The Journal of Immunology, 2005, 175: 7586-7593.
Copyright © 2005 by The American Association of Immunologists
Preferential Targeting of CD4-CCR5 Complexes with Bifunctional Inhibitors: A Novel Approach to Block HIV-1 Infection1
Matthias Mack2,*,
Jochen Pfirstinger*,
Jürgen Haas
,
Peter J. Nelson
,
Peter Kufer
,
Gert Riethmüller
and
Detlef Schlöndorff
* Klinikum, University of Regensburg, Regensburg, Germany;
Max von Pettenkofer Institute, University of Munich, Munich, Germany;
Medical Policlinic, University of Munich, Munich, Germany; and
Institute of Immunology, University of Munich, Munich, Germany
 |
Abstract
|
|---|
Two receptors, CD4 and one of several chemokine receptors, are required for cellular HIV-1 infection, with CCR5 being the main coreceptor for macrophage-tropic strains. We have designed bifunctional fusion proteins, consisting of RANTES/CCL5 and a single-chain Fv Ab fragment against CD4 to simultaneously block CD4 and CCR5. The fusion proteins bind to both receptors, compete with RANTES/CCL5 binding, and induce down-modulation of CCR5
10 times more efficiently on CD4+ compared with CD8+ T cells. Moreover, after short incubation and subsequent washout, a significant down-modulation of CCR5 was only seen with the fusion proteins and only on CD4+ cells, but not with unmodified RANTES or on CD4 cells, indicating a preferential targeting of CCR5 on CD4+ T cells. The fusion proteins block M-tropic HIV infection more efficiently than RANTES/CCL5 and CD4 Abs alone or in combination. To our knowledge this is the first report of simultaneous blockade of an HIV-1 receptor and coreceptor with bifunctional inhibitors.
 |
Introduction
|
|---|
Human immunodeficiency virus type 1 entry into cells is mediated by cell surface receptors, i.e., CD4 in conjunction with a chemokine receptor. Although several chemokine receptors have been shown to function as coreceptors for HIV-1 in vitro, the main coreceptors in vivo are CCR5 and CXCR4 (1, 2). CCR5 allows entry of M-tropic HIV-1 strains (R5, nonsyncytium inducing) that predominate during early stages of the infection and are responsible for transmission of HIV-1. Individuals with a homozygous 32-bp deletion in the CCR5 gene are highly resistant to HIV-1 infection, whereas heterozygous deletion may decelerate disease progression (3, 4). T-tropic HIV-1 strains using CXCR4 as coreceptor (X4, syncytium inducing) appear later in the disease course and are associated with a more rapid disease progression (5).
Since the discovery of CD4 as the primary HIV-1 receptor, several strategies to block the HIV-1 CD4 interaction were designed. Although effective in vitro (6, 7, 8), soluble CD4 was unsuccessful in clinical trials, most likely due to inability to obtain sufficient plasma concentration in vivo, the relative resistance of primary isolates to soluble CD4 (9, 10, 11) and the fact that binding of soluble CD4 to HIV-gp120 directly enables gp120 interaction with chemokine coreceptors independent of cellular CD4 (12). Blockade of CD4 with mAbs circumvents these restrictions and is still under investigation in clinical trails (13). Blockade of CD4 in combination with C-type lectin receptors also allows inhibition of HIV infection in monocytic/dendritic cells from cervical explants (14). Some of the CD4 mAbs do not influence the interaction of CD4 with HLA II and were genetically engineered to reduce Ab-mediated depletion of CD4+ T cells, which is considered to result from Ab-dependent cellular cytotoxicity and complement activation (13, 15, 16, 17, 18).
In addition, chemokine receptors constitute a very attractive target for inhibition of HIV-1 infection. In this regard, CCR5 appears as an ideal target, because CCR5-deficient individuals have no apparent phenotype or immunologic defect (4, 19). Based on the properties of CCR5 and its interaction with HIV-1 gp120 two strategies have been used to interfere with HIV-1 binding to CCR5, sterical hindrance of gp120 binding and internalization of CCR5 from the cell surface (20, 21). Sterical hindrance of gp120 binding to CCR5 can be achieved with modified or unmodified chemokines (22), mAbs (23, 24), or small molecular ligands (25, 26). This approach has a variable efficacy for different HIV-1 strains that use slightly different epitopes of CCR5 and might select for such mutants in vivo. In contrast, internalization of CCR5 leads to the disappearance of CCR5 from the cell surface and is thought to be effective against all CCR5-dependent strains (20). Although CCR5 can be internalized with mAbs (e.g., clone MC-1) (27), the most potent molecules are the physiological CCR5 ligands such as RANTES, MIP-1
, and MIP-1
(22). Chemical modifications of natural CCR5 ligands, such as amino-oxypentane-RANTES, have a markedly improved ability to internalize CCR5 and also affect recycling of the receptor (20, 28, 29).
Fusion of HIV-1 with the target cell membrane is a multistep process that requires interaction of gp120 with two receptors, CD4 and, in the case of M-tropic strains, CCR5 (30). Binding of HIV-1 gp120 to the first domain of CD4 induces a conformational change in the gp120 molecule that enables binding to a nearby chemokine coreceptor. It was shown that CD4 is noncovalently associated with CCR5 on the cell surface, suggesting that complexes of CD4 and CCR5 might constitute the real entry gates for HIV-1 (12, 31). Importantly only a small fraction of the total CD4 molecules are associated with CCR5, whereas the majority of CD4 molecules at least on T cells are not associated with a coreceptor and therefore insufficient for HIV-1 cell entry (32). The dependence of HIV-1 on the close proximity of CD4 and CCR5 was the basis for our present studies. To date, no approaches have been described to simultaneously target the HIV-1 receptor CD4 and a coreceptor (CCR5) with bifunctional constructs. The constructs consist of the chemokine RANTES and a single-chain Fv Ab fragment directed against CD4, fused by a short peptide linker that preserves the full functional activity of both components. We show that the constructs bind to both CD4 and CCR5 and preferentially down-modulate CCR5 from the surface of CD4-positive cells. When cells were exposed for only a short time to RANTES or the fusion proteins, significant down-modulation of CCR5 was only seen on CD4-positive cells with the fusion proteins and not with unmodified RANTES, indicating that the constructs preferentially target the CD4-CCR5 complex. In assays measuring cellular HIV-1 infection of PBMC, inhibition of M-tropic HIV-1 infection was markedly improved by the fusion proteins compared with RANTES and CD4 Abs, alone or in combination. These data indicate that the simultaneous targeting of CD4 and CCR5 might be a novel strategy to suppress cellular HIV-1 infection.
 |
Materials and Methods
|
|---|
Cloning, expression, and purification of bifunctional constructs
The VH and VL domains of the M-T413 mAb (33) were amplified by RT-PCR with Pfu polymerase (Stratagene) using primers 1 and 2 for VH and primers 3 and 4 for VH, subcloned into the PCR-Script vector (Stratagene), and sequenced. A single-chain Fv fragment from the Ab M-T413 in the order VL-VH was generated by fusion PCR with the primers 5 and 6 for VL and primers 7 and 8 for VH and subcloned in-frame with EcoRV and SalI into a periplasmic expression vector that already contained the FLAG sequence, which consists of the amino acids DYKDDDDK. The anti-CD4 single-chain (sc)3 Fv VL-VH-RANTES construct (MR) was generated by fusion PCR using primers 5 and 9 to amplify the M-T413 VL-VH scFv and primers 10 and 11 to amplify a RANTES cDNA. The MR sequence was subcloned with EcoRV and SalI into a periplasmic expression, described above. The VH-VL sc fragment was generated by fusion PCR using primers 12 and 9 for VH and primers 13 and 14 for VL. To generate the RANTES-scFv VH-VL construct (RM), two PCR fragments were subcloned into a periplasmic expression vector that contained an FspI restriction site in the OmpA signal sequence: first, RANTES cDNA amplified with primers 15 and 16 (subcloned with FspI and BspE1); and second, M-T413 scFv VH-VL amplified with primers 17 and 14 (subcloned with BspE1 and SalI). Periplasmic expression in Escherichia coli and purification by affinity chromatography on Ni-NTA columns (Qiagen) were performed as described previously (34). All constructs were dialyzed against PBS and sterile filtrated.
The following is the list of primers: 1, CCATGG(G/A)ATG(C/G)AGCTG(G/T)GT(A/C)AT(G/C)CTCTT; 2, ACCTGAGGAGACGGTGACCGTGGTCCCTTGGCCCCAG; 3, GACATTCAGCTGACCCAGTCTCCA; 4, GTTTTATTTCCAGCTTGGTCCC; 5, AAGGATATCGTGCTGACCCAGTCTCCAGC; 6, GGAGCCGCCGCCGCCAGAACCACCACCACCTTTGATCTCGAGCTCGGTCCCCCCTC; 7, GGCGGCGGCGGCTCCGGTGGTGGTGGTTCTCAGGTTCAGCTGCAGCAGTC; 8, CCTGTCGACTAATGATGATGGTGATGATGTGCGGAGACGGTGACCAGGGTCCCTTGGCC; 9, GGAGCCGCCGCCGCCAGAACCACCACCACCTGCGG AGACGGTGACCAGG; 10, GGCGGCGGCGGCTCCTCCCCATATTCCTCGGACAC; 11, GCCGTCGACTAGTGATGGTGATGGTGATGGCTCATCTGCAAAGAGTTGATG; 12, AAAGATATCCAGCTGCAGCAGTCTGGAC; 13, GGCGGCGGCGGCTCCGGTGGTGGTGGTGACATCGTGCTGACCCAGTCTCC; 14, CCCGTCGACTAATGATGGTGATGATGATGTTTGATCTCGAGCTCGGTCC; 15, AAATGCGCAGGCCTCCCCATATTCCTCGGA; 16, TCGTCCGGAGCCACCTCCACCTGAGCTCATCTGCAAAGAGTTGATG; and 17, AAATCCGGAGGTGGTGGATCCGATATCCAGCTGCAGCAGTC.
Ligand displacement assays
Chinese hamster ovary (CHO) cells stably transfected with CCR5 or CXCR4 (20) were incubated for 4 h on ice with 1 nM 125I-labeledRANTES and one of several inhibitors (RM, MR, RANTES, or anti-CD4 scFv VL-VH). After washing with ice-cold PBS, cell-bound radioactivity was counted with a gamma counter. CCR5-specific binding of 125I-labeled RANTES was received by subtracting cell-bound radioactivity on CXCR4+ CHO cells from cell-bound radioactivity on CCR5+ CHO cells for each concentration of the inhibitor. Specific 125I-labeled RANTES (percentage) was calculated as (specific binding (inhibitor)/specific binding (medium)) x 100. All incubations were performed in triplicate. Error bars indicate the SD.
FACS analysis and down-modulation of CCR5
Binding of the constructs to CD4 on T cells was analyzed by flow cytometry. PBMC were incubated for 1 h on ice with the constructs, washed with PBS, and further stained with an Ab against 6xHis (Dianova) or an Ab against RANTES (clone VL-1) (35), followed by a PE-labeled rabbit anti-mouse polyclonal Ab (R0439; DakoCytomation). To demonstrate competition of the constructs with binding of an FITC-labeled CD4 Ab (clone 13B8.2; Coulter), PBMC were preincubated with the constructs or RANTES for 1 h on ice and, without washing, were directly stained with the CD4-FITC Ab (Coulter). The mean channel fluorescence (MCF) was quantified by flow cytometry, and the relative binding of CD4-FITC was calculated as (MCF (inhibitor) MCF (negative control))/(MCF (medium) MCF (negative control)). Cells not stained with CD4-FITC served as the negative control.
For CCR5 down-modulation, PBMC were incubated for 30 min at 37°C with the constructs or RANTES and stained on ice with a combination of directly conjugated Abs against CCR5 (CCR5-PE clone 2D7; BD Pharmingen), CD8-CyChrome, and CD4-allophycocyanin (Coulter). MCF was quantified on CD4- and CD8-positive T cells by FACS analysis. CCR5 surface expression was calculated as (MCF (experimental) MCF (negative control))/(MCF (medium) MCF (negative control)). Cells not stained with the CCR5-PE Abs were used as the negative control. Down-modulation of CCR5 from CHO cells transfected with CCR5 or a combination of CCR5 and CD4 (36) was performed as described previously (20).
For wash-out experiments, PBMC were preincubated for 30 min on ice with the constructs or RANTES, washed three times with ice-cold PBS, warmed to 37°C, and incubated for 30 min. Cells were stained on ice with the CCR5 Ab MC-1 or an IgG-1 isotype control Ab, followed by an FITC-labeled mAb against murine IgG1 (BD Pharmingen). After blockade with 5% mouse serum, cells were stained with CD8-CyChrome and CD3-allophycocyanin Abs (Coulter). CD8 T cells were identified by the expression of CD8 and CD3, whereas CD4 T cells were identified by the expression of CD3 and the absence of CD8. CCR5 surface expression was calculated as described above.
HIV-1 infection
The T-tropic HIV-1 strain IIIB was propagated in H9 cells, whereas the M-tropic HIV-1 isolates SF-162 and BAL were passaged in PBMC. PBMC were isolated from full blood of healthy donors by Ficoll density gradient centrifugation and cultured overnight with rIL-2 (20 U/ml). PBMC were preincubated for 3 h with inhibitors at concentrations of 20 and 4 nM or PBS as a control before various HIV-1 strains (SF-162, BAL, and IIIB) were added. After incubation for 8 days, HIV-1 reverse transcriptase activity as an index of viral infection, was measured with a commercial kit according to the manufacturers recommendations (Roche). The reverse transcriptase activity of PBMC not infected with HIV-1 served as the negative control. All incubations were performed in quadruplicate and reproduced at least three times. Relative reverse transcriptase activity was calculated as (reverse transcriptase [inhibitor] reverse transcriptase (negative control))/(reverse transcriptase (PBS) reverse transcriptase (negative control)). Error bars indicate the SD.
 |
Results
|
|---|
Cloning of bifunctional constructs
The variable domains of the L (VL) and H (VH) Ig chains of the CD4-Ab M-T413 were cloned by RT-PCR. Several independent clones were sequenced to exclude the introduction of mutations by PCR. Two different versions of scFv fragments were generated by fusing the VL and VH domains with 15 aa flexible linkers consisting of (Gly4Ser)3. One scFv fragment contained the VL domain at the N-terminal position (VL-VH), and the other contained the VH domain in the N-terminal position (VH-VL). A C-terminal histidine tail was added for detection and purification of the constructs. Both scFv fragments were expressed in the periplasmic space of E. coli and showed excellent binding to CD4 on T cells (data not shown).
In a first trial to construct the bifunctional fusion proteins, the chemokine RANTES was fused to the N terminus of the VL-VH scFv. When expressed in E. coli or CHO cells, only the RANTES part of the bifunctional construct was active, as measured by CCR5 down-modulation, whereas the anti-CD4 scFv VL-VH part was inactive. We designed two new constructs to circumvent this problem. First, the RANTES sequence was fused to the C terminus of the scFv VL-VH fragment using a spacer sequence that was optimized so as not to influence the activity of RANTES. Using (Gly4Ser)2 as the spacer sequence did not influence the activity of RANTES (see below). A scheme of the construct (abbreviated with MR) is shown in Fig. 1. The second strategy was to fuse the RANTES sequence to the N terminus of the scFv fragment with the arrangement of variable domains in the order VH-VL (construct abbreviated with RM; Fig. 1). Based on our previous data from the design of various bispecific scAbs, we assumed that the VH-VL arrangement would be more resistant to the addition of N-terminal protein sequences (34, 37). The RANTES sequence was fused to the CD4 scFv VH-VL fragment using Ser(Gly4Ser)2 as spacer. The bifunctional constructs were expressed in the periplasmic space of E. coli and purified by affinity chromatography with Ni-NTA columns as described in Materials and Methods. The purity and integrity of the constructs were analyzed by SDS-PAGE. Coomassie stain showed a single band at the expected size of
33 kDa (data not shown).
Binding of constructs to CD4
Human PBMC were incubated with the constructs RM and MR (20 nM) for 1 h on ice. Cell-bound constructs were detected with two different secondary Abs, an mAb against RANTES (VL-1) and an mAb against the histidine tail. Binding of the constructs to CD4+ lymphocytes was equally well detectable with both secondary reagents, indicating that the anti-CD4 scFv part is functionally active, and the RANTES and anti-CD4 moieties are linked to each other (Fig. 2a). The constructs RM and MR showed the same binding to CD4 T cells as the monovalent anti-CD4 scFv fragment detected with an Ab against the histidine tail (data not shown). In addition, no background staining was observed with PBS, plain RANTES, or RANTES with a C-terminal histidine tail (20 nM) using mAbs against either RANTES or the C-terminal histidine tail (data not shown). This excludes that in Fig. 2a merely the binding of RANTES to chemokine receptors or to surface glycosaminoglycans is measured. Binding of the constructs to CD4+ T cells was concentration dependent, with 1 nM being well above the detection limit (Fig. 2b). In a second set of experiments we analyzed whether the bifunctional constructs also compete with binding of CD4 mAbs (Fig. 3). For that purpose, human PBMC were preincubated with RM, MR, or RANTES on ice, and the subsequent binding of an FITC-labeled CD4 mAb was analyzed. Preincubation of the cells with RM and MR completely blocked CD4-FITC binding in a concentration-dependent manner, whereas preincubation with RANTES had no effect (Fig. 3).

View larger version (26K):
[in this window]
[in a new window]
|
FIGURE 2. Binding of the bifunctional constructs to CD4. a, FACS analysis showing binding of RM (upper panel) and MR (lower panel) to a subpopulation of CD4-positive human lymphocytes. Lymphocytes were identified by their forward and sideward light scatter properties. Binding is equally well detectable with secondary Abs against the histidine tail (left) or against RANTES (right), indicating that the fusion between RANTES and the CD4 scFv fragment is intact. Both RANTES alone and medium followed by Abs against RANTES and the histidine tail were used as a negative control and did not result in staining of a subpopulation of lymphocytes (data not shown). b, Dose-dependent binding of the constructs RM and MR to CD4+ T cells detected with an Ab against the histidine tail.
|
|

View larger version (25K):
[in this window]
[in a new window]
|
FIGURE 3. Blockade of CD4 with the bifunctional constructs. a, Recognition of CD4+ T cells among human PBMC with an FITC-labeled CD4 mAb ( 5 µg/ml) is completely prevented by preincubation of the cells with the constructs RM and MR. b, Preincubation with the bifunctional constructs at various concentrations reduces binding of CD4-FITC Abs, whereas preincubation with RANTES alone did not alter binding of CD4-FITC Abs. One of three representative experiments is shown.
|
|
Binding to CCR5 and CCR5 down-modulation on CD4-positive and CD4-negative cells
Binding of the bifunctional constructs to CCR5 was demonstrated with a ligand competition assay using 125I-labeled RANTES as probe (Fig. 4). CHO cells stably transfected with CCR5 or CXCR4 were incubated for 4 h on ice with 1 nM 125I-labeled RANTES and one of several inhibitors (RM, MR, RANTES, or CD4 scFv) at various concentrations. After several washing steps, cell-bound radioactivity was counted. To control for CCR5-independent binding of RANTES to cell surfaces (38, 39), cell-bound radioactivity on CXCR4+ CHO cells was subtracted from cell-bound radioactivity on CCR5+ CHO cells for each concentration of the inhibitor. The data shown in Fig. 4 demonstrate that the bifunctional constructs and unmodified RANTES bind with similar efficacy to CCR5. The VL-VH scFv fragment against CD4 alone served as an additional control and was unable to displace 125I-labeled RANTES binding.

View larger version (14K):
[in this window]
[in a new window]
|
FIGURE 4. Binding of the constructs RM and MR to CCR5, as demonstrated by competition with 125I-labeled RANTES. The bifunctional constructs RM and MR show similar competition as unmodified RANTES for 125I-labeled RANTES binding to CCR5-transfected CHO cells. An scFv fragment directed against CD4 (CD4 scFv) did not interfere with binding of 125I-labeled RANTES to CCR5. As described in Materials and Methods, CHO cells transfected with CXCR4 were used to control for the CCR5-independent binding of RANTES to CHO cells.
|
|
Because down-modulation of CCR5 is considered an important mechanism of HIV-1 suppression by chemokines, we analyzed CCR5 down-modulation by incubating the cells for 30 min at 37°C with the bifunctional constructs in comparison with RANTES. Down-modulation was measured on CD4-positive and -negative cells to investigate whether the additional binding of the bifunctional constructs to CD4 has an influence on CCR5 down-modulation. CHO cells stably transfected with CCR5 alone or with both CCR5 and CD4 were incubated with RANTES or the RANTES-anti-CD4 construct (RM; Fig. 5a). Although RANTES induced CCR5 down-modulation with equal efficacy on both CD4+ and CD4 CHO cells, the RM construct was markedly more effective on the CCR5 CD4 double-positive cells than on CCR5 single-positive cells. We then used PBMC as primary cells to confirm that the coexpression of CD4 and CCR5 enhances CCR5 down-modulation with the bifunctional constructs (Fig. 5b). Again, RANTES induced CCR5 down-modulation on CD4+ and CD8+ T cells with equal efficacy. In contrast, the constructs RM and MR induced about the same degree of CCR5 down-modulation on CD8+ T cells as RANTES, but were significantly more effective in down-modulation of CCR5 from CD4+ T cells (Fig. 5b). At a concentration of 11 nM, the construct RM reduced surface expression to 77% of the medium control on CD8+ T cells and to 49% of the medium control on CD4+ T cells. Similar differences were found with the construct MR, which reduced CCR5 surface expression to 71% on CD8+ and 52% on CD4+ T cells at a concentration of 11 nM (Fig. 5b). Based on the concentration of constructs necessary to induce the same degree of CCR5 internalization on CD4+ and CD8+ T cells, the constructs were roughly 10 times more effective with CD4+ compared with CD8+ T cells, whereas there was no difference with plain RANTES (Fig. 5b).

View larger version (25K):
[in this window]
[in a new window]
|
FIGURE 5. Preferential down-modulation of CCR5 from the surface of CD4+ cells by the bifunctional constructs. a, CHO cells stably transfected with CCR5 or a combination of CCR5 and CD4 were incubated for 30 min at 37°C with RANTES (10 nM) or various concentrations of the bifunctional construct RM. Surface CCR5 was measured by flow cytometry. Although unmodified RANTES induced down-modulation of CCR5 with identical efficacy on CD4-positive and -negative cells, the construct RM was markedly more active on the CD4+ cells. b, CCR5 down-modulation on CD4+ and CD8+ T cells with unmodified RANTES or the bifunctional constructs RM and MR. Although unmodified RANTES induced identical CCR5 down-modulation on CD4+ and CD8+ T cells, the bifunctional constructs were clearly more effective on CD4+ T cells. This indicates that the additional binding of the constructs to CD4 enhances the down-modulation of CCR5. One of three representative experiments is shown.
|
|
In additional experiments we analyzed whether CD4-bound bifunctional constructs would be able to induce CCR5 down-modulation in the absence of soluble constructs (Fig. 6). For that purpose, PBMC were preincubated for 30 min on ice with the bifunctional construct RM or unmodified RANTES. Preincubation on ice did not allow CCR5 down-modulation. Subsequently, the cells were washed with ice-cold PBS to remove the unbound reagents and were warmed to 37°C for 30 min (Fig. 6, upper panel), 120 min, and 24 h (Fig. 6, lower panels) to allow CCR5 down-modulation. This experimental approach mimics the situation in vivo, where unbound constructs disappeared according to their plasma half-lives, and only cell-bound molecules were present. Under these conditions, unmodified RANTES was hardly able to induce down-modulation of CCR5 on CD4+ or CD8+ T cells. In contrast, the bifunctional construct RM at a concentration of 10 nM induced down-modulation of CCR5 to 54% of control levels within 30 min on CD4+ T cells, whereas it showed little activity on CD8+ T cells (Fig. 6, upper panel). When the incubation at 37°C was increased to 120 min and 24 h, the construct RM (20 nM) induced an even stronger down-modulation of CCR5 (to 17% of control) on CD4+ T cells, whereas RANTES (100 nM) induced an up-regulation of surface CCR5 expression (Fig. 6, middle and lower panels). We also used a different setting, where down-modulation of CCR5 was induced by incubating cells at 37°C for 30 min with RANTES or RM. After wash-out of RANTES and RM, cells were further incubated at 37°C for 120 min, which is known to allow recycling of internalized receptors (20). Also in this case, the construct RM was much more active than RANTES, with CCR5 levels on CD4+ T cells being 19% of control with RM and 71% of control with RANTES (33 nM; data not shown). Together, these data indicate that CD4-bound RANTES (RM construct) can induce CCR5 down-modulation, remains active for at least 24 h, and primarily affects CCR5s on CD4-positive cells.

View larger version (28K):
[in this window]
[in a new window]
|
FIGURE 6. Down-modulation of CCR5 by CD4-bound bifunctional constructs in the absence of free/unbound constructs. Human PBMC were preincubated with unmodified RANTES or the bifunctional construct RM for 30 min on ice and extensively washed to remove unbound molecules. Preincubation on ice prevents down-modulation of CCR5 during the preincubation period. Cells were subsequently warmed to 37°C and further incubated for 30 min (upper panel), 120 min (middle panel), and 24 h (lower panel) to allow CCR5 down-modulation. Although unmodified RANTES was hardly able to induce CCR5 down-modulation after 30 min at 37°C, the bifunctional construct RM efficiently induced down-modulation of CCR5 on CD4+, but not on CD8+, T cells (upper panel). When the incubation time at 37°C was increased to 2 and 24 h, down-modulation of CCR5 on CD4+ T cells became more effective with the construct RM, whereas with RANTES, CCR5 surface levels increased (middle panel). Representative histograms of CCR5 expression on CD4+ T cells after 24 h incubation at 37°C are shown (lower panels).
|
|
Inhibition of HIV-1 infection
The ability of the bifunctional constructs to block cellular HIV-1 infection was compared with the inhibitory activity of RANTES, the CD4 scFv fragment derived from the Ab M-T413 and the parental CD4 mAb M-T413 (Fig. 7). Human PBMC were cultured overnight with 20 U/ml IL-2 and preincubated for 3 h with the various inhibitors at concentrations of 20 and 4 nM, followed by addition of HIV virus. Eight days after infection, viral replication was measured by reverse transcriptase activity. Experiments were performed with two M-tropic strains (SF162 and BAL) as well as with the T-tropic strain IIIB. As shown in Fig. 7a, the bifunctional constructs were
10 times more effective than the monospecific inhibitors. RANTES alone (20 nM) reduced HIV-1 infection with the M-tropic strain SF162 to 30% of control values, whereas a slight increase in HIV-1 replication was observed with the T-tropic strain IIIB (Fig. 7a). The CD4 scFv fragment and the parental mAb M-T413 showed only marginal blockade of SF162 and, in the case of the mAb, moderate activity against the T-tropic strain IIIB. In contrast, the bifunctional constructs RM and MR (20 nM) reduced HIV-1 infection of the SF162 strain to
1% of control values and also had moderate activity against the T-tropic strain IIIB (Fig. 7a). The M-tropic strain BAL is markedly more sensitive toward CCR5 inhibition than SF162. RANTES at 20 nM reduced viral replication of BAL to 5% of the control value and had moderate activity at 4 nM (reduction to 26%). Again, the bifunctional constructs were much more potent inhibitors, as demonstrated by a reduction in viral replication to
1 and 2% at inhibitor concentrations of 20 and 4 nM, respectively. In addition, we analyzed whether the improved inhibition of HIV-1 with the bifunctional constructs is dependent on the covalent linkage of RANTES and anti-CD4 scFv (Fig. 7b). For that purpose we compared a combination of anti-CD4 scFv and RANTES with the bifunctional constructs RM and MR using the M-tropic strain BAL. As shown in Fig. 7b, the bifunctional constructs (20 nM) were markedly more effective than the combination of RANTES and anti-CD4 scFv (20 nM each).

View larger version (26K):
[in this window]
[in a new window]
|
FIGURE 7. Inhibition of cellular HIV-1 infection with the bifunctional constructs. a, The bifunctional constructs RM and MR were compared with unmodified RANTES, an scFv fragment against CD4, and the parental CD4 mAb MT413 for their ability to block HIV infection of human PBMC with the M-tropic strains SF-162 and BAL and the T-tropic strain IIIB. At a concentration of 20 nM (upper panels), the bifunctional constructs almost completely suppressed infection with the M-tropic strain SF-162, whereas the other inhibitors were 10100 times less effective. At a concentration of 4 nM, almost complete suppression of the M-tropic strain HIV-BAL was observed with the bifunctional constructs, whereas all other inhibitors were only marginally active. One of four representative experiments is shown. b, Comparison of the bifunctional constructs with a combination of RANTES and the CD4 scFv fragment (20 nM each). The bifunctional constructs were significantly more active against the M-tropic strain SF-162 than the combination of both inhibitors.
|
|
 |
Discussion
|
|---|
Two bifunctional constructs were generated consisting of the chemokine RANTES and a CD4 Ab fragment with the ability to bind to CD4 and CCR5 simultaneously. The rationale to develop these constructs is the requirement for M-tropic HIV-1 to interact with CD4 and CCR5 to infect target cells. Binding of gp120 to CD4 induces a conformational change in the gp120 molecule that enables interaction with nearby CCR5s and finally allows fusion of the virus with the cell membrane. The bifunctional constructs mimic gp120 in that they bind to CD4 and preferentially interact with CCR5s on the same cell and even more with those CCR5s in close proximity with CD4. Most interestingly, these constructs preferentially down-modulate surface CCR5 from CD4-positive cells and markedly reduce CD4-CCR5-mediated HIV infection of PBMC. This is the first time that a bifunctional fusion construct that targets both a receptor and a coreceptor has been demonstrated to have therapeutic potential.
The bifunctional constructs were designed to contain RANTES as CCR5 ligand and an scFv Ab fragment for binding to CD4. RANTES was chosen as CCR5 ligand, because RANTES compared with CCR5 Abs is a rather potent HIV-1 inhibitor that not only acts by sterical blockade of gp120-CCR5 binding, but also efficiently down-modulates CCR5 (20, 22, 23, 24). Disappearance of CCR5 from the cell surface, in contrast to sterical blockade of CCR5, is thought to be unfavorable for the appearance of escape mutants that use CCR5 epitopes not covered by RANTES. The scFv fragment against CD4 is derived from the mAb M-T413 that binds to the first domain of CD4 and was previously shown to interfere with HIV infection (33). The absence of the Ig Fc domains in the scFv fragment does not enable complement or Ab-dependent cellular cytotoxicity-dependent effector mechanisms and is not supposed to induce depletion of CD4 T cells in vivo, as is observed after application of CD4 mAbs in humans (15). The disadvantage of CD4 Abs that recognize the first CD4 domain and directly interfere with gp120 binding is their potential interference with the CD4-MHC class II interaction. This disadvantage might be overcome by using HIV-1-blocking CD4 Abs that bind to the second CD4 domain (13, 18).
The fusion of RANTES and the scFv fragment to generate fully active bifunctional constructs required optimized linker sequences, a certain arrangement of VL and VH domains in the scFv fragment, as well as an appropriate expression system. N-terminal modification of RANTES critically influences the activity of RANTES, as shown, for instance, with Met-RANTES, where the addition of an N-terminal methionine results in a CCR5 antagonist (40). To find a suitable linker to fuse the scFv fragment at the N terminus of RANTES (construct MR), we analyzed how the addition of several different amino acids to the N terminus of RANTES alters its ability to bind to and activate CCR5. Serine and glycine residues had no detectable influence on the interaction of RANTES with CCR5 and were therefore chosen as linker sequences. The arrangement of VL and VH domains was critical for the functional activity of the scFv fragment when RANTES was fused to the N terminus of the scFv fragment (construct RM). Only the VH-VL scFv fragment maintained its ability to bind CD4, whereas the VL-VH scFv was inactive as a fusion protein with RANTES at the N-terminal position. To avoid the addition of an N-terminal methionine during intracellular expression in E. coli, we have chosen to express the constructs in the periplasmic space, which also avoided the necessity of refolding the proteins.
Binding of the bifunctional constructs to CD4 was shown by FACS analysis using secondary Abs that recognize the histidine tail or the RANTES moiety and by competition with an FITC-labeled CD4 Ab. Binding of the constructs to CCR5 was demonstrated by ligand competition assay using radioactively labeled RANTES and by down-modulation of CCR5. We were not able to show binding of the constructs to CCR5 by flow cytometry on CCR5-transfected CHO cells or CD8+ T cells using secondary Abs against the histidine tail, even though all incubations were performed on ice to prevent CCR5 down-modulation (Fig. 2 and data not shown). The failure to directly detect CCR5 binding of the constructs by flow cytometry was not unexpected, because detection of CCR5 binding of unmodified RANTES with Abs against RANTES or against the histidine tail in the case of histidine-tagged RANTES was also unsuccessful (data not shown). This indicates that the interaction of RANTES with CCR5 may not be stable enough to survive the repeated washing steps required for FACS analysis. The main advantage of fusing RANTES with the CD4 scFv fragment, therefore, appears to be the stable and prolonged binding of the constructs to CD4. This targeting of RANTES to CD4 explains the preferential down-modulation of CCR5 on CD4+ compared with that on CD8+ T cells. To obtain the same degree of CCR5 internalization,
10 times lower concentrations of the constructs were necessary for CD4+ compared with CD8+ T cells, although there was no difference in the case of RANTES. The most pronounced difference between RANTES and the construct RM was observed when CCR5 down-modulation was analyzed after wash-out of the CCR5 ligands. RANTES or RM was preincubated with PBMC on ice and then removed by several washing steps with ice-cold medium. During preincubation on ice, no down-modulation of CCR5 occurred. Subsequently, the cells were warmed to 37°C to allow CCR5 down-modulation. A marked CCR5 down-modulation was only seen with the construct RM and only on CD4+ T cells, whereas little down-modulation was observed on CD8+ T cells or with plain RANTES. When the incubation at 37°C was increased to 120 min or 24 h, the differences between RANTES and the construct RM were even more pronounced. These experiments show that the bifunctional constructs bind to CD4 for prolonged periods of time, and that CD4-bound RANTES is able to induce down-modulation of CCR5 and primarily affects CCR5s on CD4+ cells. The recycling of CCR5 probably explains why unmodified RANTES hardly induced CCR5 down-modulation after wash-out, because RANTES would be removed from the receptor during recycling of CCR5. In the case of the bifunctional construct, one could imagine several possibilities of how internalization of CCR5 could occur even after wash-out of unbound constructs. The first explanation is based on the fact that the number of cell surface CD4 molecules, and therefore the number of bifunctional constructs bound to CD4, by far exceeds the number of CCR5s (32). After recycling of CCR5, enough CD4-bound RANTES molecules would be present on the cell surface to enable repeated down-modulation of CCR5. Eventually, this might almost totally exhaust surface expression of CCR5. Second, one could also hypothesize that the combined internalization of CCR5 with CD4 results in different handling during the endocytic pathway, which does not allow recycling of CCR5 (41). Whatever the mechanism might be, clearly the bifunctional constructs result in an effective surface depletion of CCR5 on CD4-positive cells that appears to have pathobiological consequences in terms of infection with HIV.
To this end we tested the ability of the constructs to block HIV-1 infection with two M-tropic strains and one T-tropic strain. A moderate inhibitory activity of the constructs against the T-tropic strain (IIIB) was seen. This most likely results from the blockade of CD4, because RANTES alone showed a slight increase in T-tropic HIV-1 infection, in accordance with published data (42, 43). When M-tropic strains were analyzed (SF-162 and BAL), the bifunctional constructs proved to be
10 times more effective than either RANTES or Abs against CD4 in blocking cellular HIV-1 infection. The constructs were still significantly more effective compared with a combination of RANTES and CD4 Abs, indicating that the fusion of both inhibitors results in an additional HIV-1-suppressive effect. A caveat has to be mentioned about the possibility of the bifunctional constructs inducing clustering of CD4 and CCR5. If the constructs dissociate from the clusters, the clusters may persist and enhance HIV-1 infection. However, at least as long as the constructs remain bound to the clusters, they would prevent binding of HIV-1 gp120 and suppress HIV-1 infection.
In summary, the simultaneous targeting of CCR5 and CD4 with bifunctional inhibitors consisting of RANTES and an Ab fragment against CD4 leads to a preferential down-modulation of CCR5 on CD4+ T cells, enables a stable and prolonged binding to CD4+ cells, and markedly suppresses HIV-1 infection of PBMC. Furthermore, the fusion of RANTES with CD4 Abs is superior to RANTES or CD4 Abs and constitutes a novel principle for treatment of HIV-1 infection.
 |
Acknowledgments
|
|---|
We thank Peter Weinzirl for help with the HIV infection assays.
 |
Disclosures
|
|---|
The authors have no financial conflict of interest.
 |
Footnotes
|
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
1 This work was supported by grants from the Deutsche Forschungsgemeinschaft (to M.M.). 
2 Address correspondence and reprint requests to Dr. Matthias Mack, Department of Internal Medicine, University of Regensburg, 93042 Regensburg, Germany. E-mail address: matthias.mack{at}klinik.uni-regensburg.de 
3 Abbreviations used in this paper: sc, single chain; CHO, Chinese hamster ovary; MCF, mean channel fluorescence. 
Received for publication June 23, 2005.
Accepted for publication September 28, 2005.
 |
References
|
|---|
- Moore, J. P., S. G. Kitchen, P. Pugach, J. A. Zack. 2004. The CCR5 and CXCR4 coreceptors: central to understanding the transmission and pathogenesis of human immunodeficiency virus type 1 infection. AIDS Res. Hum. Retroviruses 20: 111-126. [Medline]
- Feng, Y., C. C. Broder, P. E. Kennedy, E. A. Berger. 1996. HIV-1 entry cofactor: functional cDNA cloning of a seven-transmembrane, G protein-coupled receptor. Science 272: 872-877. [Abstract]
- OBrien, S. J., J. P. Moore. 2000. The effect of genetic variation in chemokines and their receptors on HIV transmission and progression to AIDS. Immunol. Rev. 177: 99-111. [Medline]
- Samson, M., F. Libert, B. J. Doranz, J. Rucker, C. Liesnard, C. M. Farber, S. Saragosti, C. Lapoumeroulie, J. Cognaux, C. Forceille, et al 1996. Resistance to HIV-1 infection in Caucasian individuals bearing mutant alleles of the CCR-5 chemokine receptor gene. Nature 382: 722-725. [Medline]
- Schuitemaker, H., M. Koot, N. A. Kootstra, M. W. Dercksen, R. E. de Goede, R. P. van Steenwijk, J. M. Lange, J. K. Schattenkerk, F. Miedema, M. Tersmette. 1992. Biological phenotype of human immunodeficiency virus type 1 clones at different stages of infection: progression of disease is associated with a shift from monocytotropic to T-cell-tropic virus population. J. Virol. 66: 1354-1360. [Abstract/Free Full Text]
- Traunecker, A., W. Luke, K. Karjalainen. 1988. Soluble CD4 molecules neutralize human immunodeficiency virus type 1. Nature 331: 84-86. [Medline]
- Deen, K. C., J. S. McDougal, R. Inacker, G. Folena-Wasserman, J. Arthos, J. Rosenberg, P. J. Maddon, R. Axel, R. W. Sweet. 1988. A soluble form of CD4 (T4) protein inhibits AIDS virus infection. Nature 331: 82-84. [Medline]
- Hussey, R. E., N. E. Richardson, M. Kowalski, N. R. Brown, H. C. Chang, R. F. Siliciano, T. Dorfman, B. Walker, J. Sodroski, E. L. Reinherz. 1988. A soluble CD4 protein selectively inhibits HIV replication and syncytium formation. Nature 331: 78-81. [Medline]
- Schooley, R. T., T. C. Merigan, P. Gaut, M. S. Hirsch, M. Holodniy, T. Flynn, S. Liu, R. E. Byington, S. Henochowicz, E. Gubish, et al 1990. Recombinant soluble CD4 therapy in patients with the acquired immunodeficiency syndrome (AIDS) and AIDS-related complex. A phase I-II escalating dosage trial. Ann. Intern. Med. 112: 247-253.
- Schacker, T., A. C. Collier, R. Coombs, J. D. Unadkat, I. Fox, J. Alam, J. P. Wang, E. Eggert, L. Corey. 1995. Phase I study of high-dose, intravenous rsCD4 in subjects with advanced HIV-1 infection. J. Acquired Immune Defic. Syndr. Hum. Retrovirol. 9: 145-152. [Medline]
- Daar, E. S., X. L. Li, T. Moudgil, D. D. Ho. 1990. High concentrations of recombinant soluble CD4 are required to neutralize primary human immunodeficiency virus type 1 isolates. Proc. Natl. Acad. Sci. USA 87: 6574-6578. [Abstract/Free Full Text]
- Wu, L., N. P. Gerard, R. Wyatt, H. Choe, C. Parolin, N. Ruffing, A. Borsetti, A. A. Cardoso, E. Desjardin, W. Newman, et al 1996. CD4-induced interaction of primary HIV-1 gp120 glycoproteins with the chemokine receptor CCR-5. Nature 384: 179-183. [Medline]
- Kuritzkes, D. R., J. Jacobson, W. G. Powderly, E. Godofsky, E. DeJesus, F. Haas, K. A. Reimann, J. L. Larson, P. O. Yarbough, V. Curt, et al 2004. Antiretroviral activity of the anti-CD4 monoclonal antibody TNX-355 in patients infected with HIV type 1. J. Infect. Dis. 189: 286-291. [Medline]
- Hu, Q., I. Frank, V. Williams, J. J. Santos, P. Watts, G. E. Griffin, J. P. Moore, M. Pope, R. J. Shattock. 2004. Blockade of attachment and fusion receptors inhibits HIV-1 infection of human cervical tissue. J. Exp. Med. 199: 1065-1075. [Abstract/Free Full Text]
- van der Lubbe, P. A., C. Reiter, F. C. Breedveld, K. Kruger, M. Schattenkirchner, M. E. Sanders, G. Riethmuller. 1993. Chimeric CD4 monoclonal antibody cM-T412 as a therapeutic approach to rheumatoid arthritis. Arthritis Rheum. 36: 1375-1379. [Medline]
- Reddy, M. P., C. A. Kinney, M. A. Chaikin, A. Payne, J. Fishman-Lobell, P. Tsui, P. R. Dal Monte, M. L. Doyle, M. R. Brigham-Burke, D. Anderson, et al 2000. Elimination of Fc receptor-dependent effector functions of a modified IgG4 monoclonal antibody to human CD4. J. Immunol. 164: 1925-1933. [Abstract/Free Full Text]
- Isaacs, J. D., J. Greenwood, H. Waldmann. 1998. Therapy with monoclonal antibodies. II. The contribution of Fc
receptor binding and the influence of C(H)1 and C(H)3 domains on in vivo effector function. J. Immunol. 161: 3862-3869. [Abstract/Free Full Text]
- Moore, J. P., Q. J. Sattentau, P. J. Klasse, L. C. Burkly. 1992. A monoclonal antibody to CD4 domain 2 blocks soluble CD4-induced conformational changes in the envelope glycoproteins of human immunodeficiency virus type 1 (HIV-1) and HIV-1 infection of CD4+ cells. J. Virol. 66: 4784-4793. [Abstract/Free Full Text]
- Liu, R., W. A. Paxton, S. Choe, D. Ceradini, S. R. Martin, R. Horuk, M. E. MacDonald, H. Stuhlmann, R. A. Koup, N. R. Landau. 1996. Homozygous defect in HIV-1 coreceptor accounts for resistance of some multiply-exposed individuals to HIV-1 infection. Cell 86: 367-377. [Medline]
- Mack, M., B. Luckow, P. J. Nelson, J. Cihak, G. Simmons, P. R. Clapham, N. Signoret, M. Marsh, M. Stangassinger, F. Borlat, et al 1998. Aminooxypentane-RANTES induces CCR5 internalization but inhibits recycling: a novel inhibitory mechanism of HIV infectivity. J. Exp. Med. 187: 1215-1224. [Abstract/Free Full Text]
- Alkhatib, G., M. Locati, P. E. Kennedy, P. M. Murphy, E. A. Berger. 1997. HIV-1 coreceptor activity of CCR5 and its inhibition by chemokines: independence from G protein signaling and importance of coreceptor downmodulation. Virology 234: 340-348. [Medline]
- Cocchi, F., A. L. DeVico, A. Garzino-Demo, S. K. Arya, R. C. Gallo, P. Lusso. 1995. Identification of RANTES, MIP-1
, and MIP-1
as the major HIV-suppressive factors produced by CD8+ T cells. Science 270: 1811-1815. [Abstract/Free Full Text]
- Olson, W. C., G. E. Rabut, K. A. Nagashima, D. N. Tran, D. J. Anselma, S. P. Monard, J. P. Segal, D. A. Thompson, F. Kajumo, Y. Guo, et al 1999. Differential inhibition of human immunodeficiency virus type 1 fusion, gp120 binding, and CC-chemokine activity by monoclonal antibodies to CCR5. J. Virol. 73: 4145-4155. [Abstract/Free Full Text]
- Lee, B., M. Sharron, C. Blanpain, B. J. Doranz, J. Vakili, P. Setoh, E. Berg, G. Liu, H. R. Guy, S. R. Durell, et al 1999. Epitope mapping of CCR5 reveals multiple conformational states and distinct but overlapping structures involved in chemokine and coreceptor function. J. Biol. Chem. 274: 9617-9626. [Abstract/Free Full Text]
- Baba, M., O. Nishimura, N. Kanzaki, M. Okamoto, H. Sawada, Y. Iizawa, M. Shiraishi, Y. Aramaki, K. Okonogi, Y. Ogawa, et al 1999. A small-molecule, nonpeptide CCR5 antagonist with highly potent and selective anti-HIV-1 activity. Proc. Natl. Acad. Sci. USA 96: 5698-5703. [Abstract/Free Full Text]
- Strizki, J. M., S. Xu, N. E. Wagner, L. Wojcik, J. Liu, Y. Hou, M. Endres, A. Palani, S. Shapiro, J. W. Clader, et al 2001. SCH-C (SCH 351125), an orally bioavailable, small molecule antagonist of the chemokine receptor CCR5, is a potent inhibitor of HIV-1 infection in vitro and in vivo. Proc. Natl. Acad. Sci. USA 98: 12718-12723. [Abstract/Free Full Text]
- Blanpain, C., J. M. Vanderwinden, J. Cihak, V. Wittamer, E. Le Poul, H. Issafras, M. Stangassinger, G. Vassart, S. Marullo, D. Schlndorff, et al 2002. Multiple active states and oligomerization of CCR5 revealed by functional properties of monoclonal antibodies. Mol. Biol. Cell 13: 723-737. [Abstract/Free Full Text]
- Simmons, G., P. R. Clapham, L. Picard, R. E. Offord, M. M. Rosenkilde, T. W. Schwartz, R. Buser, T. N. Wells, A. E. Proudfoot. 1997. Potent inhibition of HIV-1 infectivity in macrophages and lymphocytes by a novel CCR5 antagonist. Science 276: 276-279. [Abstract/Free Full Text]
- Signoret, N., A. Pelchen-Matthews, M. Mack, A. E. Proudfoot, M. Marsh. 2000. Endocytosis and recycling of the HIV coreceptor CCR5. J. Cell Biol. 151: 1281-1294. [Abstract/Free Full Text]
- Gallo, S. A., C. M. Finnegan, M. Viard, Y. Raviv, A. Dimitrov, S. S. Rawat, A. Puri, S. Durell, R. Blumenthal. 2003. The HIV Env-mediated fusion reaction. Biochim. Biophys. Acta 1614: 36-50. [Medline]
- Xiao, X., L. Wu, T. S. Stantchev, Y. R. Feng, S. Ugolini, H. Chen, Z. Shen, J. L. Riley, C. C. Broder, Q. J. Sattentau, et al 1999. Constitutive cell surface association between CD4 and CCR5. Proc. Natl. Acad. Sci. USA 96: 7496-7501. [Abstract/Free Full Text]
- Lee, B., M. Sharron, L. J. Montaner, D. Weissman, R. W. Doms. 1999. Quantification of CD4, CCR5, and CXCR4 levels on lymphocyte subsets, dendritic cells, and differentially conditioned monocyte-derived macrophages. Proc. Natl. Acad. Sci. USA 96: 5215-5220. [Abstract/Free Full Text]
- Rieber, E. P., C. Federle, C. Reiter, S. Krauss, L. Gurtler, J. Eberle, F. Deinhardt, G. Riethmuller. 1992. The monoclonal CD4 antibody M-T413 inhibits cellular infection with human immunodeficiency virus after viral attachment to the cell membrane: an approach to postexposure prophylaxis. Proc. Natl. Acad. Sci. USA 89: 10792-10796. [Abstract/Free Full Text]
- Mack, M., G. Riethmuller, P. Kufer. 1995. A small bispecific antibody construct expressed as a functional single-chain molecule with high tumor cell cytotoxicity. Proc. Natl. Acad. Sci. USA 92: 7021-7025. [Abstract/Free Full Text]
- Krensky, A. M., P. J. Nelson. 1997. Expression of chemokine RANTES and production of monoclonal antibodies. Methods Enzymol. 287: 162-174. [Medline]
- Mack, M., A. Kleinschmidt, H. Bruhl, C. Klier, P. J. Nelson, J. Cihak, J. Plachy, M. Stangassinger, V. Erfle, D. Schlondorff. 2000. Transfer of the chemokine receptor CCR5 between cells by membrane-derived microparticles: a mechanism for cellular human immunodeficiency virus 1 infection. Nat. Med. 6: 769-775. [Medline]
- Mack, M., R. Gruber, S. Schmidt, G. Riethmuller, P. Kufer. 1997. Biologic properties of a bispecific single-chain antibody directed against 17-1A (EpCAM) and CD3: tumor cell-dependent T cell stimulation and cytotoxic activity. J. Immunol. 158: 3965-3970. [Abstract]
- Kuschert, G. S., F. Coulin, C. A. Power, A. E. Proudfoot, R. E. Hubbard, A. J. Hoogewerf, T. N. Wells. 1999. Glycosaminoglycans interact selectively with chemokines and modulate receptor binding and cellular responses. Biochemistry 38: 12959-12968. [Medline]
- Mack, M., J. Pfirstinger, C. Weber, K. S. Weber, P. J. Nelson, T. Rupp, K. Maletz, H. Bruhl, D. Schlondorff. 2002. Chondroitin sulfate A released from platelets blocks RANTES presentation on cell surfaces and RANTES-dependent firm adhesion of leukocytes. Eur. J. Immunol. 32: 1012-1020. [Medline]
- Proudfoot, A. E., C. A. Power, A. J. Hoogewerf, M. O. Montjovent, F. Borlat, R. E. Offord, T. N. Wells. 1996. Extension of recombinant human RANTES by the retention of the initiating methionine produces a potent antagonist. J. Biol. Chem. 271: 2599-2603. [Abstract/Free Full Text]
- Pelchen-Matthews, A., J. E. Armes, M. Marsh. 1989. Internalization and recycling of CD4 transfected into HeLa and NIH3T3 cells. EMBO J. 8: 3641-3649. [Medline]
- Gordon, C. J., M. A. Muesing, A. E. Proudfoot, C. A. Power, J. P. Moore, A. Trkola. 1999. Enhancement of human immunodeficiency virus type 1 infection by the CC-chemokine RANTES is independent of the mechanism of virus-cell fusion. J. Virol. 73: 684-694. [Abstract/Free Full Text]
- Lee, S., C. K. Lapham, H. Chen, L. King, J. Manischewitz, T. Romantseva, H. Mostowski, T. S. Stantchev, C. C. Broder, H. Golding. 2000. Coreceptor competition for association with CD4 may change the susceptibility of human cells to infection with T-tropic and macrophagetropic isolates of human immunodeficiency virus type 1. J. Virol. 74: 5016-5023. [Abstract/Free Full Text]