|
|
||||||||
Physiology Program, Harvard School of Public Health, Boston, MA 02115
| Abstract |
|---|
|
|
|---|
and lack of significant IL-12 production on stimulation with LPS alone. Conversely, SR-AI/II-deficient PEMs produced 2.4 and 1.8 times more IL-12 than wild-type PEMs in response to LPS or LPS and IFN-
, respectively. Corresponding differences in regulation of SR-A and MARCO expression were also observed. Th1 adjuvants (LPS, a CpG motif-containing oligodeoxynucleotide (CpG-ODN), IL-12, and GM-CSF) increased, whereas Th2-polarizing factors (IL-4, M-CSF, and non-CpG ODN) decreased expression of MARCO on J774 macrophage-like cells. Expression of SR-A was regulated in the opposite manner to MARCO or not affected. Whereas MARCO was involved in opsonin-independent phagocytosis in CpG-ODN-pretreated but not in IL-4-pretreated J774 cells, anti-SR-A Abs inhibited particle uptake in untreated and IL-4-pretreated but not in CpG-ODN-pretreated cells. SR-A and MARCO are regulated differently and mediate distinct negative and positive effects on IL-12 production in macrophages. These differences may contribute to sustained Th1 or Th2 polarization of ongoing immune responses. | Introduction |
|---|
|
|
|---|
2 integrins, and class A scavenger receptors. There is some evidence that concomitant engagement of different combinations of PRRs allows an APC to discriminate between different pathogens. Consequently, this initial APC-mediated recognition seems to dictate the type of subsequent adoptive immune responses due to differential effects of different PPRs on expression of costimulatory molecules and immunomodulatory mediators such as IL-12 (2, 3). The members of the class A family of SRs were identified as major macrophage receptors mediating initial opsonin-independent recognition of bacteria. The members of the family share the presence of collagenous and scavenger receptor cysteine-rich domains in their extracellular portions. The family includes type I and II class A scavenger receptors (scavenger receptor AI/II) (SR-A), derived from the alternative splicing of a single gene product, and macrophage receptor with a collagenous structure (MARCO), encoded by a separate gene (4, 5). Both SR-A and MARCO are expressed predominately on macrophages and DCs (5, 6, 7, 8), and both have been implicated in scavenging (9, 10, 11) and immune functions of macrophages (5, 9, 11, 12, 13).
SR-A shows ubiquitous expression on numerous macrophage populations (6). In contrast, in healthy mice from "barrier" facilities, expression of MARCO seems to be most robust on marginal zone macrophages in the spleen, on medullary cord macrophages of lymph nodes, and on peritoneal macrophages. However, this expression is rapidly and transiently induced in macrophages of liver, lungs, and other organs during bacterial infection or upon administration of bacteria-derived products (5, 12, 14). Human MARCO is expressed at the highest level in liver, lymph nodes, alveolar macrophages, and monocytes but is barely detectable in other tissues and cells (15, 16). Global gene expression analysis revealed that the MARCO mRNA is also among the most strongly induced during in vitro maturation of murine DCs, triggered by LPS, bacteria (7), or lysates of normal or tumor tissues (17). In vivo, MARCO-positive DCs were detected in spleens of mice maintained in a conventional nonpathogen-free animal house facility but not in DCs of mice kept under pathogen-free conditions (17). Similarly, MARCO could be also detected on alveolar macrophages of mice not kept under pathogen-free conditions (10).
This pattern of MARCO expression suggests a specialized role in antimicrobial defense. Such a role is further supported by in vitro demonstration of MARCO involvement in phagocytosis of both Gram-positive and Gram-negative bacteria species (5, 12, 15). In vivo experiments with bacteria also demonstrate a phagocytic function for MARCO. Treatment with anti-MARCO mAb inhibited capture of heat-killed bacteria by macrophages in the marginal zone areas of the spleen (14). MARCO/ mice displayed severely impaired ability to clear bacteria from the lungs and increased mortality during infection with Streptococcus pneumoniae (11).
Despite their importance in antimicrobial defense (9, 11, 13) and in scavenging functions of macrophages (9, 10), little is known about signaling abilities of SR-A and MARCO. IL-12 and NO are key mediators of macrophage immunoregulatory and bactericidal functions. We reported previously that ligation of SR-A on mouse macrophages inhibits IL-12 but has no effect on LPS plus IFN-
-stimulated NO and IL-6 production in mouse alveolar and peritoneal macrophages (18). We have observed that, despite a structure and ligand binding repertoire similar to SR-A, MARCO mediates an opposite stimulatory effect on IL-12 production in macrophages and therefore may play a distinct role in innate immune responses. This conclusion is consistent with different, usually opposite regulation of SR-A and MARCO expression on macrophages by Th1- vs Th2-polarizing factors.
| Materials and Methods |
|---|
|
|
|---|
Rat anti-mouse MARCO (clone ED31), anti-mouse SR-A (2F8), and F4/80 mAbs were purchased from Serotec, rat anti-mouse CR3 (M1/70), irrelevant rat IgG2b (cIgG2b, clone A95-1), and IgG1 (cIgG1, R3-34) was purchased from BD Pharmingen, ImmunoPure goat anti-rat IgG Fc-specific Ab was purchased from Pierce, and HRP- or FITC-conjugated F(ab')2 of goat anti-rat IgG Ab was purchased from Rockland. Murine rIL-4, IL-12, M-CSF, GM-CSF, and IFN-
were obtained from R&D Systems. Nuclease-resistant class B phosphorothioate-linked oligonucleotide 1826, containing (underlined) two mouse-optimized immunostimulatory CpG motifs (CpG-ODN: TCCATGACGTTCCTGACGTT) and control ODN 2138 with reversed CpG motif (GC-ODN: TCCATGAGCTTCCTGAGCTT), were obtained from the Coley Pharmaceutical Group. Carboxyl-modified 1-µm fluorescent (green) polystyrene spheres (PSSs) and unlabeled or Alexa Fluor 488-labeled Staphylococcus aureus bioparticles (heat-killed S. aureus (SACs)) were obtained from Molecular Probes. LPS from strain 0127:B8 of Escherichia coli and all chemical reagents not otherwise specified were obtained from Sigma-Aldrich.
Preparation of mAb-coated plates
The Abs against macrophage receptors were linked to protein G-coated surfaces through a goat Ab specific for Fc portions of rat IgG, as described previously (18). In brief, goat-anti-rat Fc at 40 µg/ml was immobilized on Reacti-Bind Protein G Coated Plates (Pierce) by 2.5-h (room temperature) or overnight (4°C) incubation in 0.1 ml of ImmunoPure (G) IgG Binding Buffer (Pierce). Subsequently, plates were washed twice with ImmunoPure (G) IgG Binding Buffer and once with 0.1% BSA (low-endotoxin, IgG-free) plus 20 µg/ml polymyxin B in PBS (pH 7.4; BioWhittaker). ED31 or cIgG1 mAbs, at 20 µg/ml in 0.1 ml of BSA/polymyxin B, were added for 1.5-h incubation at 37°C. Finally, plates were washed four times with PBS directly before the use in experiments described below.
Animals
MARCO-deficient mice, developed by Soininen and colleagues (11), and SR-A-deficient mice (9), both on the C57BL/6 background, were maintained in our facility under pathogen-free conditions. Mice deficient with both SR-A and MARCO (double, SR-A and MARCO knockout (dKO)) were obtained by cross-breeding of single knockouts. C57BL/6 and BALB/c mice were purchased from Charles River Laboratories, and mice deficient in the
-chain of FcRs on C57BL/6 background were obtained from Taconic Farms. Female mice, 914 wk old, were used in the experiments. The studies have been reviewed and approved by an appropriate institutional review committee.
Cells
Mice were quickly euthanized by inhalation of halothane (Halocarbon Products). Inflammatory peritoneal cells (PECs), elicited with 1 ml of aged, 3% thioglycolate (Difco), injected i.p. 45 days earlier, were washed out with PBS and collected into centrifuge tubes kept on ice. Most experiments were conducted using adherence-purified thioglycolate-elicited peritoneal macrophages (PEMs) from either wild-type or receptor-deficient mice. Other macrophage cell types were used in some experiments as warranted by advantages for a particular assay. In most cases, the findings were subsequently confirmed using PEMs.
The culture of J774A.1 macrophage-like cells was maintained in FCS-RPMI medium (RPMI 1640 medium with 25 mM HEPES supplemented with 10% FCS (Gemini Bio-Products), 2 mM L-glutamine, and antibiotics), in unmodified polystyrene (bacteriological grade) 6-well plates, with medium replaced every 23 days. Cells, which adhere loosely under these conditions, were detached by pipetting, resuspended in fresh medium, and plated at 0.5 (for 2-days treatment) or 1 (for 1-day treatment) x 105/well in 96-well tissue culture-treated plates.
IL-12 p70 and NO assays
After washing once, peritoneal cells were resuspended in FCS-RPMI medium and plated at 1.6 x 105/well in 96-well tissue culture-treated plates. After overnight incubation, with or without 10 µg/ml CpG-ODN, adherent macrophages (PEMs) were stimulated in 0.2 ml of medium with 0.011 µg/ml LPS ± 20 ng/ml IFN-
or 25 µg/ml S. aureus bioparticles. There was some variability in the number of adherent macrophages, resulting largely from different percentages of macrophages (4374%) within PEC populations, identified by flow cytometry as large granular cells expressing the macrophage marker F4/80. To ensure equal cell densities, in all experiments comparing wild-type and knockout macrophages, relative numbers of adherent cells were determined on the basis of lactate dehydrogenase (LDH) activities in cell lysates, and the medium volumes for knockout cells were appropriately adjusted. We have validated previously the LDH assay as very sensitive and correlating extremely well with direct counting of macrophages (18).
The second type of experiments involved receptor cross-linking with immobilized mAb. PECs were plated in 6-well nontissue culture treated (bacteriological grade) polystyrene plates at 6 x 106/well in 6 ml of FCS-RPMI medium. After overnight preincubation, with or without 10 µg/ml CpG-ODN, nonadherent cells were removed by washing and adherent PEMs detached with 10 mM EDTA in FCS-RPMI medium. Suspensions of freshly isolated PECs or adherence-purified PEMs in FCS-RPMI medium were plated in mAb-coated plates at 1.6 x 105/ml in 0.1 ml of medium. Following 40-min preincubation at 37°C, another 0.1-ml portion of medium containing double-concentrated solution of LPS or IFN-
was added, and the incubation was continued overnight in the cell culture incubator.
Nitrite and IL-12 p70 concentrations were determined in supernatants from 22-h cultures of macrophages, stimulated as described above in four to five replicates.
Nitrite concentrations in 70-µl aliquots of culture supernatants were determined according to the modified Griess method, as described before (18). IL-12 p70 determinations were performed with the use of Mouse IL-12 p70 Duo Set ELISA kit from R&D Systems, according to the manufacturers instructions.
Receptor expression
Tissue culture plastic-adhered PEMs or J774 cells were treated for 1 day with LPS (10100 ng/ml), CpG-ODN, GC-ODN (110 µg/ml), or IL-12 (10 ng/ml) or for 2 days with IL-4 (10 ng/ml), M-CSF (20 ng/ml), or GM-CSF (10 ng/ml) in 0.2 ml of FCS-RPMI. Effects of treatments on SR-A and MARCO expression were assessed by cellular ELISA. The medium was replaced with 50 µl of 20% mouse serum in FCS-RPMI. and the plate was placed on ice for 10-min preincubation. Quadruplicate wells were subsequently incubated for 40 min on ice with 100 µl of mAb solution in 20% mouse serum (10 µg/ml (cIgG2b, 2F8, M1/70, F4/80) or 25 µg/ml (cIgG1, ED31)). After removal of unbound mAbs by three times washing with ice-cold HBSS, adherent cells were incubated for another 40 min with 5 µg/ml HRP-conjugated F(ab')2 of goat anti-rat IgG Ab in 20% mouse serum. Wells were washed five times with HBSS, and enzymatic reaction was performed with 0.1 ml of tetramethylbenzidine (DakoCytomation) as the HRP substrate. The reaction was stopped with 0.1 ml of 2 M H2SO4, and absorbance of the product was measured (at 450 nm with the background substraction at 550 nm) in a plate reader.
In some cases, cells were treated under nonadherent conditions in 96-well ultra low-attachment plates (Costar). They were subsequent labeled with primary mAbs in 20% mouse serum, followed by FITC-conjugated secondary Ab and analyzed by flow cytometry with the use of the Epics Elite flow cytometer (Beckman Coulter).
Phagocytic assays
Adherent cells were preincubated for 20 min at room temperature with 50 µl of double-concentrated solutions of mAbs (final concentrations: cIgG1 and ED31 (25 µg/ml); cIgG2b and 2F8 (10 µg/ml)), dextran sulfate or chondroitin sulfate (final concentration, 400 µg/ml). Subsequently, PSSs (100 µg/ml) or SACs (25 µg/ml) in 50 µl were added and allowed to be phagocytosized for 1.5 h in a cell culture incubator. The wells were washed four times with HBSS, and fluorescence of bound/ingested particles was measured in a fluorescence plate reader (Spectrafluor Plus; Tecan). Fluorescence values were corrected for variations in numbers of adherent cells determined on the basis of LDH activities in lysates of adherent cells, as described previously (18).
Cell viability
Viability of cells was routinely assessed by their ability to exclude trypan blue. The effect of treatments on macrophage viability was assessed by measuring LDH release from the cells with the use of Cytotoxicity Detection kit (LDH) (Roche Diagnostics), according to the manufacturers instructions. In brief, the percentage of cytotoxicity was calculated as the ratio of LDH in culture supernatants to the total LDH (cell-associated plus that in supernatant) x 100%. None of treatments was toxic to PEMs or J774 cells cultured under adherent conditions.
Data analysis
Homogeneity of variances was assessed with the F test. Statistical significance of differences in IL-12 or NO production between wild-type and receptor-deficient PEMs was assessed with unpaired Students t test, for single comparison, or ANOVA, for multiple comparisons, with the assumption that p values < 0.05 indicate statistically significant differences (GraphPad Prism software). Effects of anti-MARCO mAb were compared with effects of isotype-matched control mAb with the paired t test.
In receptor expression studies, specific binding of mAbs to receptors was calculated by subtracting binding of isotype-matched control IgGs (cIgGs). Effects of treatments on receptor expression were expressed as the percentage of expression in nontreated controls and evaluated statistically with one-sample t test. All results are presented as mean ± SEM from either several independent experiments or from replicates obtained in a single representative experiment.
| Results |
|---|
|
|
|---|
We measured the LPS-induced release of IL-12 by PEMs from wild-type, SR-A/, and MARCO/ mice. PEMs deficient in SR-A released more IL-12 than wild-type PEMs. In contrast, PEMs deficient in MARCO showed markedly diminished IL-12 release, as illustrated in Fig. 1A. Similarly, SR-A-deficient PEMs produced more IL-12 and MARCO-deficient PEMs less IL-12 when stimulated with a combination of LPS and IFN-
(Fig. 1B), even as the absolute amount of cytokine is greater. These results suggest that LPS binding to SR-A and MARCO mediate, respectively, negative and positive regulation of LPS-stimulated IL-12 production in macrophages.
|
. Anti-MARCO mAb caused a slight (by 36.5 ± 6.63%, n = 5) but significant increase in IL-12 production in the presence of IFN-
(Fig. 1C). This effect of immobilized ED31 mAb resulted specifically from MARCO ligation since it was not seen in PECs from MARCO/ mice (Fig. 1D).
We hypothesized that the rather weak stimulation of IL-12 release by immobilized anti-MARCO mAb might be caused by the suppressive effect of concomitant ligation of Fc
Rs by immobilized Abs, as reported previously, to inhibit IL-12 release from mouse macrophages (19). This was directly tested by using PECs from Fc
RI/III/ mice. When Fc
RI/III/ PECs were used, IFN-
-stimulated IL-12 production was more strongly enhanced by immobilized anti-MARCO mAb than in wild-type PECs (Fig. 1E) by 69 ± 13.7% (n = 4). Additional supportive evidence includes the observation that PECs from mice deficient in Fc
RI and Fc
RIII produced more basal IL-12 than wild-type cells when cultured over immobilized Abs (i.e., compare Fig. 1, C and E) but not when cultured in conventional tissue culture plates (data not shown).
In contrast to its effect on the IFN-
-stimulated IL-12 production, immobilized anti-MARCO mAb did not affect significantly LPS-stimulated IL-12 production (29 ± 11.4 and 31 ± 12.5 pg/ml in ED31- and cIgG1-cotreated cultures, respectively, n = 6), also in Fc
RI/III/ PECs (49 ± 3.7 and 45 ± 7.4 pg/ml, respectively, n = 4). The latter results are consistent with activation by LPS and immobilized anti-MARCO mAb of the same receptor, MARCO.
MARCO is not required for stimulation of NO production by LPS
Direct ligation of MARCO with immobilized ED31 mAb significantly enhanced IFN-
-stimulated NO production in wild-type but not in MARCO/ PEMs (Fig. 2A), measured as nitrite via Griess assay. However, involvement of MARCO was not required for stimulation of NO production by LPS; wild-type and MARCO/ cells accumulated similar quantities of nitrite when stimulated with LPS or LPS plus IFN-
(Fig. 2B). It is noteworthy that costimulation with IFN-
strongly enhanced LPS induction of IL-12 (Fig. 1, A and B), but did not have an effect on NO production (Fig. 2B). These data suggest involvement of different sets of receptors in LPS signaling for NO vs IL-12 release. This postulate is also suggested by differences in dose response (Fig. 2, C and D). We measured the effect on NO and IL-12 release of either high (1 µg/ml) and low (10 ng/ml) concentrations of LPS in combination with IFN-
. LPS at a lower concentration of 10 ng/ml stimulated 81 ± 2.6% (mean ± SEM from two experiments) of the NO release (Fig. 2C), but only 8 ± 1.2% of the IL-12 production, seen with the higher level of endotoxin (Fig. 2D). Taken together, the results indicate that while a high-affinity LPS receptor (presumably CD14-TLR4-MD-2 receptor system (20)) is sufficient to stimulate maximal NO production in response to LPS, stimulation of IL-12 production by LPS requires involvement of MARCO.
|
Because absence of SR-A increases LPS-stimulated IL-12 production by PEMs while absence of MARCO reduces their IL-12 release, expression levels of SR-A and MARCO may determine the magnitude of macrophage IL-12 production. Hence, we hypothesized that adjuvants such as LPS or CpG-ODNs may promote stable Th1 polarization of immune responses by increasing MARCO and/or decreasing SR-A expression. Conversely, we postulated that Th2-polarizing factors, such as IL-4, would decrease expression of MARCO and/or increase expression of SR-A.
Macrophages from C57BL/6 mice, used in experiments described above, express an allelic isoform of SR-A unrecognizable by 2F8 mAb (21). Also, PEMs from BALB/c mice could not be used because of undetectable (Fig. 4D) or very low (Fig. 6A) basal expression of MARCO, which precluded assessing effects of potentially down-regulating factors. For these reasons, we have studied regulation of receptor expression mainly on the J774 macrophage cell line, rather than on PEMs. Flow cytometric analysis revealed that at least 95% of J774 cells express high level of SR-A. Due to a relatively low level of basal MARCO expression, assessing the percentage of MARCO-positive cells in a similar manner was not possible. We found that LPS up-regulates expression of MARCO and down-regulates expression of SR-A on J774 cells, as assessed by cellular ELISA (Fig. 3A). Similar effects on SR-A and MARCO expression were exerted by CpG-ODN (Fig. 3, A and B), although the effect on SR-A expression did not reach statistical significance. We also directly tested IL-12 and IL-4, which are prototypical Th1- and Th2-polarizing cytokines, respectively. IL-4 decreased MARCO expression by 43 ± 3.9% (n = 3; Fig. 3C), whereas 1-day treatment with IL-12 increased MARCO expression on J774 cells by 37 ± 8.3% (n = 3; Fig. 3A). Expression of SR-A was not affected by IL-4 (Fig. 3C) and increased by IL-12 by 11 ± 0.4% (Fig. 3A).
|
|
|
CpG motif-containing ODNs are well-characterized as potent Th1 adjuvants (28). Phosphorothioate-modified ODNs lacking CpG motifs have similarly strong immunoenhancing activities but induced the differentiation of unprimed CD4+ T cells toward Th2 cells (29, 30). These opposite effects of CpG- and non-CpG-ODNs on Th1-Th2 polarization may be related to their opposite effects on IL-12 production. Consistent with previous reports (31), CpG-ODN induced low-level IL-12 production in PEMs (
7 vs 0.5 pg/ml in nontreated controls; data not shown). In contrast, we have found that GC-ODN, while not stimulating any IL-12 release on its own, inhibited LPS-stimulated IL-12 release in a dose-dependent manner (IC50 = 4 ± 0.5 µg/ml) by up to 72% at 50 µg/ml (data not shown). Interestingly, these opposite effects of CpG- vs non-CpG-ODNs on Th1-Th2 polarization and IL-12 production coincide with their opposite effects on MARCO expression. In contrast to CpG-ODN, GC-ODN down-regulated expression of MARCO on J774 cells by 38 ± 8.4% (n = 3; Fig. 3A).
CpG-ODN-induced up-regulation of phagocytosis in macrophages is mediated by MARCO
The class A scavenger receptors have been identified as major receptors involved in opsonin-independent phagocytosis by macrophages (5, 10, 13). We found that changes in MARCO, but not SR-A, expression on J774 cells paralleled changes in uptake of PSSs. LPS at 100 ng/ml and CpG-ODN at 10 µg/ml increased MARCO expression by 68 and 55%, respectively (Fig. 3A), and increased uptake of PSSs by 49 and 29%, respectively (Fig. 3D). In contrast, pretreatment with IL-4 decreased MARCO expression (Fig. 3C) and PSSs uptake (Fig. 3D) by 43 and 42%, respectively. In comparison to phagocytosis of PSSs, phagocytosis of SACs was less affected by IL-4 or CpG-ODN pretreatment, suggesting its lesser dependence on MARCO (Fig. 3D).
We have confirmed that MARCO plays an important role in phagocytosis of PSSs also in PEMs because MARCO-deficient PEMs exhibited decreased uptake by 27 ± 5.1% (n = 6) (Fig. 4A). As in J774 cells, the CpG-ODN pretreatment increased both MARCO expression (Fig. 4B) and particle uptake (Fig. 4A) in wild-type PEMs. Interestingly, up-regulation of particle uptake seemed mediated entirely by MARCO since the CpG-ODN pretreatment had no effect on phagocytosis by MARCO-deficient PEMs (Fig. 4A).
As in J774 cells, MARCO does not seem to play a major role in S. aureus uptake by PEMs (Fig. 4C) since SACs uptake was not significantly decreased in MARCO-deficient PEMs (by 11 ± 5.6%, n = 6, p = 0.1). However, MARCO begins to play a significant role in S. aureus phagocytosis by CpG-ODN-pretreated PEMs, as indicated by comparison of bacteria uptake in CpG-ODN-pretreated wild-type and MARCO-deficient PEMs (26 ± 6.7% difference). Interestingly, CpG-ODN-pretreated MARCO/ PEMs exhibited significantly lower uptake of S. aureus in comparison to nontreated, wild-type PEMs also. The latter results suggest that the CpG-ODN-induced, MARCO-mediated increase in phagocytosis of bacteria is masked partially by concomitant down-regulation of other receptor(s), which mediate phagocytosis of bacteria but not of polystyrene beads.
The SR-A deficiency had no effect on phagocytosis of PSSs in PEMs (Fig. 4A), which is consistent with the previously reported normal phagocytosis of PSSs by SR-A-deficient alveolar macrophages (10). However, in our study, SR-A deficiency had also no effect on S. aureus phagocytosis by C57BL/6 PEMs (Fig. 4C), which contrast with previously reported severe impairment of S. aureus phagocytosis in PEMs from SR-A-deficient BALB/c mice (13). PEMs lacking both SR-A and MARCO exhibited significantly decreased uptake of both polystyrene beads and bacteria (to 41 ± 8.3 and 60 ± 5.8% of wild-type controls, respectively). Because this was a greater decrease in comparison to PEMs lacking only MARCO, it suggests that SR-A may be involved in S. aureus or latex bead phagocytosis under certain conditions, such as lack of MARCO expression (Fig. 4, A and C). In this context it is noteworthy that, unlike C57BL/6 PEMs (Fig. 4B), untreated BALB/c PEMs did not express MARCO (Fig. 4D), or this expression was much lower (three to seven times; Fig. 6A and data not shown). LPS treatment induced weak MARCO expression on BALB/c PEMs and, as in J774 cells, slightly down-regulated SR-A expression (Fig. 4D).
SR-A mediates phagocytosis in IL-4-pretreated and MARCO in CpG-ODN-pretreated J774 cells
We next examined functional consequences of altered receptor levels on phagocytosis by J774 cells. In untreated cells, which express high levels of SR-A and low levels of MARCO (Fig. 3B), only
30% of latex bead (PSSs) uptake could be inhibited by dextran sulfate, a nonselective polyanionic ligand of scavenger receptors (Fig. 5A). In contrast, the increase in particle uptake mediated by CpG-ODN was fully blocked by dextran sulfate, indicating that scavenger receptor(s) are responsible for CpG-ODN-induced enhancement of phagocytosis. Interestingly, in comparison to nontreated cells, receptor(s) mediating particle uptake in CpG-ODN-pretreated cells exhibited higher selectivity for dextran sulfate over control polyanion chondroitin sulfate, the latter considered a poor ligand of class A scavenger receptors (Fig. 5A).
|
35 and 51%, respectively, but not in CpG-ODN-pretreated cells (Fig. 5B). Thus, CpG-ODN-pretreated and IL-4-pretreated J774 cells interact with the same ligand, PSSs, through different receptors. SR-A but not MARCO is the receptor mediating phagocytosis of particles in IL-4-pretreated J774 cells, whereas the inverse is true for CpG-ODN-pretreated J774 cells. In CpG-ODN-pretreated J774 cells, uptake of fluorescent S. aureus was inhibited by dextran sulfate by 17 ± 3.9% (n = 5) and by anti-MARCO mAb by 16 ± 3.4% (n = 5) but not by chondroitin sulfate. In contrast, neither polyanions nor ED31 mAb produced any inhibition of S. aureus uptake in untreated J774 cells (data not shown).
The magnitude of macrophage NO responses to stimulation with heat-killed S. aureus correlate with MARCO expression
Because MARCO both binds to S. aureus and can costimulate IL-12 and NO production, we also examined whether the magnitude of macrophage responses to S. aureus correlate with MARCO expression. For this purpose, we used PEMs from different strains of mice, which differ in basal levels of MARCO expression as well as PEMs in which expression of MARCO was up-regulated by CpG-ODN pretreatment. As described above, basal expression of MARCO on C57BL/6 PEMs was higher than on BALB/c PEMs but lower than on SR-A/ PEMs (Fig. 6A). Pretreatment with CpG-ODN up-regulated strongly expression of MARCO on C57BL/6 and SR-A/ PEMs and, to a lesser extent, on BALB/c PEMs (Fig. 6A). Immobilized anti-MARCO mAb ED31 stimulated low but significant levels of NO production in CpG-ODN-pretreated C57BL/6 and SR-A/ PEMs but did not produce significant stimulation in untreated C57BL/6 PEMs or CpG-ODN-pretreated BALB/c PEMs (Fig. 6B), which expressed lower levels of MARCO (Fig. 6A).
The magnitude of macrophage NO responses to S. aureus correlated with MARCO expression. In SR-A/ PEMs, expressing more MARCO than C57BL/6 PEMs, treatment with S. aureus stimulated also more strongly NO production (compare left panels of Fig. 6, A and C). Conversely, S. aureus stimulated lower NO production in BALB/c PEMs expressing very low levels of MARCO and even lower NO production in MARCO/ PEMs. Up-regulation of MARCO expression by CpG-ODN pretreatment (Fig. 6A) was accompanied by increased effects of S. aureus on NO production (Fig. 6C).
Unfortunately, relationships between MARCO expression and IL-12 production could not be analyzed in a similar manner as in the case of NO production because macrophages pretreated with CpG-ODN produced reduced levels of IL-12 when subsequently stimulated with LPS or S. aureus (data not shown). Nevertheless, without CpG-ODN pretreatment, both BALB/c and MARCO/ PEMs produced less IL-12 in response to S. aureus than C57BL/6 PEMs (Fig. 6D). Decreased release of proinflammatory mediators by CpG-ODN pre-exposed macrophages in response to subsequent challenge with LPS has been reported already (32, 33) and may be attributed, at least in part, to the delayed CpG-ODN-induced accumulation of IL-10 in culture medium (33).
| Discussion |
|---|
|
|
|---|
, stimulated higher IL-12 production in SR-A/ PEMs and lower IL-12 production in MARCO/ PEMs than in wild-type cells. This finding suggests that SR-A and MARCO mediate, respectively, negative and positive regulation of IL-12 production. Consistent with this postulate, specific ligation of SR-A with a mAb inhibited (18) whereas ligation of MARCO using the same approach enhanced IL-12 production by macrophages. The use of unfractioned PECs in most of experiments with receptor cross-linking by immobilized mAb raises the possibility that other cell types, namely DCs, may contribute to the measured responses. Nevertheless, anti-MARCO mAb produced a specific effect also when adherence-purified macrophages were used in these type of experiments (Fig. 6B). Moreover, according to previous reports, DCs are very rare or absent among thioglycollate-elicited PECs (34). Whether ligation of MARCO on DCs produces similar effects as in macrophages is an interesting question for future study.
IL-12 is a major factor in regulation of Th1-Th2 balance in adoptive immune responses. Severe impairment of LPS-stimulated IL-12 production in PEMs lacking MARCO and, in contrast, strongly increased IL-12 production in SR-A-deficient PEMs suggest that the magnitude of an IL-12 response to bacteria-derived ligands shared by TLRs, SR-A and MARCO, may be determined by relative expression levels of these receptors. Consequently, we hypothesized that altering type of receptors mediating APC interaction with a microorganism may be a mechanism of sustained Th1 or Th2 polarization of ongoing immune responses. According to this scenario, macrophages (and potentially DCs which also express MARCO and SR-A (7, 8)) pre-exposed to Th2-polarizing factors such as IL-4 would interact with microorganism preferentially through receptors mediating inhibition of IL-12 production, such as SR-A. Conversely, macrophages and DCs pre-exposed to Th1 adjuvants such as LPS and CpG-ODN would interact with microorganisms through MARCO-type receptors, which provide costimulation for TLR-mediated IL-12 production. Supporting this postulate, expression of MARCO, and to a lesser of SR-A, on J774 cells was regulated differently, usually in the opposite manner, by several different Th1- or Th2-polarizing factors. Strong Th1 adjuvants: LPS, CpG-ODN, IL-12, and GM-CSF up-regulated whereas Th2-promoting factors, IL-4, M-CSF, and GC-ODN, down-regulated expression of MARCO on J774 cells. Whereas in CpG-ODN-pretreated J774 cells nonopsonic phagocytosis of PSSs was mediated by MARCO, but not by SR-A, SR-A, but not MARCO, mediated phagocytosis of the same ligand in IL-4-pretreated cells. Similarly as in the case of PSSs, pretreatment with CpG-ODN increased the role of MARCO in phagocytosis of S. aureus. Moreover, levels of basal or CpG-ODN-up-regulated MARCO expression on different populations of PEMs correlated with the magnitude of their NO responses to S. aureus.
The decreased role of SR-A in particle uptake in CpG-ODN-pretreated cells as well as increased role in IL-4-pretreated cells cannot be simply explained by effects of these pretreatments on SR-A expression (Fig. 3, A and C). Based on our results, we speculate that it may rather reflect a dominant role of MARCO in nonopsonic phagocytosis, with SR-A mediating particle uptake only when MARCO is weakly expressed. Consistent with this hypothesis, although IL-4-pretreatment had no effect on SR-A expression, it decreased expression of MARCO, and, consequently, involvement of SR-A in phagocytosis had increased. Because we have found that untreated BALB/c PEMs expressed much less MARCO than untreated C57BL/6 PEMs, this mechanism may also explain discrepancy between the lack of an effect of SR-A deficiency on S. aureus phagocytosis in our study and reported severe impairment of S. aureus phagocytosis by SR-A-deficient BALB/c PEMs in the study of Thomas et al. (13).
Our findings confirm prior reports of up-regulation of MARCO by LPS and CpG-ODNs (12, 14, 35) and extend characterization of factors regulating MARCO expression by demonstrating that expression of MARCO on J774 cells is up-regulated by GM-CSF and IL-12 and down-regulated by M-CSF, IL-4, and GC-ODNs. The latter data are consistent with the findings that: 1) M-CSF is not necessary for the development of MARCO-expressing macrophages in spleens of M-CSF-deficient osteopetrotic mutant mice (36); and 2) neonatal microglial cells grown in the presence of GM-CSF but not M-CSF express MARCO at cell surface (37). These data also prompt the speculation that decreased expression of MARCO may be responsible for the impairment of opsonin-independent phagocytosis in alveolar macrophages from GM-CSF-deficient mice, which express concomitantly strongly increased levels of M-CSF in the lungs (23).
Due to a low level of MARCO expression (in combination with high autofluorescence of a fraction of cells), we could not satisfactorily assess heterogeneity of macrophages in terms of MARCO expression. Low levels of MARCO expression (or a small fraction of MARCO-expressing cells) is a likely reason for the weak responsiveness of macrophages to anti-MARCO mAb. Consistent with this postulate, in PEMs in which expression of MARCO was up-regulated by CpG-ODN pretreatment, immobilized anti-MARCO mAb stimulated significant NO production even without costimulation with IFN-
(Fig. 6, A and B).
With the exception of the LPS effect, our results concerning regulation of SR-A expression qualitatively confirm previous reports (27). The small magnitude of effects we observed are lower than in some previous reports; this may be explained by very high basal expression level of SR-A on J774 cells. In contrast to its effect on MARCO expression, LPS decreased expression of SR-A on J774 cells and PEMs. Our results thus contrast with those reported by Fitzgerald et al. (38). These authors reported that LPS exerted the opposite effects on SR-A expression in human (negative) and mouse (positive) macrophages at the mRNA and total protein levels. The authors also reported increased surface expression of SR-A on J774 cells. We have identified two factors that may lead to overestimation of LPS effect on SR-A expression on J774 cells. First, LPS treatment increased strongly, likely Fc
R-mediated, "nonspecific" binding of mAbs to J774 cells. As a results, in the absence of sufficient blockade of Fc
Rs, achieved in our study by as high as 20% concentration of mouse serum, "total" binding of 2F8 mAb strongly increased in LPS-pretreated cells (data not shown). Hence, in the absence of an appropriate isotype control, as in Ref.38 , increased nonspecific binding of 2F8 mAb may be easily misinterpreted as resulting from increased SR-A expression. Second, we have found that LPS is toxic to J774 cells cultured under certain conditions. Whereas number of nontreated J774 cells cultured under nonadherent conditions in low-attachment plates increased
3.2-fold within 2 days, the number of LPS-treated cells decreased
2.1-fold during the same period (data not shown). An effect of LPS on viability of J774 cells cultured in chamber slides in the study of Fitzgerald et al. (38) was not reported. Interestingly, nonadherent J774 cells that survived LPS treatment expressed increased levels of SR-A (by
52% as assessed by flow cytometric analysis, data not shown), suggesting that SR-A expression protects from LPS toxicity and may skew results under conditions where LPS toxic effects occur.
Detrimental effects of absence of both MARCO (11) and SR-A (9, 13) on antibacterial defenses in mice have been reported. A defect in the uptake or killing of bacteria by macrophages was suggested as the mechanism responsible for decreased survival of receptor knockout mice during bacterial infections (9, 11, 13). Our results suggest that in addition to impaired bacterial destruction by macrophages, dysregulation of inflammatory responses may contribute to defective antibacterial defense in both MARCO- and SR-A-deficient mice. Indirect evidence includes increased serum IL-12 levels in SR-A/ mice 4 h after i.v. administration of CpG-ODN (39), increased production of TNF-
and IL-6 during LPS-induced septic shock of BCG-primed, SR-A-deficient mice (40), and higher expression of MIP-2 in SR-A/ than in SR-A+/+ mice after i.p. injection with LPS (41) or thioglycollate (42). Whereas exaggerated production of proinflammatory mediators (septic shock) may contribute to increased lethality of SR-A-deficient mice (43), decreased production of IL-12 may make MARCO-deficient mice more prone to bacterial infections as a consequence of impaired development of protective Th1-type immunity and may favor development of Th2-dominant allergic responsespostulates that can be experimentally tested.
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 The study was supported by National Institutes of Health Grant ES011008, 00002. ![]()
2 Address correspondence and reprint requests to Dr. Lester Kobzik, Physiology Program, Harvard School of Public Health, 665 Huntington Avenue, Boston, MA 02115. E-mail address: lkobzik{at}hsph.harvard.edu ![]()
3 Abbreviations used in this paper: DC, dendritic cell; cIgG, isotype-matched control IgG; CpG-ODN, CG dinucleotide-containing immunostimulatory motifs; GC-ODN, control ODN, with reversed GC motif; CS, chondroitin sulfate; dKO, double, SR-A and MARCO knockout; DS, dextran sulfate; LDH, lactate dehydrogenase; MARCO, macrophage receptor with a collagenous structure; PEC, thioglycollate-elicited peritoneal cell; PEM, thioglycolate-elicited peritoneal macrophage; PRR, pattern recognition receptor; PSS, polystyrene sphere; SAC, heat-killed Staphylococcus aureus; SR-A, type I/II class A scavenger receptor. ![]()
Received for publication June 22, 2005. Accepted for publication October 4, 2005.
| References |
|---|
|
|
|---|
-helical and collagen-like coiled coils. Nature 343: 531-535. [Medline]
receptor type I. J. Exp. Med. 188: 217-222.
response to subsequent lipopolysaccharide challenge. Infect. Immun. 69: 2123-2129. This article has been cited by other articles:
![]() |
H. Yi, X. Yu, P. Gao, Y. Wang, S.-H. Baek, X. Chen, H. L. Kim, J. R. Subjeck, and X.-Y. Wang Pattern recognition scavenger receptor SRA/CD204 down-regulates Toll-like receptor 4 signaling-dependent CD8 T-cell activation Blood, June 4, 2009; 113(23): 5819 - 5828. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Todt, B. Hu, and J. L. Curtis The scavenger receptor SR-A I/II (CD204) signals via the receptor tyrosine kinase Mertk during apoptotic cell uptake by murine macrophages J. Leukoc. Biol., August 1, 2008; 84(2): 510 - 518. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. V. Limmon, M. Arredouani, K. L. McCann, R. A. C. Minor, L. Kobzik, and F. Imani Scavenger receptor class-A is a novel cell surface receptor for double-stranded RNA FASEB J, January 1, 2008; 22(1): 159 - 167. [Abstract] [Full Text] [PDF] |
||||
![]() |
X.-Y. Wang, J. Facciponte, X. Chen, J. R. Subjeck, and E. A. Repasky Scavenger Receptor-A Negatively Regulates Antitumor Immunity Cancer Res., May 15, 2007; 67(10): 4996 - 5002. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. F. Hamilton Jr., S. A. Thakur, J. K. Mayfair, and A. Holian MARCO Mediates Silica Uptake and Toxicity in Alveolar Macrophages from C57BL/6 Mice J. Biol. Chem., November 10, 2006; 281(45): 34218 - 34226. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Jozefowski, T. H. Sulahian, M. Arredouani, and L. Kobzik Role of scavenger receptor MARCO in macrophage responses to CpG oligodeoxynucleotides J. Leukoc. Biol., October 1, 2006; 80(4): 870 - 879. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. S. Arredouani, Z. Yang, A. Imrich, Y. Ning, G. Qin, and L. Kobzik The Macrophage Scavenger Receptor SR-AI/II and Lung Defense against Pneumococci and Particles Am. J. Respir. Cell Mol. Biol., October 1, 2006; 35(4): 474 - 478. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. S. Schulert and L.-A. H. Allen Differential infection of mononuclear phagocytes by Francisella tularensis: role of the macrophage mannose receptor J. Leukoc. Biol., September 1, 2006; 80(3): 563 - 571. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |