of MAPKs in regulating the H. pylori-induced CRE and AP-1 luciferase activities were further confirmed using the dominant-negative p38, ERK2, and JNK mutants (Fig. 5, C and D).
|
B by H. pylori to induce COX-2 expression was recently found by this lab (14). To examine the possible involvement of MAPKs in regulating NF-
B activity, H. pylori-induced NF-
B-luc activity was examined in the presence of the dominant-negative mutants of MAPKs. In Fig. 5E, the induction of NF-
B activity by H. pylori was not affected by these dominant-negative mutants, and the H. pylori-induced I
B
degradation was not reversed by either PD98059, SB308520, or SP600125 (Fig. 5F, lanes 36). These results suggested that MAPKs do not act through the NF-
B site to induce COX-2 expression in the H. pylori-infected AGS cells. Because MAPKs-regulated CRE and AP-1 sites were found to be involved in the H. pylori-induced COX-2 expression, the role of MAPKs in the H. pylori-induced COX-2 promoter activity was examined. As shown in Fig. 5G, the COX-2 promoter activity was stimulated by HC but not HS, which was in line with the results that HC, but not HS, could induce COX-2 expression in AGS cells (Ref.14 ; Fig. 1A). H. pylori-induced COX-2 promoter activity was really inhibited by the MAPKs inhibitors and their dominant-negative mutants (Fig. 5, H and I). The H. pylori-induced COX-2 mRNA and protein were also attenuated by the MAPKs inhibitors (Fig. 5, J and K), confirming the involvements of ERK, p38, and JNK in the H. pylori-induced CRE and AP1 activations and the COX-2 expression.
| Discussion |
|---|
|
|
|---|
B signaling via TLR2 but not TLR4 (36, 37, 38), and finding of TLR9 expression on the gastric epithelial cell surface (39). Moreover, TLR2 and TLR9 agonists were found to promote an angiogenic switch (40). These findings together revealed a novel function of TLR2 and TLR9 in H. pylori-induced COX-2 expression, cell invasion, and angiogenesis. However, the addition of both anti-TLR2 and TLR9 Abs to the culture could not completely block cell invasion and tube formation (data not shown), indicating that other TLR receptors or alternative mechanisms may be functional. The effectiveness of NS-398 or celecoxib on inhibiting cell invasion and angiogenesis of AGS and MKN45 gastric cancer cell lines points to a promising therapeutic target for gastric cancer prevention and treatment, as exemplified by the great success of COX-2 inhibitor in the colon cancer prevention and treatment (41). Therefore, COX-2 and its metabolites are the necessary "angiogenic" and "invasive/permissive" factors and are sufficient to induce tumor invasiveness and angiogenesis. Recently, the use of nonsteroidal anti-inflammatory drugs is also reported to be associated with a decreased risk of gastric cancer in a systematic review and metaanalysis of epidemiological evidence (42). Intriguingly, the protective effect of nonsteroidal anti-inflammatory drugs was observed only in individuals who were H. pylori IgG-positive but not in noninfected subjects (43).
The mechanism that H. pylori induced COX-2 expression at transcriptional level was further examined. Our recent data demonstrated the involvements of CRE (59/53), NF-IL6, and NF-
B sites in the H. pylori-induced COX-2 expression (14). Juttner et al. (44) also reported the involvement of CRE/E box (56/48) in H. pylori-induced COX-2 expression. However, we further verified and investigated the AP-1 element (67/61). The transcription factors of AP-1 family (Fos, Jun, and ATF) and CREB/ATF family (ATF and CREB) can form either homo- or heterodimer. Jun-Jun and Jun-Fos dimers preferentially bind to the AP-1 site, whereas Jun-ATF prefers binding to the CRE sequence (45). Using DAPA and supershift assays, the respective bindings of CREB-1, ATF-2, and c-jun to the CRE site, and c-fos, c-jun, and ATF-2 to the AP1 site after H. pylori coculture were demonstrated. In addition, ChIP assays demonstrated the in vivo recruitments of CREB-1, ATF-2, c-jun, and c-fos to the proximal sites of COX-2 promoter (109/+7). We are the first to clearly verify the respective binding components of CRE and AP-1 sites on the COX-2 promoter both in vivo and in vitro. Dannenberg and colleagues and others claimed the binding of AP-1 components to the CRE site using oligonucleotide consensus sequences containing both CRE and AP-1 sites (21, 22, 46). In their experiments, the individual role of CRE and AP-1 could not be clearly differentiated because they claimed the bindings of c-fos, c-jun, and ATF-2 (AP-1 components) to the CRE site (21). However, Bowden and colleagues (47) found the bindings of CREB and ATF-1 (CREB components) to the CRE site using similar probes. We and Flamand and colleagues (18) used oligonucleotides containing respective AP-1 site- and CRE site-specific consensus binding sequences. Flamand and colleagues also demonstrated the involvements of CRE and AP-1 sites in the COX-2 promoter activation in human herpes virus 6-infected monocytes. They found the binding of CREB-1 to the CRE site and c-jun to the AP-1 site (18). Therefore, respective binding components of CRE and AP-1 sites on the COX-2 promoter were explored. Our unpublished data demonstrated the specific binding of CREB/ATF-2 to the CRE site (53/45), and c-fos/c-jun to the AP-1 site (936/930) on the cyclin D1 promoter after H. pylori infection. The additional bindings of c-jun to the CRE site and ATF-2 to the AP1 site in the present study might be due to the adjacency of these two elements on the COX-2 promoter, as they are far apart on the cyclin D1 promoter.
Present studies explored that H. pylori induced activations of CRE and AP-1 through MAPKs pathways. As lung A549 cells expressing ICAM-1 and releasing IL-8 through MAPKs-induced AP-1 activation (28, 48), ERK and p38 regulate c-fos mRNA expression, and JNK and p38 regulate c-jun mRNA expression in the present AGS cells. Activations of ERK and c-fos expression by H. pylori have also been noted (49). CREB-dependent transcription is regulated through the phosphorylation of serine 133, which was first found to be mediated by PKA (50). Our finding provided evidence for an alternative mechanism whereby CREB was phosphorylated by MAPKs as found by Yu et al. (51). ATF-2 has been reported to be activated by JNK and p38 (52, 53). In this study, we showed that ATF-2 was activated by all three MAPKs. Therefore, the binding components of CRE and AP-1 sites are differentially regulated by the MAPKs. Intriguingly, p38 could regulate all these transcription factors.
In summary, we provided a mechanistic view of COX-2 in the H. pylori-mediated carcinogenesis. H. pylori was shown to act through TLR2 and TLR9 to activate the MAPKs (ERK1/2, p38, JNK) and their downstream transcription factors (CREB-1, ATF-2, c-fos, and c-jun), resulting in the activations of CRE and AP-1 on the COX-2 promoter. These intracellular networks drive the COX-2-dependent PGE2 release, and they may contribute to the carcinogenesis and metastasis in patients colonized with these strains through the enhancement of tumor cell invasion and angiogenesis. A schematic diagram exhibiting the comprehensive intracellular networks in gastric cancer cells is displayed in Fig. 6, and the application of the selective COX-2 inhibitor may provide an alternative therapy to reduce the development of gastric cancer.
|
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported by grants from National Health Research Institute (NHRI-EX94-9307BI) and National Science Council (NSC94-2314-B002-234), Taiwan. ![]()
2 Y.-J.C. and M.-S.W. contributed equally to this work. ![]()
3 Address correspondence and reprint requests to Dr. Ching-Chow Chen, Department of Pharmacology, College of Medicine, National Taiwan University, No. 1, Jen-Ai Road, 1st Section, Taipei 10018, Taiwan. E-mail address: ccchen{at}ha.mc.ntu.edu.tw ![]()
4 Abbreviations used in this paper: COX, cyclooxygenase; CRE, cAMP response element; HC, H. pylori isolate from gastric cancer; HD, H. pylori isolate from duodenal ulcer; HS, H. pylori isolate from gastritis; MOI, multiplicity of infection; DAPA, DNA affinity protein-binding assay; ChIP, chromatin immunoprecipitation; wt, wild type. ![]()
Received for publication May 4, 2005. Accepted for publication September 27, 2005.
| References |
|---|
|
|
|---|
B activation. Mol. Pharmacol. 66: 1465-1477.
, cAMP-response element-binding protein, and AP-1 in osteoblastic MC3T3-E1 cells. J. Biol. Chem. 276: 7048-7054.
ligands suppress the transcriptional activation of cyclooxygenase-2: evidence for involvement of activator protein-1 and CREB-binding protein/p300. J. Biol. Chem. 276: 12440-12448.
-induced cyclooxygenase-2 expression via sequential activation of ceramide-dependent mitogen-activated protein kinases, and I
B kinase 1/2 in human alveolar epithelial cells. Mol. Pharmacol. 59: 493-500.
-induced up-regulation of intercellular adhesion molecule-1 (ICAM-1) in respiratory epithelial cells through activator protein-1 and nuclear factor-
B: structure-activity relationships. Mol. Pharmacol. 66: 683-693.
-methylene-
-butyrolactone derivatives. Carcinogenesis 25: 1925-1934.
B activation and chemokine expression by epithelial cells. J. Biol. Chem. 278: 32552-32560.
in human cervical cancer cells. Clin. Cancer Res. 9: 4627-4635.
gene in B cells and T cells by NFATp and ATF-2/JUN. Mol. Cell Biol. 16: 5232-5244. [Abstract]This article has been cited by other articles:
![]() |
S.-Y. Kim, J. Weiss, M. Tong, M. M. Laronda, E.-J. Lee, and J. L. Jameson Foxl2, a Forkhead Transcription Factor, Modulates Nonclassical Activity of the Estrogen Receptor-{alpha} Endocrinology, November 1, 2009; 150(11): 5085 - 5093. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-H. Wang, J.-J. Wu, and H.-Y. Lei The Autophagic Induction in Helicobacter pylori-Infected Macrophage Experimental Biology and Medicine, February 1, 2009; 234(2): 171 - 180. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. J. Cho and S. G. Kim A Novel Mitogen-Activated Protein Kinase Phosphatase-1 and Glucocorticoid Receptor (GR) Interacting Protein-1-Dependent Combinatorial Mechanism of Gene Transrepression by GR Mol. Endocrinol., January 1, 2009; 23(1): 86 - 99. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. N. Sorensen, L. S. Reinert, L. Malmgaard, C. Bartholdy, A. R. Thomsen, and S. R. Paludan TLR2 and TLR9 Synergistically Control Herpes Simplex Virus Infection in the Brain J. Immunol., December 15, 2008; 181(12): 8604 - 8612. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Sayasith, N. Bouchard, M. Dore, and J. Sirois Regulation of Bovine Tumor Necrosis Factor-{alpha}-Induced Protein 6 in Ovarian Follicles during the Ovulatory Process and Promoter Activation in Granulosa Cells Endocrinology, December 1, 2008; 149(12): 6213 - 6225. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Snider, C. Allison, B. H. Bellaire, R. L. Ferrero, and J. A. Cardelli The {beta}1 Integrin Activates JNK Independent of CagA, and JNK Activation Is Required for Helicobacter pylori CagA+-induced Motility of Gastric Cancer Cells J. Biol. Chem., May 16, 2008; 283(20): 13952 - 13963. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Aki, Y. Minoda, H. Yoshida, S. Watanabe, R. Yoshida, G. Takaesu, T. Chinen, T. Inaba, M. Hikida, T. Kurosaki, et al. Peptidoglycan and lipopolysaccharide activate PLCgamma2, leading to enhanced cytokine production in macrophages and dendritic cells. Genes Cells, February 1, 2008; 13(2): 199 - 208. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Hattermann, S. Picard, M. Borgeat, P. Leclerc, M. Pouliot, and P. Borgeat The Toll-like receptor 7/8-ligand resiquimod (R-848) primes human neutrophils for leukotriene B4, prostaglandin E2 and platelet-activating factor biosynthesis FASEB J, May 1, 2007; 21(7): 1575 - 1585. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Merrell, J. M. Ilvesaro, N. Lehtonen, T. Sorsa, B. Gehrs, E. Rosenthal, D. Chen, B. Shackley, K. W. Harris, and K. S. Selander Toll-Like Receptor 9 Agonists Promote Cellular Invasion by Increasing Matrix Metalloproteinase Activity Mol. Cancer Res., July 1, 2006; 4(7): 437 - 447. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Y. Wu, H. Lu, Y. Sun, D. Y. Graham, H. S. Cheung, and Y. Yamaoka Balance between Polyoma Enhancing Activator 3 and Activator Protein 1 Regulates Helicobacter pylori-Stimulated Matrix Metalloproteinase 1 Expression. Cancer Res., May 15, 2006; 66(10): 5111 - 5120. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |