|
|
||||||||




,
,
,¶
* Department of Medicine, University of Washington, Seattle, WA 98195;
Department of Laboratory Medicine, University of Washington, Seattle, WA 98195;
Department of Pathobiology, University of Washington, Seattle, WA 98195;
Fred Hutchinson Cancer Research Center, Seattle, WA 98109; and
¶ Benaroya Research Institute, Seattle, WA 98101
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
CD8 T cell responses are important for some aspects of host defense against orthopoxviruses. Humans with T cell and mixed abnormalities such as advanced HIV-1 infection may fail to contain primary orthopoxvirus infections (2), while patients with isolated Ab disorders typically contain infection normally (3). The abnormality in atopic dermatitis that permits human disseminated cutaneous vaccinia is unknown, but is likely related to T cell dysfunction (4). CD8-depleted or
2-microglobulin/ mice die after primary infection with ectromelia virus, an orthopoxvirus that infects mice in the wild, while untreated and CD4-depleted mice survive (5). Primary vaccinia challenge studies in mice typically fail to show a deleterious effect of depletion or deletion of CD8+ cells or
2-microglobulin, although CD8+ cells are important in MHCII/ mice (6, 7, 8). In nonhuman primates, vaccinia vaccine efficacy against monkeypox, a related orthopoxvirus, may not require CD8 cells and is strongly associated with neutralizing Abs (9). Cellular immunity is therefore likely to be most important for recovery from primary orthopoxvirus infection in the natural host species.
The primary CD8 response to vaccinia may reach levels of
25% of CD8 T cells in mice and 1% or greater in humans (6, 10, 11). The response declines, but persists for several decades in humans, without apparent re-exposure to Ag (10). CD8 responses are also provoked to heterologous Ags inserted into poxviruses (1). Little is known concerning the specificity, diversity, and dynamics of the CD8 response to vaccinia. Several HLA A*0201-restricted epitopes were derived by testing CD8 cells from vaccinated humans, or A*0201-transgenic mice, with peptides that were predicted on the basis of HLA-binding motifs to bind to HLA A*0201. Responses to three of these epitopes, in vaccinia Copenhagen open reading frames (ORFs) B22R, C7L, and H3L, have been detected in humans (11, 12, 13). To study CD8 responses to orthopoxviruses in diverse human populations with varying HLA types, and to provide tools to examine the quantitative relationship between antivector and anti-insert responses at the epitope level and to evaluate candidate vaccines for variola and other indications, we have defined a large number of novel CD8 epitopes. In contrast to bioinformatic-based approaches that scan for microbial peptides predicted to bind to HLA molecules, our method targets either cloned or bulk effector cells that are reactive with whole vaccinia virus. Our principal findings include the documentation that a theoretical ORF does encode immunogenic protein, the identification of candidate immunodominant ORFs containing several epitopes, and an estimate of the diversity of the acute response to primary vaccination. These epitopes may be useful in the design and evaluation of candidate vaccines for the prevention of variola and monkeypox in humans, and of candidate vectors for the delivery of heterologous Ags.
| Materials and Methods |
|---|
|
|
|---|
Eight adult subjects (Table I) receiving scarification with Dryvax smallpox vaccine for occupational health were consented after approval by the Institutional Review Board. Five had received one previous vaccination, ranging from 32 to 43 years before recent immunization, while one had received two previous vaccinations 28 and 52 years prior to reimmunization and two younger individuals were primary vaccinees. PBMC from peripheral blood obtained by phlebotomy into sodium heparin-anticoagulated syringes at weeks 2, 4, and 6 after vaccination were enriched by Ficoll centrifugation from peripheral blood and cryopreserved. No relationship between time after vaccination, or between primary vs revaccination status, and the yield of mononuclear cells per volume of blood was noted. HLA typing was done at the Puget Sound Blood Center (Seattle, WA).
|
PBMC were seeded at 106/ml in 2 ml of T cell medium (TCM) in 24-well plates (14). Live vaccinia at a multiplicity of infection (MOI) of 10 was added to restimulate lymphocytes (15). IL-2 (Hemagen) was begun on day 5 (32 U/ml). Cultures were split as needed, fed periodically with IL-2-TCM, and CTL assays done on days 1214. CD8 magnetic-positive selection (Miltenyi Biotec or StemCell Technologies), typically yielding >95% CD8+ cells, was followed by functional assays (below), cloning with PHA as mitogen, or bulk T cell expansion with anti-CD3 as mitogen (14). Clones were screened (day 14) by CTL assay. Positive clones were expanded (14) to >108 cells and used, or frozen, at the end of an expansion cycle. EBV-transformed B-lymphocyte continuous lines (LCL) were derived from PBMC (16). Vaccinia strain New York City Board of Health (NYCBH; National Institutes of Health Aids Research and Reference Reagent Program, Germantown, MD) was raised and titered in BSC-40 cells (16). Cos-7 and BSC-40 were cultured in DMEM with 10% FCS.
Lymphocyte functional assays
51Cr CTL assays used autologous mock- and vaccinia-infected (MOI 10, 18 h) LCL, or peptide-pulsed LCL (90 min, 37°C) at 2 x 103/well as targets (16). Candidate clones were screened singly or in duplicate. Clones with >20% specific release for vaccinia-infected LCL and <10% for uninfected targets were expanded. Established clones, and bulk cultures, were triplicate tested at 20 effectors/target. Percent-specific release was calculated (16); spontaneous release (16) was usually <25%. To assign restricting HLA class I alleles to CTL clones, panels of allogeneic LCL matched at one or more HLA class I alleles were used as APC with and without vaccinia infection. Patterns of results were analyzed for informative, nonambiguous restriction (14, 17) (see Results).
T cell activation was detected by IFN-
ELISA of culture supernatants (17). Exponential standard curves were used to convert OD450 values to cytokine concentrations and the level of IFN-
secreted by nonstimulated T cells subtracted to give specific secretion. For intracellular cytokine cytometry (ICC) (18), peptides (1 µM) were added to 35 x 105 bulk-cultured T cells in 500 µl of TCM for 15 h. A total of 1 x 105 autologous LCL were added as APC. Anti-CD28 and anti-CD49d, and brefeldin A, were added at 0 and 1 h, respectively (18). Each specimen was stained with anti-CD8-PE-Cyanin 5 (Cy5) or -FITC, permeabilized, and then split for staining with control mAb-PE or anti-IFN-
-PE. Controls were DMSO (1%) and PMA/ionomycin (18).
Flow cytometry
Bulk cultures were stained with anti-TCR
-FITC (BD Biosciences), anti-CD4-PE, and anti-CD8
-PE-Cy5 (Caltag Laboratories). PE-labeled tetrameric complexes of HLA B*0801 and peptide A50R 395403 (WLKIKRDYL) supplied by the National Institutes of Health Tetramer Program (Atlanta, GA) was used at 0.1 µl/5 x 105 cells in 75 µl of TCM, 60 min, room temperature, followed by anti-CD8-PE-Cy5 for 30 min, 4°C. Clones were stained with anti-TCR
and anti-CD8. HLA expression by 48-h transfected Cos-7 was measured by staining HLA-specific mAb (One Lambda; unlabeled, or biotin- or FITC-conjugated) and goat anti-mouse PE or streptavidin-PE (BD Biosciences). ICC data are reported as the percentage of CD8+ lymphocytes that stain positive for IFN-
(see Results). Data collected on FACScan (BD Biosciences) were analyzed with WinMDI 2.8 (
http://facs.scripps.edu/software.html
).
Vaccinia genomic library
BSC-40 cells at 90% confluent were infected 48 h with vaccinia NYCBH, MOI 10. Nuclear DNA was reduced by lysing cells (450 cm2) with 1% Nonidet P-40 (17), centrifugation (400 x g, 15 min), and retention of the supernatant. The cytoplasmic fraction was extracted with chloroform-phenol and DNA precipitated with ethanol (17). Vaccinia DNA was digested with DNase I (New England Biolabs) with optimized MnCl2 concentration, temperature, and enzyme/substrate ratio to generate DNA fragments in the 0.12 kB range. DNA was purified from the excised agarose gel zone corresponding to 300500 bp (Qiaquick). Termini were blunt-ended with T4 DNA polymerase and dNTPs. The gel-purified purified blunt-end fragments were ligated to a dsDNA adaptor with a 5' GA overhang: 5'-GAGGGTCCGACAGC (single-stranded overhangs are underlined). Unincorporated linkers were removed by gel purification. The library vector backbone (pEGFP-C1; BD Clontech) was XhoI-digested, partially filled in with dTTP and dCTP, and gel-purified to give TC overhangs complementary to the vaccinia fragments. After ligation and purification of DNA by organic extraction/ethanol precipitation, libraries were created by electroporation (BTX) of Escherichia coli DH10B (Invitrogen Life Technologies). Libraries were plated on 10 150-mm diameter kanamycin-LB plates. Bacteria rinsed from the primary growth plates with 10 ml of broth were frozen in aliquots for glycerol stocks, which were titered on kanamycin plates. 96-well deep-dish plates (n = 5) were seeded at 40 colonies/well. Resultant plasmid DNA for transfection was prepared (14) with an average yield of 5 µg/well. This yielded a library of 1.9 x 104 independent vaccinia DNA fragments at a complexity of 40/well. Pools were diluted to an average of 50 ng/µl DNA for screening. Forty single colonies derived from retransformation of selected pools were sequenced to check library insert identity and heterogeneity.
The purity of the vaccinia genomic DNA used for library construction was estimated by restriction endonuclease digestion/agarose electrophoresis. Discrete bands were observed (data not shown), consistent with reduction of cellular DNA. The primary library was estimated, from counting primary growth plates, to contain 3.0 x 104 unique kanamycin-resistant colonies. Sequencing of 40 random colonies showed that 90% contained single independent vaccinia DNA inserts, averaging 300-bp long (not shown). High diversity was also observed. The quality of the library 96-well miniprep DNA (14), derived from either pools or single bacterial clones, was verified by transfecting Cos-7 cells and observing enhanced GFP (eGFP) live-cell fluorescence in >50% of cells for most DNA preparations.
HLA cDNA expression plasmids
HLA A*0101, A*0201, and B*4403 cDNAs in pcDNA3.0 (Invitrogen Life Technologies) have been described (19, 20). HLA B*0801 cDNA in pcDNA 3.0 was obtained from Dr. J. Pei (Fred Hutchinson Cancer Research Center, Seattle, WA). For other alleles, RNA was isolated from subjects LCL (RNAeasy; Qiagen) and first strand cDNA synthesis primed with oligo(dT) (Superscript II; Invitrogen Life Technologies). cDNA template was PCR-amplified (pfu; Invitrogen Life Technologies). HLA A*2301 and A*2902 primers were GGCGCTAGCATGGCCGTCATGGCG and GGCCTCGAGTCACACTTTACAAGCTGTGAGAGAC (NheI and XhoI sites underlined). PCR products were digested, gel-purified, and directionally ligated into similarly digested pcDNA3.1 (Invitrogen Life Technologies). Low-endotoxin plasmid DNA was prepared (Qiagen) after sequence verification.
Epitope discovery
Details and examples have been published (14, 17). Briefly, functional HLA expression and restriction were confirmed by transfection of Cos-7 cells, plated the day before at 9 x 103/well in 96-well flats, with HLA cDNA (50 ng/well) using Fugene 6 (Roche) or Lipofectamine (Invitrogen Life Technologies), followed the next day by vaccinia infection (MOI 210). One day later, 5 x 104 cloned CD8 CTL were added in 130 µl of LCL media (16) with 2 U/ml IL-2. As controls, autologous or HLA-mismatched LCL were mock- or vaccinia-infected overnight at MOI 10 and cocultured (2.5 x 104 LCL and 510 x 104 CD8 CTL) in 96-well U plates for 24 h. Twenty-four hour supernatants were assayed for IFN-
. If HLA transfection plus infection lead to high IFN-
release, as described (17), HLA expression was functionally adequate for library screening.
Cos-7 were transfected with 50 ng of HLA cDNA and 150 ng of library pool DNA/well. We screened 384 library pools in duplicate, the equivalent of 1.5 x 104 discrete vaccinia genomic fragments. T cells were added 2448 h later and IFN-
was measured after an additional day. If multiple positive pools were detected, up to five were analyzed. Positive plasmid pools were broken down by retransformation and selection of 96 single daughter bacterial colonies per positive pool, screened as plasmid DNA in a secondary cotransfection assay. Single, biologically active plasmids were sequenced (17).
Candidate peptides were selected by bioinformatics (14). Briefly, if more than one active plasmid was sequenced, overlapping insert sequences were assembled into a contig (DNASTAR) after trimming. The overlap (or single) region was searched with a basic local alignment search tool(
www.poxvirus.org/
; Ref.21). Typically, the vaccinia insert was within a documented/predicted vaccinia ORF and in-frame with eGFP. Some exceptions are discussed in Results. Predicted amino acid sequences in the antigenic fragments were submitted to HLA epitope prediction algorithms (22, 23) and high-scoring peptides (Synpep) dissolved in DMSO. Orthopoxvirus genomes (21, 24) were searched for the presence and sequence of homologous ORFs, antigenic fragments, and peptide epitopes. Alphanumeric ORF nomenclature based on vaccinia Copenhagen HindIII digests, and systematic names, are used (21, 25).
High-throughput epitope discovery
Peptide epitopes recognized by bulk vaccinia-specific T cells were also identified using a parallel processing variant method. Cos-7 (384 wells) were transfected in duplicate with cDNA encoding one of the subjects HLA class I A or B alleles, plus the library. Bulk CD8 CTL (105/well) were substituted for cloned CTL as responders. Single active plasmids were sequenced and contigs assembled and analyzed as above. Candidate peptides were tested by loading (0.0110 µM) onto autologous LCL (2 x 105 cells, 200 µl of LCL medium, 90 min, 37°C). After washing, stimulators were plated in duplicate or triplicate with 1 x 105 bulk CTL responders in 130 µl of TCM with 2 U/ml IL-2 in 96-well U-bottom plates, and T cell activation detected by IFN-
ELISA in 24-h supernatants. Specific responses at 1 µM or lower were considered positive. As an alternative, bulk CTL were tested with synthetic peptides (1 µM) by IFN-
ICC as detailed above.
| Results |
|---|
|
|
|---|
Bulk CTL.
Vaccinia-specific CD8 T cells were initially detected by IFN-
ICC using whole PBMC responders and live vaccinia stimulation. Specific signals in the range of 1.0% of CD8+ lymphocytes were detected 26 wk after Dryvax, but not in vaccinia-naive subjects (Fig. 1, representative subject). To enrich vaccinia-specific CD8 T cells, PBMC from eight subjects (Table I), obtained 26 wk after intradermal vaccination, were restimulated once in vitro. Vaccinia-specific, self-restricted cytotoxicity was detected (not shown), as defined in Materials and Methods, in each subject except subject 1. These cultures were predominantly CD8+, CD4, and >95% TCR
+. CD8+ cells were purified from six cultures. For each, strong virus- and self-restricted CTL activity was detected (Fig. 1).
|

+, CD8+, and displayed vaccinia-specific lysis in confirmatory assays (data not shown). After expansion, HLA class I A or B restriction was unambiguously assigned for most clones using both panels of partially matched APC and by vaccinia infection/HLA transfection assays (example, Fig. 3). Each clone investigated (n = 5) gave identical results with both methods.
|
|
We defined peptide epitopes for five CD8 clones. For each, one or more vaccinia plasmids were strongly stimulatory for IFN-
release, and only when cotransfected with the appropriate HLA cDNA. If multiple library hits were obtained, they were aligned and shortest overlapping regions (SOR) were determined. For example, the HLA B*4403-restricted clone 2.59 from a primary vaccinee yielded four independent library hits (Fig. 4). The SOR was the C-terminal 29 aa of the theoretical ORF F3. This 49-aa-long ORF (VACVgp067) is predicted to lie between ORFs F14L and F15L in vaccinia Copenhagen (GenBank NC_001559), but has never been documented at the protein level. Of note, the plasmids RC4 B6 E7, RC1 H11 H8, and RC1 B5 C10 are fusions in which fragments of ORF F3, or the neighboring ORF F15 L, are predicted to be out of frame with eGFP. However, an ATG codon is present at predicted aa 25 of ORF F3. Sequence with features of a vaccinia early promoter (27), 5' to the predicted initiation codon of F3, occurs in plasmids RC2 B7 A10 (and RC4 B6 E7). Full-length F3, cloned after PCR into pEGFP-C1 as an in-frame fusion, was positive in the IFN-
Cos-7 cotransfection assay (not shown).
|
|
|
To speed epitope discovery, and explore within-subject diversity, we adapted expression cloning to bulk CTL responders. This eliminated the need to clone and expand CTL. A subset of the bulk CTL response was functionally isolated by transfecting Cos-7 cells with one of the subjects HLA A or B alleles. We analyzed the B*4403- and A*2301-restricted repertoires of primary vaccinee subject 2, and the A*0101-restricted response of revaccinee subject 5. Bulk CTL typically yielded many positive pools of vaccinia genomic DNA with a gradation of IFN-
responses. The pools stimulating the highest IFN-
levels were broken down to identify single vaccinia genomic fragments that stimulate IFN-
release when cotransfected with HLA cDNA (examples in Fig. 6). The biological activity of each positive vaccinia fragment reported was confirmed in at least one repeat assay.
|
ICC and/or ELISA to study peptide-level reactivity of bulk CTL. Each epitope in this report was positive in at least two repeats of one assay or one repeat of each assay. Intracellular cytokine cytometry
In the first format, singe-cell IFN-
responses were measured ICC after 15 h stimulation with vaccinia peptide (representative positive and negative examples and controls in Fig. 7). Responses in the presence of DMSO were somewhat above those observed with isotype control Ab, likely reflecting the prolonged (15 h) stimulation and residual activation from previous expansion and stimulation of the bulk CTL. Peptide stimulation lead to signals that were clearly separable from this background activation, ranging from 1.09 to 8.93%. The intensity of the specific IFN-
signal was very bright, in contrast to the moderate intensity observed with DMSO control. Down-shift of CD8
intensity was sometimes noted (see Discussion). ICC was used for rapid screening of candidate peptides. For example, a genomic fragment of ORF D5R encoding amino acids 290391 was positive when cotransfected with A*2301 (Fig. 6). Peptide-binding algorithms high-affinity HLA B*2301 binding for both 349357 and 356364. These peptides were each tested and only 349357 lead to detection of IFN-
-bright cells at a level above the background seen with DMSO alone.
|
1.55%. Use of an HLA B*0801-A50R 395403 tetramer to stain the same specimen detected 1.45% Ag-specific CD8 T cells (Fig. 7, right), while a control HSV-2 tetramer (28) was negative.
IFN-
secretion
The second IFN-
test format for high-throughput epitope discovery involved coincubation of bulk CTL with peptide-loaded autologous APC, and measurement of cytokine release into the media (Fig. 8). Most peptides checked were positive in both ICC and IFN-
secretion tests (example, A3L 264272, Figs. 7 and 8), but IFN-
secretion was generally more sensitive (not shown). For subject 2, eight additional epitopes (Fig. 8) were documented by IFN-
release to lie within genomic fragments that were active upon cotransfection with HLA B*4403 (Fig. 6). Responses to the epitope in ORF F3 detected at the clonal level (Figs. 4 and 5) were again detectable among bulk CTL. Of note, three discrete B*4403-restricted epitopes were detected in ORF A3L and two in ORF D5R. Overall, 16 epitopes have been defined by combining clonal reactivity and interrogation of bulk CTL with the IFN-
ICC and secretion assays (Table II).
|
|
HLA A*0201-restricted responses are of interest due to the high population prevalence of this allele. Subject 3, a revaccinee, had brisk HLA A*0201-restricted IFN-
release by bulk CD8 CTL exposed to Cos-7 artificially transfected with A*0201 cDNA and infected with vaccinia. CD8+ clones with HLA A*0201-restricted CTL activity and IFN-
release were also derived from this subject (data not shown). For unknown reasons, discussed below, screening of the vaccinia genomic library for A*0201 epitopes was negative for both clonal and bulk CTL responders. We used the ICC assay to probe bulk CTL from this subject with five previously reported (11, 12, 13) A*0201-restricted epitopes (Fig. 7, bottom). Three peptides, B22R 60-68, C7L 74-82, and D6R 498-506, gave responses above background), while A26L 6-14 and H3L 184-192 did not (data not shown).
| Discussion |
|---|
|
|
|---|
This report describes 16 novel discrete epitopes within 15 vaccinia ORFs that are recognized in the context of four HLA class I alleles (HLA A*0101, A*2301, A*2902, and B*4403). HLA A*2301 belongs to the A24 supertype, while B*4403 belongs to the B44 supertype. A*0101 and related A*0101 supertype members are also prevalent in the population (29, 30). Although reactivity with other members of these supertypes will have to be studied empirically, the epitopes described in this report greatly extent published reports, limited to 5 epitopes restricted by A*0201 (11, 12, 13), and should allow monitoring of expanded patient cohorts. As almost all of the epitopes described in this report are conserved in MVA and NYVAC (Table IV), these epitopes should also be useful in monitoring the immune response to these replication-incompetent candidate vaccine strains.
|
The virologic features of the vaccinia proteins newly identified as CD8 Ags in humans are diverse (Table IV). The known functions include enzymes, transcription factors, immune evasion proteins, and structural virion proteins. Of note, we have not detected epitopes in envelope proteins or in known targets of neutralizing Abs. Vaccinia genes are transcribed in several coordinated waves, designated early, intermediate, and late. Each kinetic class is immunogenic, with early proteins particularly well represented.
The determinants of immunodominance the polypeptide level are largely unknown (32). We showed that several vaccinia ORFs contain multiple CD8 epitopes and are thus candidate immunodominant Ags. Specifically, A3L contains at least four epitopes (each B*4403 restricted), D5R at least three epitopes, and A24R, F12L, and IL-18-binding protein at least two epitopes each. These epitopes were discovered in independent iterations of an unbiased genome-wide screen, reducing the chance that epitope grouping is an artifact. Because the responder cells used in this report were studied after one cycle of expansion in response to live vaccinia virus, it is possible that some bias was introduced during restimulation that favored detection of some epitopes over others. The potential dominance of the vaccinia Ags mentioned above is testable by examination of subjects with diverse HLA type by ELISPOT or related techniques using short peptides from these ORFs.
The vaccinia Ags that were found to stimulate CD8 responses belonged to diverse functional and kinetic classes. Notably, viral regulatory and immune evasion genes and enzymes were well-represented, while we only detected one structural or envelope proteins that was a CD8 Ag (ORF A3L). None of the major neutralizing proteins (9) on infectious intracellular mature virion or extracellular-enveloped virion were targets of CD8 T cells. Viral proteins synthesized at early times after infection were particularly well-represented. If cross-presentation is an important mode of Ag presentation for vaccinia-encoded Ags, as implied by some studies (33, 34), we would predict that abundant structural proteins would be better represented. We did not note any overlap at the ORF level with the ORFs previously reported to contain A*0201-restricted epitope, or with a set of ORFs recognized by CD8 T cells in mouse strain C57BL/6 (35). It is therefore likely that many additional antigenic ORFs remain to be uncovered, and that detailed analyses of many persons and HLA alleles will be required to assess the structural and kinetic correlates of CD8 antigenicity.
Our studies differ in several ways from other approaches to epitope discovery for complex viral pathogens. No knowledge of the viral genome sequence or predicted ORFS was used to generate our initial positive antigenic "hits". The vaccinia genome was probed in an unbiased fashion and Ags were identified by library screening. Expression cloning should therefore be useful for studying T cell reactivity for unsequenced microbial pathogens or for identifying previously unsuspected ORFs. HLA peptide-binding motifs and algorithms were only used to define peptide epitopes within small (
100 aa) antigenic fragments, and were not formally necessary, as the fragment size allows economical molecular truncation analyses and/or screening of internal peptides (19). Although peptide-binding motifs are known for some prevalent HLA alleles, HLA class I loci are extremely diverse, and reliance of these motifs for epitope discovery will exclude some HLA alleles from analysis.
The cells we probed for specificity by expression cloning are reactive with whole vaccinia, because they were studied after one cycle of in vitro expansion stimulated by live vaccinia. Our T cell clones, in addition, recognize vaccinia-infected cells in CTL assays. Both the clonal and bulk responders in our studies are documented to express CD8
. We used relatively low peptide concentrations in some assays (Figs. 5 and 8). Taken together, these factors are consistent with the detection of vaccinia-specific CTL and decrease the likelihood of detection of cross-reactive T cells. Most likely, both peptide-based and molecular methods such as expression cloning will be required to completely analyze the cellular immune response to vaccinia.
We initially validated our vaccinia library system using CTL clones (Fig. 5), as previously reported for HSV-2 (19), but adapted the method to bulk-cultured CD8 CTL to speed epitope discovery. This variant offers higher throughput, but without loss of precision. Use of bulk CTL allowed rapid identification of antigenic genomic fragments (Fig. 6) and internal epitopes using IFN-
release (Fig. 8) or ICC (Fig. 7). Overall, the "hit" rate for candidate peptides that we synthesized within antigenic genomic fragments was
70% for both cloned and bulk responder cells. This is far higher than the
1% rate obtained from bioinformatic scans of predicted ORFs and analyses of whole PBMC (11). In the ICC format, we noted bright, specific IFN-
accumulation in CD8
int cells when some peptides were used. These cells are unlikely to be NK cells, as the responding bulk cultures are >98% TCR
+ (not shown). Down-modulation of surface TCR
and associated molecules has been reported after activation through TCR (36). It is most likely that the IFN-
high cells in our ICC assays started as CD8high cells and down-modulated surface CD8
during our long (15 h) stimulation period.
Our results are likely influenced by technical limitations. Any molecular library will have gaps, for example, if epitopes are downstream from viral promoters that are inactive after transfection into uninfected cells, or if epitopes require posttranslational modification by other virus-encoded or -activated functions. As mentioned above, we were unable to score "hits" when screening HLA A*0201-restricted CTL clones, or bulk CTL lines with A*0201-restricted activity, using our genomic library. This was somewhat surprising, as bulk CTL reactivity was detected against known A*0201 epitopes (Fig. 7) in ORFS B22R, C7L, and D6R that do not have posttranslational modification, and should have been included in our library. The A*0201 expression plasmid was checked and protein expression was demonstrable in transfected Cos-7 cells (data not shown). Assessment by PCR with primers spanning these epitopes should allow assessment of whether these epitopes are represented in our library and this type of analysis could be useful for quality control of next-generation libraries. Our analysis of the diversity of vaccinia-specific responses are not exhaustive, as a gradation of IFN-
responses was detected when bulk CTL were detected against library pools, and not all positive pools have been decoded to single active plasmids (Fig. 6). We cannot yet determine whether we have detected the quantitatively most abundant responses within individuals, but the epitopes disclosed in this report should be useful for designing tetramer and peptide ELISPOT or ICC assays to examine this issue.
In summary, the human CD8 T cell response to vaccinia is robust at early times after vaccination. Expression cloning, including a new high-throughput variant, has disclosed that the response can be very diverse within an individual. Several candidate immunodominant Ags, containing multiple epitopes, have been described. These Ags and epitopes should be useful in evaluating candidate smallpox vaccines and modified poxviruses (37) being developed as vectors for heterologous Ags.
| Acknowledgments |
|---|
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was presented in part at the 5th Orthopoxvirus Workshop, Bethesda, MD, April 18 and 19, 2005 by L.J., T.M.C., and D.M.K. ![]()
2 This work was supported by National Institutes of Health Grant AI061636. ![]()
3 Address correspondence and reprint requests to Dr. David M. Koelle at the current address: Harborview Medical Center, Mail Stop 359690, 325 Ninth Avenue, Seattle, WA 98104. E-mail address: viralimm{at}u.washington.edu ![]()
4 Abbreviations used in this paper: NYVAC, New York vaccinia; MVA, modified vaccinia Ankara; ORF, open reading frame; TCM, T cell medium; MOI, multiplicity of infection; LCL, lymphocyte continuous line; ICC, intracellular cytokine cytometry; eGFP, enhanced GFP; SOR, shortest overlapping region; int, intermediate. ![]()
Received for publication August 17, 2005. Accepted for publication September 23, 2005.
| References |
|---|
|
|
|---|
2-Microglobulin-, CD8+ T-cell-deficient mice survive inoculation with high doses of vaccinia virus and exhibit altered IgG responses. Proc. Natl. Acad. Sci. USA 89: 6070-6074.
receptor improves CD8+ T-cell memory responses elicited upon immunization with modified vaccinia virus Ankara. J. Gen. Virol. 86: 1997-2006.
interferon production and natural killer and T-cell activity. J. Virol. 77: 9960-9968. This article has been cited by other articles:
![]() |
V. S. Meyer, W. Kastenmuller, G. Gasteiger, M. Franz-Wachtel, T. Lamkemeyer, H.-G. Rammensee, S. Stevanovic, D. Sigurdardottir, and I. Drexler Long-Term Immunity against Actual Poxviral HLA Ligands as Identified by Differential Stable Isotope Labeling J. Immunol., November 1, 2008; 181(9): 6371 - 6383. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Jing, D. H. Davies, T. M. Chong, S. Chun, C. L. McClurkan, J. Huang, B. T. Story, D. M. Molina, S. Hirst, P. L. Felgner, et al. An Extremely Diverse CD4 Response to Vaccinia Virus in Humans Is Revealed by Proteome-Wide T-Cell Profiling J. Virol., July 15, 2008; 82(14): 7120 - 7134. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Oseroff, B. Peters, V. Pasquetto, M. Moutaftsi, J. Sidney, V. Panchanathan, D. C. Tscharke, B. Maillere, H. Grey, and A. Sette Dissociation between Epitope Hierarchy and Immunoprevalence in CD8 Responses to Vaccinia Virus Western Reserve J. Immunol., June 1, 2008; 180(11): 7193 - 7202. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. G. Kenter, M. J.P. Welters, A.R. P.M. Valentijn, M. J.G. Lowik, D. M.A. Berends-van der Meer, A. P.G. Vloon, J. W. Drijfhout, A. R. Wafelman, J. Oostendorp, G. J. Fleuren, et al. Phase I Immunotherapeutic Trial with Long Peptides Spanning the E6 and E7 Sequences of High-Risk Human Papillomavirus 16 in End-Stage Cervical Cancer Patients Shows Low Toxicity and Robust Immunogenicity Clin. Cancer Res., January 1, 2008; 14(1): 169 - 177. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Mitra-Kaushik, J. Cruz, L. J. Stern, F. A. Ennis, and M. Terajima Human Cytotoxic CD4+ T Cells Recognize HLA-DR1-Restricted Epitopes on Vaccinia Virus Proteins A24R and D1R Conserved among Poxviruses J. Immunol., July 15, 2007; 179(2): 1303 - 1312. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Assarsson, J. Sidney, C. Oseroff, V. Pasquetto, H.-H. Bui, N. Frahm, C. Brander, B. Peters, H. Grey, and A. Sette A Quantitative Analysis of the Variables Affecting the Repertoire of T Cell Specificities Recognized after Vaccinia Virus Infection J. Immunol., June 15, 2007; 178(12): 7890 - 7901. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Moutaftsi, H.-H. Bui, B. Peters, J. Sidney, S. Salek-Ardakani, C. Oseroff, V. Pasquetto, S. Crotty, M. Croft, E. J. Lefkowitz, et al. Vaccinia Virus-Specific CD4+ T Cell Responses Target a Set of Antigens Largely Distinct from Those Targeted by CD8+ T Cell Responses J. Immunol., June 1, 2007; 178(11): 6814 - 6820. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Jing, T. M. Chong, B. Byrd, C. L. McClurkan, J. Huang, B. T. Story, K. M. Dunkley, L. Aldaz-Carroll, R. J. Eisenberg, G. H. Cohen, et al. Dominance and Diversity in the Primary Human CD4 T Cell Response to Replication-Competent Vaccinia Virus J. Immunol., May 15, 2007; 178(10): 6374 - 6386. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |