The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Roy, V.
Right arrow Articles by Wither, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Roy, V.
Right arrow Articles by Wither, J.
Right arrowPubmed/NCBI databases
*Substance via MeSH
Medline Plus Health Information
*Lupus
The Journal of Immunology, 2005, 175: 7363-7371.
Copyright © 2005 by The American Association of Immunologists

Aberrant IgM Signaling Promotes Survival of Transitional T1 B Cells and Prevents Tolerance Induction in Lupus-Prone New Zealand Black Mice1

Valerie Roy*,{dagger}, Nan-Hua Chang*, Yongchun Cai*, Gabriel Bonventi* and Joan Wither2,*,{dagger},{ddagger}

* Arthritis Center of Excellence, Toronto Western Research Institute, Toronto, Canada; {dagger} Department of Immunology, University of Toronto, Toronto, Canada; and {ddagger} Department of Medicine, University Health Network, Toronto, Canada


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
New Zealand Black (NZB) mice develop a lupus-like syndrome. Although the precise immune defects leading to autoantibody production in these mice have not been characterized, they possess a number of immunologic abnormalities suggesting that B cell tolerance may be defective. In the bone marrow, immature self-reactive B cells that have failed to edit their receptors undergo apoptosis as a consequence of Ig receptor engagement. Splenic transitional T1 B cells are recent bone marrow emigrants that retain these signaling properties, ensuring that B cells recognizing self-Ags expressed only in the periphery are deleted from the naive B cell repertoire. In this study we report that this mechanism of tolerance is defective in NZB mice. We show that NZB T1 B cells are resistant to apoptosis after IgM cross-linking in vitro. Although extensive IgM cross-linking usually leads to deletion of T1 B cells, in NZB T1 B cells we found that it prevents mitochondrial membrane damage, inhibits activation of caspase-3, and promotes cell survival. Increased survival of NZB T1 B cells was associated with aberrant up-regulation of Bcl-2 after Ig receptor engagement. We also show that there is a markedly increased proportion of NZB T1 B cells that express elevated levels of Bcl-2 in vivo and provide evidence that up-regulation of Bcl-2 follows encounter with self-Ag in vivo. Thus, we propose that aberrant cell signaling in NZB T1 B cells leads to the survival of autoreactive B cells, which predisposes NZB mice to the development of autoimmunity.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Systemic lupus erythematosus (SLE)3 is a generalized systemic autoimmune disease characterized by the production of pathogenic anti-nuclear autoantibodies. The New Zealand Black (NZB) mouse and its F1 cross with the New Zealand White (NZW) mouse (NZB/W) both spontaneously develop a lupus-like autoimmune disease and are considered to be excellent models of human SLE. In NZB mice, disease is characterized by IgG anti-RBC, anti-lymphocyte, and anti-ssDNA autoantibodies, leading to hemolytic anemia and mild glomerulonephritis that develops late in life (1). Although NZB mice do not develop rapidly progressive glomerulonephritis, they appear to possess most of the immunologic defects required, because backcrossing of the H-2bm12 MHC locus onto the NZB background is sufficient to produce mice that develop both high titer anti-dsDNA Abs and early-onset nephritis (2).

The capacity of NZB mice to produce diverse autoantibodies suggests that these mice possess a generalized defect in self-tolerance. Although both B and T cell defects could contribute to the loss of tolerance in these mice, studies of T cell tolerance have been negative, with normal clonal deletion and clonal anergy induction being demonstrated (3, 4, 5, 6). In contrast, NZB mice have a number of immunological abnormalities suggesting that B cell tolerance mechanisms may be defective. These include polyclonal B cell activation in vivo (7, 8, 9), IgM hypergammaglobulinemia (10, 11), and altered B cell function in vitro (12, 13).

Negative regulation of self-reactive B cells can occur at multiple checkpoints in the bone marrow or periphery (14, 15). One of the earliest checkpoints in B cell tolerance induction is clonal deletion. During B cell development in the bone marrow, immature B cells that acquire self-reactive receptors attempt to edit their receptors and, if unsuccessful, are deleted. Deletion of immature B cells at this phase of development requires Ig receptor engagement and results from signaling properties that render these cells highly sensitive to apoptosis (16, 17, 18, 19, 20, 21). In the periphery, the T1 transitional B cell population retains these properties, ensuring that B cells recognizing self-Ags expressed only in the periphery are deleted from the naive B cell repertoire. In this study we have examined whether this tolerance process is defective in NZB mice by investigating the functional properties of the T1 population. Our study was prompted by the work of Kozono et al. (22), which demonstrated that resting B cells in NZB mice are less susceptible to apoptosis after IgM cross-linking than those from a number of nonautoimmune mouse strains. Although this study raised the possibility that clonal deletion may be defective in NZB mice, the B cell subset(s) involved and the molecular basis for the defect were not determined.

In this study we show that apoptosis after IgM cross-linking is reduced in the T1 B cell population in NZB mice. Indeed, in contrast to normal T1 cells, extensive IgM cross-linking prevents mitochondrial damage and subsequent caspase-3 activation, leading to increased survival of NZB T1 cells. Rescue from IgM-mediated apoptosis correlates with abnormal expression of the survival factor Bcl-2, which is abnormally up-regulated in NZB T1 cells following IgM cross-linking in vitro. We also show that a large proportion of freshly isolated transitional T1 B cells express Bcl-2 in NZB mice and that this has resulted from engagement with self-Ags in vivo. Thus, T1 cells from NZB mice demonstrate functional and phenotypic properties suggesting that tolerance induction within the immature peripheral B cell repertoire is defective.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Animals

BALB/c and B6 mice were purchased from The Jackson Laboratory or bred in our facility. NZB mice were obtained from Harlan Sprague Dawley. B6 mice expressing a transgene encoding IgM/IgD H and L chains specific for hen egg white lysozyme (HEL; anti-HEL Ig transgenic (Tg); MD4) or soluble HEL (sHEL; ML5) were purchased from The Jackson Laboratory and backcrossed onto the NZB genetic background using the speed congenic technique. Fully backcrossed mice were obtained in seven generations for the anti-HEL Ig transgene and in six generations for the sHEL transgene. All mice used for the experiments were 4–12 wk of age and were housed in microisolators in a specific pathogen-free facility at Toronto Western Hospital (Toronto, Canada).

Cell surface flow cytometric staining and analysis

A total of 5 x 105 cells were incubated with 10 µg/ml mouse IgG (Sigma-Aldrich) for 15 min to block FcRs and then were stained with various combinations of directly conjugated mAbs. After washing, allophycocyanin-conjugated streptavidin (SA-allophycocyanin; BD Pharmingen) was used to reveal biotin-conjugated mAb staining. Dead cells were excluded by staining with 0.6 µg/ml propidium iodide (PI; Sigma-Aldrich). Flow cytometry of the stained cells was performed using a dual laser FACSCalibur (BD Biosciences) and was analyzed using CellQuest software (BD Biosciences). The following directly conjugated mAbs were purchased from BD Pharmingen: biotin anti-heat-stable Ag (anti-HSA; M1/69), allophycocyanin-anti-B220 (RA3-6B2), PE-anti-HSA (M1/69), PE-anti-CD21 (7G6), PE-anti-CD23 (B3B4), FITC anti-CD21 (7G6), and FITC anti-IgD (11-26c.2a). FITC-labeled F(ab')2 anti-IgM (115-096-020) was purchased from Jackson ImmunoResearch Laboratories. FITC-anti-CD8a (CT-CD8a), PE-anti-B220 (RA3-6B2) and biotinylated anti-B220 (RA3-6B2) were purchased from Cedarlane Laboratories. PE-anti-CD4 (CT-CD4) was purchased from Caltag Laboratories.

Mature follicular B cell isolation

B cell populations enriched for mature follicular B cells were isolated over a Percoll gradient from T cell-depleted splenocytes as previously described (13). Briefly, freshly isolated, RBC-depleted splenocytes from 8- to 12-wk-old mice (four to eight mice per strain per experiment) were incubated with a 1/10 dilution of hybridoma supernatants containing anti-Thy1.2 (HO13.2) and anti-CD4 (RL172) mAbs for 15 min on ice. The cells were then incubated with low-tox guinea pig complement (Cedarlane Laboratories) at 37°C for 45 min, washed, and loaded in the {rho} = 1.092 layer on a Percoll gradient. After centrifugation, resting B cells were collected at the {rho} = 1.085–1.079 interface. The purity of mature follicular B cells was >80% in these B cell preparations. CD4 and CD8 T cell contamination in the resultant populations, determined by flow cytometry, was <1%.

Hypodiploid DNA analysis after IgM hypercross-linking in mature follicular B cells

Resting B cells isolated from 8- to 12-wk-old mice were incubated at 1 x 106 cells/ml with 10 µg/ml biotinylated anti-IgM (BET-2; gift from Dr. N. Hozumi, Tokyo University of Science, Noda, Japan) alone or in combination with 20 µg/ml avidin (Sigma-Aldrich; added 30 min later) for 16 h at 37°C. After incubation, cells were washed in 1 ml of PBS, resuspended in 0.2 ml of hypotonic solution (0.1% sodium citrate, 0.1% Triton X-100, and 50 µg/ml PI), and incubated at 4°C for 16 h (23). Samples were analyzed by flow cytometry, and the percentage of cells undergoing apoptosis was calculated by gating on the sub-G0 peak.

Transitional B cell isolation and IgM cross-linking

Resting B cell preparations enriched for transitional B cells were isolated from 4- to 6-wk-old mice (four to eight mice per strain per experiment) by Percoll density centrifugation as outlined above, except that cells were collected from the {rho} = 1.085–1.079 and {rho} = 1.079–1.075 interfaces. B cells (2.5 x 106 cells/ml) were stimulated with different concentrations of AffiniPure F(ab')2 goat anti-mouse IgM (Jackson ImmunoResearch Laboratories) for 5, 12, or 16 h to induce apoptosis. For semiquantitative RT-PCR experiments on freshly isolated T1 B cells, resting B cells were sorted by FACS into T1 B cells (CD21lowHSAhigh) and mature follicular B cells (CD21intHSAlow) after staining with FITC-anti-CD21 and PE-anti-HSA (M1/69; BD Pharmingen) mAbs on a Mo-Flo instrument (DakoCytomation). Sorted B cell populations were >98% pure.

Intracellular staining for Bcl-2 and active caspase-3

Resting B cell populations enriched for transitional B cells were stained with biotinylated anti-B220 and FITC-anti-CD21 mAbs. After washing, SA-allophycocyanin was added to reveal biotin-conjugated Ab staining. The cells were then fixed, permeabilized in Cytofix/Cytoperm (BD Pharmingen) for 20 min on ice, and incubated with a 1/10 dilution of PE-conjugated, affinity-purified. polyclonal rabbit Ab specific for the cleaved active form of caspase-3 (BD Pharmingen) or PE-conjugated anti-Bcl-2 Ab (3F11; BD Pharmingen) at room temperature for 40 min. The percentage of B cells undergoing apoptosis was measured by gating on forward scatterlow (FSClow) active caspase-3+ B cells. Cells kept at 4°C were used as a negative staining control. The percentage of cells expressing Bcl-2 was measured by gating on FSChighBcl-2+ B cells and Bcl-2 expression above background staining was determined using an Armenian hamster IgG (A19-3; BD Pharmingen) isotype control mAb.

Measurement of mitochondrial transmembrane potential ({Delta}{psi})

B cell populations enriched for transitional B cells were stained with PE-anti-CD21 and biotinylated anti-B220 mAbs after incubation with various concentrations of F(ab')2 goat anti-mouse IgM. After washing, SA-allophycocyanin was added to reveal biotin-conjugated Ab staining. For assessment of apoptosis in mature follicular B cells, resting B cell preparations from 6- to 10-wk-old mice (four or five mice per strain per experiment) were incubated with various concentrations of biotin-conjugated goat anti-mouse IgM (Southern Biotechnology Associates) and 20 µg/ml avidin. Cells were stained with PE-anti-HSA and allophycocyanin-anti-B220 mAbs to permit gating of B220highHSAlow follicular B cells. To determine the {Delta}{psi}, B cells were incubated with 40 nM 3,3'-dihexyloxycarbocyanine iodide (DIOC6) in serum-free RPMI for 15 min at 37°C. The cells were then washed twice in ice-cold PBS and analyzed on a FACSCalibur flow cytometer.

Semiquantitative RT-PCR measurement of Rag-2 expression

mRNA expression was examined on FACS-sorted follicular and T1 B cells. Total RNA was isolated using an RNeasy kit (Qiagen) and a first cDNA strand generated from 1 µg of total RNA using SuperScript II reverse transcriptase (Invitrogen Life Technologies). The primer sequences used for amplification were: GAPDH (g3pdh): sense, ACCACAGTCCATGCCATCAC; antisense, TCCACCACCCTGTTGCTGTA (purchased from BD Biosciences); and rag-2: sense, CACATCCACAAGCAGGAAGTACAG; antisense, GGTTCAGGGACATCTCCTACTAAG. For each pair of primers, serial 2-fold dilutions were used to determine the number of cycles required to obtain amplification within a linear range. Optimal amplification occurred at 28 cycles for g3pdh and 32 cycles for rag-2. The PCR conditions used were 94°C for 2 min; the appropriate number of amplification cycles at 94°C for 20 s, 66°C for 20 s, and 72°C for 25 s; and a final incubation at 72°C for 5 min. PCR products were separated by electrophoresis on a 1.5% agarose gel and visualized using ethidium bromide. The amount of PCR product was quantified by a Fluor-s Max densitometer and analyzed using Quantity One software (Bio-Rad). After background subtraction, rag-2 gene expression was normalized to g3pdh expression to control for total cell number.

Data analysis and statistics

The percent specific apoptosis was calculated as previously described (22). The percent specific apoptosis = [(% induced apoptosis – % spontaneous apoptosis)/(100 – % spontaneous apoptosis)] x 100. For each experiment, different culture conditions were performed in triplicate, and the mean value of each triplicate was calculated. Data from multiple independent experiments were analyzed using a two-tailed unpaired Student’s t test to determine whether statistically significant differences could be found between mouse strains. A value of p < 0.05 was considered significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Mature follicular B cells from NZB mice undergo apoptosis normally after IgM receptor hypercross-linking

Previous experiments examining apoptosis after IgM cross-linking in NZB mice used resting B cells isolated from 5- to 7-wk-old mice. At this age, resting B cell preparations contain predominantly a mixture of follicular and transitional T1 B cells (13, 24). We therefore sought to determine whether the apoptotic defect in NZB mice affected both these populations or was restricted to the transitional B cell compartment. We began by isolating resting B cells from 10-wk-old mice, an age at which the majority (>80%) of resting splenic B cells have a mature follicular HSAlowCD21int B cell phenotype (see Fig. 1A). As shown in Fig. 1B, CD21highCD23low marginal zone and CD21highCD23+ transitional T2 B cells were removed from the resting B cell populations after centrifugation on the Percoll gradient, as were B1a (CD21low-intCD23HSAhighIgMhighCD5+) B cells (13) (data not shown). Because efficient apoptosis of mature B cells requires IgM hypercross-linking (25), the cells were first incubated with 10 µg/ml biotinylated anti-IgM mAb and then hypercross-linked by addition of avidin. After a 16-h incubation, the cells were stained with a PI-containing hypotonic solution, and the percentage of apoptotic cells was determined by quantitating the proportion of hypodiploid cells using flow cytometry. BALB/c mice were chosen as a representative nonautoimmune control, because previous work by Kozono et al. (22) indicated that BALB/c resting B cells were significantly more susceptible to IgM-mediated apoptosis than NZB B cells. As shown in Table I, apoptosis after IgM hypercross-linking was equivalent in NZB and BALB/c resting B cell preparations containing predominantly mature follicular B cells.



View larger version (33K):
[in this window]
[in a new window]
 
FIGURE 1. B cell subsets in resting B cell preparations. A, Resting B cells isolated from 10-wk-old BALB/c and NZB mice are predominantly mature follicular cells. Freshly isolated splenocytes (Pre) and resting B cells (Post) were stained with anti-B220, anti-CD21, and anti-HSA mAbs. Dot plots are gated on PI-excluding B220+ cells. The proportions of gated cells are shown adjacent to each box. B, Removal of marginal zone and transitional T2 B cells after centrifugation on a Percoll gradient. Cells purified as described in A were stained with anti-B220, anti-CD21, and anti-CD23 mAbs. Dot plots are gated on PI-excluding B220+ cells. The proportions of gated cells are shown adjacent to each box. Diagrams on the right of dot plots indicate the B cell subset gated in each box. MZ, marginal zone; F, follicular; T1, T1 transitional; T2, T2 transitional. Results are representative of four independent experiments. C, Cells from 4- to 6-wk-old BALB/c, B6, and NZB mice were isolated, stained, and gated as described in A. The proportions of gated cells are shown adjacent to each box. Results are representative of five independent experiments.

 

View this table:
[in this window]
[in a new window]
 
Table I. Apoptosis induced by cross-linking and hypercross-linking sIgM on mature peripheral B cellsa

 
IgM cross-linking of mature B cells typically leads to abortive activation or proliferation, rather than apoptosis (26, 27, 28), and as expected, minimal apoptosis was induced in mature follicular B cells after incubation with biotinylated anti-IgM mAb alone (see Table I). Similar results were obtained using a goat anti-mouse IgM Ab for concentrations ranging from 0.5–10 µg/ml (data not shown). Thus, the results showed that the differences in apoptosis between BALB/c and NZB mice did not arise from the follicular B cell subset.

Reduced apoptosis of NZB T1 B cells after IgM cross-linking

Because NZB and BALB/c follicular B cells were similarly sensitive to IgM-mediated apoptosis, we next sought to determine whether transitional T1 B cells had an apoptosis defect in NZB mice. We therefore isolated resting B cells from 4- to 6-wk-old mice to enrich for transitional T1 B cells (see Fig. 1C). T1 B cells are recent bone marrow emigrants and, as a result, retain an immature B220lowCD21CD23HSAhighIgD phenotype. The percentage of CD21HSAhigh B cells in the spleens of 4- to 6-wk-old NZB mice was similar to that in controls (% CD21HSAhigh B cells ± SD: BALB/c, 19.1 ± 5.6; B6, 18.4 ± 5.1; NZB, 15.7 ± 6.1; mean of five independent experiments; all p > 0.05), as was the percentage of these cells in resting B cell preparations (% CD21HSAhigh B cells ± SD: BALB/c, 20.2 ± 4.8; B6, 19.8 ± 4.0; NZB, 15.9 ± 5.3; mean of five independent experiments; all p > 0.05). These cells were also CD23 and IgD (data not shown). As expected, resting B cell preparations from young mice had a 2- to 3-fold increase in T1 B cells compared with preparations from older mice (see Fig. 1, A and C for comparison).

Apoptosis after IgM cross-linking was quantitated by flow cytometry using an Ab specific for the cleaved active form of caspase-3. Maximal caspase-3 activation occurs 12–14 h after IgM cross-linking in transitional B cells, which are then irreversibly committed to undergo apoptosis (19, 20). Resting B cells were incubated for 12 h with an F(ab')2 anti-IgM Ab (to avoid simultaneous signaling through FcRs), washed, and stained with anti-B220 and anti-CD21 mAbs. The cells were then fixed, permeabilized, and incubated with anti-active caspase-3 Ab. As shown in Fig. 2A, apoptotic FSClowactive caspase-3+B220+ cells could be easily identified using this technique, and the percentage of these cells increased dramatically after IgM cross-linking. We found a decreased percentage of NZB B220+ cells undergoing IgM-mediated apoptosis compared with B6 and, to a lesser extent, BALB/c, B cells. Similar results were obtained with hypodiploid DNA analysis or TUNEL assay of resting transitional B cells incubated for 16 h with an F(ab')2 anti-IgM Ab (Fig. 2B and data not shown). As shown in Fig. 2C, B220 and CD21 expression was used to gate on B220lowCD21 B cells independently from other B cell populations present within the resting B cell preparations. This population is comprised almost entirely of HSAhigh T1 cells in all three mouse strains (Fig. 1C). The results showed that apoptosis of NZB T1 B cells after IgM cross-linking was significantly impaired compared with that in controls (Fig. 2D). Consistent with our results presented in Table I, IgM cross-linking induced minimal apoptosis within the remaining B cell subsets contained in the B220+CD21+ gate and was not different in BALB/c and NZB mice (Fig. 2E).



View larger version (32K):
[in this window]
[in a new window]
 
FIGURE 2. NZB T1 cells have an apoptosis defect after IgM cross-linking. A, Caspase-3 activation in resting B cells after IgM cross-linking. B6 resting B cells were incubated on ice or at 37°C with 0 or 1 µg/ml AffiniPure F(ab')2 anti-IgM for 12 h and stained with anti-B220 and anti-CD21 mAbs. B cells were then fixed, permeabilized, and stained intracellularly with anti-active caspase-3 Ab as described in Materials and Methods. Dot plots are gated on B220+ cells. The region used to gate apoptotic FSClowactive caspase-3+ B cells is shown with the percentage of cells in the region indicated below each plot. B, Graph showing decreased apoptosis in NZB B cells after IgM cross-linking. Resting B cells from 4- to 6-wk-old mice were incubated with different concentrations of AffiniPure F(ab')2 anti-IgM for 12 h, and the percent specific apoptosis was calculated as described in Materials and Methods by gating on B220+ FSClowactive caspase-3+ cells. Percent spontaneous B cell apoptosis ± SD: BALB/c, 47.1 ± 2.4; B6, 51.9 ± 6.5, NZB, 49.2 ± 6.6 (all p > 0.05). C, Regions used for gating of T1 and follicular B cells. B6 resting B cells isolated from 4- to 6-wk-old mice were stained with anti-B220, anti-CD21, and anti-HSA mAbs. Top panel, Transitional T1 or follicular B cells were gated separately using B220 and CD21 expression. Bottom panel, Dot plots showing differential expression of CD21 and HSA on transitional T1 or follicular B cells. D and E, Graphs showing percent specific apoptosis after IgM cross-linking in transitional T1 or follicular B cells. Cell populations were gated as described in C. The percent specific apoptosis was calculated by gating on FSClowactive caspase-3+ T1 or B220+CD21+ cells as described in Materials and Methods. Percent spontaneous T1 cell apoptosis ± SD: BALB/c, 77.7 ± 6.3; B6, 76.7 ± 6.8; NZB, 71.3 ± 9.1 (all p > 0.05). Percent spontaneous B220+CD21+ cell apoptosis ± SD: BALB/c, 11.0 ± 5.8; B6, 14.8 ± 6.0; NZB, 14.6 ± 6.0 (all p > 0.05). Results from B, D, and E were pooled from five independent experiments. F, Bar graph showing decreased caspase-3 activation after IgM cross-linking in NZB T1 cells. The percent specific apoptosis of T1 cells was calculated by gating on FSClowactive caspase-3+ T1 cells. Percent spontaneous apoptosis ± SD: BALB/c, 67.6 ± 11.3; B6, 68.8 ± 13.7; NZB, 64.9 ± 11.9 (all p > 0.05). Results are pooled from three independent experiments. *, Conditions where NZB values were statistically different from BALB/c or B6 mice with p < 0.05. Error bars denote the SE.

 
To study the kinetics of caspase-3 activation in NZB T1 B cells, resting B cells were incubated for 5 h with different concentrations of an F(ab')2 anti-IgM Ab. Caspase-3 activation was measured in T1 B cells by flow cytometry as described above. Although caspase-3 activation was already detectable 5 h after IgM cross-linking in BALB/c and B6 T1 cells, NZB T1 cells showed reduced caspase-3 activation below background in a dose-dependent fashion (Fig. 2F). Thus, strong IgM signaling was able to prevent caspase-3 activation and rescue NZB T1 cells from apoptosis for up to 12 h after IgM cross-linking.

Reduced mitochondrial damage and increased survival of NZB T1 B cells after IgM cross-linking

Loss of mitochondrial transmembrane potential precedes the activation of downstream effector caspases and IgM-mediated apoptosis in transitional B cells (29). We therefore examined whether mitochondrial damage was reduced in NZB T1 B cells after IgM cross-linking. To this end, resting B cell populations enriched for T1 cells were incubated for 5 h with serial dilutions of F(ab')2 anti-IgM Ab to induce apoptosis. The cells were then stained with anti-CD21 and anti-B220 mAbs and loaded with DIOC6 to measure mitochondrial transmembrane potential. As shown in Fig. 3, A and B, IgM-induced mitochondrial damage was seen in BALB/c and B6 T1 cells. In contrast, IgM cross-linking of NZB T1 cells inhibited the background mitochondrial damage associated with in vitro culture of the cells. Consistent with the results shown in Table I, the percentage of NZB mature B cells demonstrating mitochondrial damage after IgM hypercross-linking was similar to that in controls (Fig. 3C).



View larger version (28K):
[in this window]
[in a new window]
 
FIGURE 3. Strong IgM signals prevent mitochondrial damage and lead to increased survival in NZB T1 cells. A, Loss of {Delta}{psi} in T1 cells after IgM cross-linking. Resting B cells isolated from 4- to 6-wk-old mice were incubated on ice or with 0 or 10 µg/ml AffiniPure F(ab')2 anti-IgM for 5 h. B cells were stained with anti-B220 and anti-CD21 mAbs and then loaded with DIOC6 to measure {Delta}{psi} using flow cytometry. T1 cells were gated as described in Fig. 2. The percentage of DIOC6 T1 cells is shown on each histogram. B, Bar graph showing decreased mitochondrial damage in NZB T1 B cells after IgM cross-linking. Resting B cells from 4- to 6-wk-old mice were incubated with different concentrations of AffiniPure F(ab')2 anti-IgM for 5 h. The percent specific apoptosis was calculated as described in Materials and Methods using the percentage of DIOC6 T1 cells. Results are pooled from four independent experiments. Percent spontaneous T1 apoptosis ± SD: BALB/c, 43.9 ± 21.8; B6, 51.2 ± 20.7; NZB, 47.6 ± 22.8 (all p >0.05). C, Bar graph showing normal mitochondrial damage in mature follicular NZB B cells after IgM hypercross-linking. Resting B cells from 6- to 10-wk-old mice were incubated for 16 h with 10 or 30 µg/ml biotinylated anti-IgM Ab in combination with avidin. Cells were stained with anti-B220 and anti-HSA to permit gating of B220highHSAlow follicular B cells. The percent specific apoptosis was calculated as described in Materials and Methods using the percentage of DIOC6 follicular cells. Results are pooled from three independent experiments. Percent spontaneous apoptosis ± SD: BALB/c, 73.3 ± 7.8; B6, 76.7 ± 11.7; NZB, 71.2 ± 5.0 (all p > 0.05). D, Bar graph showing increased survival of NZB T1 cells after IgM cross-linking. Cells were stimulated as outlined above, and the percentage of live FSChigh T1 cells was determined by flow cytometry. Survival above background is shown. Percent background live T1 cells ± SD: BALB/c, 32.4 ± 11.3; B6, 31.2 ± 13.7; NZB, 35.2 ± 11.9 (all p > 0.05). Results are pooled from three independent experiments. *, Conditions where NZB values were statistically different from BALB/c or B6 mice with p < 0.05. Error bars denote the SE.

 
The observation that strong IgM cross-linking inhibits mitochondrial damage and caspase-3 activation suggests that in contrast to normal T1 cells, IgM signaling can induce cell survival in NZB T1 cells. To assess this possibility, T1 cells were purified and activated as described above, and the percentage of live FSChigh T1 B cells was determined using flow cytometry. Although the percentage of live T1 B cells was similar in all mouse strains in the absence of IgM signaling, the percentage of live T1 B cells increased in NZB mice after IgM cross-linking (Fig. 3D). As expected, the percentages of live BALB/c and B6 T1 B cells were decreased after IgM cross-linking. Thus, we found that in contrast to normal T1 B cells, NZB T1 B cells were able to survive if provided a strong enough signal through the IgM receptor.

Abnormal Bcl-2 expression in NZB T1 B cells

We next sought to determine the intracellular signaling events leading to enhanced survival of NZB T1 B cells. Genetic manipulations leading to increased expression of Bcl-2 in immature B cells impair negative selection and receptor-induced apoptosis (30). We therefore investigated whether Bcl-2 was abnormally expressed in NZB T1 cells. First, Bcl-2 expression was measured in freshly isolated, resting T1 cells. We found that the proportion of freshly isolated NZB T1 B cells expressing Bcl-2 was increased ~2- to 3-fold over that in control T1 cells (Fig. 4A; % Bcl-2+T1 B cells ± SD: BALB/c, 19.2 ± 8.2; B6, 17.7 ± 8.9; NZB, 44.9 ± 11.1; mean of three independent experiments; p < 0.05 for NZB compared with both control strains). Thus, we concluded that signaling events leading to increased expression of Bcl-2 in unstimulated NZB T1 cells occurred in vivo and are not an artifact of the culture conditions. In contrast to T1 cells, mature B cells from all three mouse strains expressed similar high levels of Bcl-2 (data not shown).



View larger version (36K):
[in this window]
[in a new window]
 
FIGURE 4. Abnormal Bcl-2 expression in NZB T1 cells. A, IgM cross-linking induces Bcl-2 expression in NZB T1 cells in vitro. Freshly isolated resting B cells from 4- to 6-wk-old mice or incubated with 0 or 10 µg/ml AffiniPure F(ab')2 anti-IgM for 5 h were stained with anti-B220 and anti-CD21 mAbs to gate on B220lowCD21 T1 cells. Cells were then fixed, permeabilized, and stained with anti-Bcl-2 or isotype control mAbs. The percentage of Bcl-2+FSChigh live T1 cells is shown on each dot plot and was determined using an isotype control. Results are representative of three individual experiments. B, Bar graph showing increased Bcl-2 up-regulation in NZB T1 cells after IgM cross-linking. Resting B cells from 4- to 6-wk-old mice were incubated with different concentrations of AffiniPure F(ab')2 anti-IgM for 5–6 h. The percentage of Bcl-2+ live T1 cells was measured using flow cytometry as described above. The percentage above background is shown. Results were pooled from three independent experiments. *, Conditions where NZB values were statistically different from BALB/c or B6 mice with p < 0.05. Error bars denote the SE.

 
Next, to determine whether abnormal Bcl-2 expression could be maintained and/or induced in NZB T1 cells after IgM cross-linking in vitro, resting B cell populations enriched for transitional B cells were incubated with serial dilutions of F(ab')2 anti-IgM for 5 h in vitro. The percentage of Bcl-2+ T1 B cells was measured on a flow cytometer as described in Materials and Methods. As shown in Fig. 4A, in the absence of IgM cross-linking, the percentage of Bcl-2+ T1 B cells dropped, but remained increased in NZB mice compared with controls (% Bcl-2+ T1 B cells ± SD: BALB/c, 12.7 ± 1.8; B6, 10.2 ± 2.5; NZB, 23.2 ± 3.7; mean of three independent experiments; p < 0.05 for NZB compared with both control strains). With IgM cross-linking, minimal induction of Bcl-2 expression was seen in BALB/c and B6 T1 cells even at 10 µg/ml (Fig. 4, A and B). In contrast, NZB T1 cells up-regulated Bcl-2 at lower Ab concentrations and to a greater extent than control T1 cells. Notably, at 10 µg/ml, the up-regulation of Bcl-2 in NZB T1 cells was similar to Bcl-2 expression in freshly isolated resting NZB T1 cells. Thus, the results showed that abnormal Bcl-2 expression in NZB T1 B cells can be reinduced after IgM cross-linking in vitro.

Bcl-2 is induced in NZB T1 B cells by BCR engagement in vivo

The results outlined above suggested that the increased proportion of Bcl-2+ T1 B cells in NZB mice resulted from an altered response to Ig receptor engagement in vivo. To examine this question, an Ig transgene recognizing a foreign protein, HEL (anti-HEL Ig Tg), was backcrossed onto the NZB background. Expression of this transgene blocks endogenous Ig gene rearrangement, and therefore almost all peripheral B cells (>95%) in these mice express the IgMa Tg H chain and bind HEL (data not shown). Resting B cells were isolated from 4-wk-old mice, and Bcl-2 expression in the T1 B cell subset was compared between NZB anti-HEL Ig Tg and littermate controls. As shown in Fig. 5A, the proportion of T1 cells expressing Bcl-2 was markedly reduced in anti-HEL Ig Tg mice, suggesting that Ig receptor engagement is necessary to induce Bcl-2 expression in NZB T1 B cells in vivo. To confirm this finding, T1 cells were isolated from NZB mice expressing both Ig and sHEL transgenes. In these mice a high concentration of sHEL is present in the bone marrow, and thus, almost all immature B cells encounter self-Ag before they exit to the periphery (31). As shown in Fig. 5A, the majority (>85%) of T1 B cells isolated from NZB Ig/sHEL Tg mice were Bcl-2+ supporting the role of Ig receptor engagement in the up-regulation of Bcl-2 in NZB mice.



View larger version (28K):
[in this window]
[in a new window]
 
FIGURE 5. Aberrant IgM signaling leads to abnormal up-regulation of Bcl-2 in vivo in NZB T1 B cells. A, IgM signaling leads to abnormal Bcl-2 expression in NZB T1 cells in vivo. Resting B cells were isolated from 4-wk-old NZB non-Tg, anti-HEL Ig Tg, and Ig/sHEL Tg mice. Numbers shown on each plot indicate the percentage of Bcl-2+FSChigh T1 cells. Results are representative of two independent experiments. B, The rag-2 gene expression in follicular and T1 B cells. Freshly isolated resting B cells from 4- to 6-wk-old B6 and NZB mice were stained with anti-HSA and anti-CD21 mAbs. Follicular (HSAlowCD21int) and T1 B cells (HSAhighCD21low) were purified using a cell sorter. The rag-2 and g3pdh expression was determined by semiquantitative RT-PCR as described in Materials and Methods. PCR products were run on a 1.5% agarose gel. F, follicular B cells; T, T1 B cells. Results are representative of three independent experiments.

 
It has been shown that rag-2 expression is increased in immature B cells that have engaged self-Ag in vivo (32). Consistent with an increased proportion of NZB T1 cells having engaged self-Ags, NZB T1 cells had a 2.5-fold increase in rag-2 expression compared with B6 T1 cells (fold increase in NZB T1 cells ± SD, 2.49 ± 1.03; mean of four independent experiments; p < 0.05). As reported previously, rag-2 expression was not detected in mature follicular B cells of either mouse strain (Fig. 5B). Taken together, the data indicate that the increased proportion of Bcl-2 expressing T1 cells in NZB mice results from Ig receptor engagement with self-Ags in vivo.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Clonal deletion of autoreactive B cells at the T1 stage of development has been proposed to play an important role in the maintenance of B cell tolerance. In this study we show that this checkpoint is defective in NZB mice. Although extensive IgM cross-linking usually leads to deletion of T1 cells, in NZB T1 cells it prevents mitochondrial membrane damage and promotes cell survival.

Our data confirm the presence of the IgM-mediated apoptosis defect in resting B cells isolated from young NZB mice, previously identified by Kozono et al. (22), and demonstrates for the first time that this defect lies within the T1 B cell subset. Because apoptosis of NZB and BALB/c populations from older mice containing predominantly mature follicular B cells was comparable after IgM cross-linking and hypercross-linking, we hypothesized that the apoptosis defect in NZB B cells must arise from the T1 cell subset, which is more abundant in young mice. We confirmed this by gating on T1 cells and demonstrating using several different techniques that IgM-mediated apoptosis was consistently reduced for NZB T1 B cells. We also showed that although mitochondrial damage was impaired in NZB T1 cells after IgM cross-linking, the mitochondrial damage induced by IgM hypercross-linking of mature follicular B cells was comparable in NZB and both nonautoimmune mouse strains, indicating that the apoptosis defect is restricted to the T1 B cell subset in NZB mice.

B cells at the transitional phase of development express low levels of antiapoptosis factors, such as A1, Bcl-2, and Bcl-xL, and, in contrast to mature follicular cells, do not up-regulate these factors in response to Ig receptor engagement (33, 34). Consistent with these previous results, we found that only a small percentage of freshly isolated control T1 B cells were Bcl-2 positive and that Bcl-2 was minimally induced by IgM cross-linking. Surprisingly, >40% of freshly isolated NZB T1 B cells were Bcl-2 positive, with many of the cells expressing higher levels of Bcl-2 than those seen in Bcl-2+ control T1 B cells. We provide evidence supporting the role of in vivo Ig receptor engagement in the induction of the altered bcl-2 expression seen in these cells and demonstrate in vitro that IgM cross-linking reinduces or maintains abnormal Bcl-2 expression in NZB T1 cells. We have focused on Bcl-2, but it is likely that this is not the only prosurvival factor that is abnormally expressed in NZB T1 B cells. In support of this possibility, bcl-xL mRNA expression was also increased in NZB transitional B cells after IgM cross-linking in vitro compared with controls (data not shown).

Although we have not yet identified the precise signaling abnormality that leads to the altered T1 response in NZB mice, in some respects it mimics that seen in normal mature follicular B cells. IgM cross-linking in mature B cells leads to protein kinase C (PKC)-dependent activation of the NF-{kappa}B pathway, which induces the expression of anti-apoptosis factors and promotes entry into the cell cycle (35, 36). Inhibition of PKC or gene deletion of NF-{kappa}B family members in mature B cells leads to increased apoptosis after IgM cross-linking, whereas activation of PKC in transitional B cells leads to cell survival and proliferation. The abnormal expression of bcl-2 in NZB T1 cells argues that there is altered translocation of NF-{kappa}B in these cells. This could result from a B cell signaling abnormality that leads to increased PKC activation and/or altered NF-{kappa}B translocation after IgM cross-linking. Our previous demonstration that mature B cells in NZB mice are hyper-responsive to CD40-derived signals provides support for this idea (13).

It might be predicted that an apoptosis defect in the NZB T1 cell subset would lead to expansion of this subset in vivo; however, we did not detect any expansion of the T1 population, or the T2 population that is derived from it, in NZB mice. It is likely that the lack of expansion of these populations results from recruitment of autoreactive T1 B cells directly into the autoimmune response. In NZB mice with a CD40L gene deletion that abrogates IgG anti-ssDNA or anti-RBC Ab production, we see marked expansions of the CD21highCD23+ T2 and CD21highCD23 marginal zone B cell compartments compared with CD40L-sufficient +/– littermates and control B6 mice (our manuscript in preparation). Thus, the apoptosis defect in NZB mice qualitatively alters the generation of T1 B cells, leading to an increased proportion of autoimmune B cells within the naive B cell repertoire compared with nonautoimmune controls. Consistent with this possibility, the proportion of autoreactive T1 B cells in membrane HEL (B6 x NZB)F1 mice reconstituted with NZB anti-HEL Ig bone marrow is significantly increased over that seen after reconstitution with B6 anti-HEL Ig bone marrow (our manuscript in preparation).

Protection from apoptosis in NZB T1 cells is dependent upon the extent and duration of IgM cross-linking. At 5 h after IgM cross-linking, all concentrations of anti-IgM Ab tested not only failed to induce apoptosis, but also reduced apoptosis below background. By 12 h, anti-IgM Ab concentrations ≤3 µg/ml induced apoptosis, but apoptosis at 10 µg/ml was still reduced below background. At 16 h, even 10 µg/ml anti-IgM Ab induced some apoptosis above background, which was still reduced compared with controls (data not shown). Examination of apoptosis at later time points was precluded by high background apoptosis levels. These findings indicate that IgM cross-linking alone is not sufficient to induce sustained survival of NZB T1 cells in vitro and suggest that a second survival signal may be required to further prolong their survival in vivo. Nevertheless, the prolonged survival of autoreactive T1 B cells in NZB mice could create an increased window of opportunity for recruitment of autoreactive cells into mature B cell microenvironments and/or activation. Normally transitional B cells that have engaged autoantigens fail to enter B cell follicles and die (37). This process is thought to play an important role in preventing autoreactive B cells from entering the mature follicular or marginal zone B cell compartments, where they could become activated by T cells to differentiate into autoantibody-producing B cells. Death of excluded B cells is dictated by a balance between the affinity of autoreactive B cells for self Ag, or the extent of IgM cross-linking by self Ag, and the concentration of the B cell-activating factor belonging to the TNF family (38). Thus, it is possible that the increased expression of bcl-2 in NZB transitional B cells acts to reduce the dependence of Ag-engaged cells on B cell-activating factor belonging to the TNF family for survival, resulting in increased recruitment into mature B cell niches. The expansion of the marginal zone B cell compartment as well as the enrichment for autoreactive B cells in this compartment in NZB mice would also be consistent with this hypothesis (24). In support of this idea, we have found that anergic NZB anti-HEL Ig Tg B cells demonstrate increased survival after adoptive transfer into sHEL recipients and migrate into the B cell follicle (our manuscript in preparation).

Alternatively, the reduced apoptosis of NZB transitional B cells after Ig receptor engagement may lead to an increased capacity to survive and differentiate into autoantibody-producing cells with suboptimal T cell help. Normal transitional B cells undergo Ag-induced apoptosis in the absence of T cell help (20). Although transitional B cells can process and present Ag to naive T cells, they do not effectively stimulate these cells due to impaired up-regulation of CD86 (39). Consequently, transitional B cells are not rescued by interactions with naive T cells. In NZB mice, the enhanced survival of Ag-engaged transitional B cells may allow suboptimal T cell signals to produce sustained survival and differentiation to autoantibody-producing cells. In support of this hypothesis, we recently reported that anti-HEL Ig Tg B cells from NZB mice proliferate and differentiate into autoantibody-producing cells after transfer into sHEL mice (40). This abnormal activation resulted from an intrinsic B cell defect that was dependent upon T cell help.

Our data provide support for the relevance of the bcl-2 transgenic mouse models to the immunopathogenesis of lupus. Although the bcl-2 transgene has been shown to induce lupus on a susceptible genetic background (41), this is the first demonstration that aberrant expression of Bcl-2 may be implicated in the development of lupus in a spontaneously arising mouse model. Identification of this defect was facilitated by focusing on T1 B cells, a subset that does not normally express antiapoptosis factors at high levels and which demonstrates similar functional properties to immature bone marrow B cells. Recently, Yurasov et al. (42) provided evidence that autoreactive B cells are not properly deleted between the new emigrant and mature naive B cell stage in humans with lupus. It will be important to determine whether abnormal IgM signaling, as described in this study for NZB mice, is responsible for this defect in human SLE. Identification of such defects would indicate that signaling processes that prevent deletion of autoreactive B cells from the preimmune repertoire play a central role in susceptibility to lupus.


    Acknowledgments
 
We thank Drs. Michael Ratcliffe, Robert Inman, and J. C. Zúñiga-Pflücker for critical reading of this manuscript.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by grants from the Canadian Institute of Health Research (MOP-37886) and the Arthritis Society of Canada. J.E.W. is the recipient of an Arthritis Society/Canadian Institutes of Health Research Investigator Award. N.-H.C. is the recipient of an Arthritis Center of Excellence Fellowship. Back

2 Address correspondence and reprint requests to Dr. Joan E. Wither, IE429-C, Toronto Western Hospital, 399 Bathurst Street, Toronto, Ontario, Canada M5T 2S8. E-mail address: jwither{at}uhnres.utoronto.ca Back

3 Abbreviations used in this paper: SLE, systemic lupus erythematosus; {Delta}{psi}, mitochondrial transmembrane potential; DIOC6, 3,3'-dihexyloxycarbocyanine iodide; FSC, forward scatter; HEL, hen egg white lysozyme; HSA, heat-stable Ag; NZB, New Zealand Black; NZW, New Zealand White; PI, propidium iodide; PKC, protein kinase C; SA, streptavidin; sHEL, soluble HEL; T1 cell, transitional T1 B cell; Tg, transgenic. Back

Received for publication October 29, 2004. Accepted for publication September 22, 2005.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Theofilopoulos, A. N., F. J. Dixon. 1985. Murine models of systemic lupus erythematosus. Adv. Immunol. 37: 269-390. [Medline]
  2. Chiang, B.-L., E. Bearer, A. Ansari, K. Dorshkind, M. E. Gershwin. 1990. The bm12 mutation and autoantibodies to dsDNA in NZB.H-2bm12 mice. J. Immunol. 145: 94-101. [Abstract]
  3. Kotzin, B. L., J. W. Kappler, P. C. Marrack, L. R. Herron. 1989. T cell tolerance to self antigens in New Zealand hybrid mice with lupus-like disease. J. Immunol. 143: 89-94. [Abstract]
  4. Theofilopoulos, A. N., P. A. Singer, R. Kofler, D. H. Kono, M. A. Duchosal, R. S. Balderas. 1989. B and T cell antigen receptor repertoires in lupus/arthirtis murine models. Springer Semin. Immunopathol. 11: 335-368. [Medline]
  5. Scott, D. E., W. J. Kisch, A. D. Steinberg. 1993. Studies of T cell deletion and T cell anergy following in vivo administration of SEB to normal and lupus-prone mice. J. Immunol. 150: 664-672. [Abstract]
  6. Wither, J. E., B. Vukusic. 1998. Autoimmunity develops in lupus-prone NZB mice despite normal T cell tolerance. J. Immunol. 161: 4555-4562. [Abstract/Free Full Text]
  7. Izui, S., P. J. McConahey, F. J. Dixon. 1978. Increased spontaneous polyclonal activation of B lymphocytes in mice with spontaneous autoimmune disease. J. Immunol. 121: 2213-2219. [Abstract/Free Full Text]
  8. Raveche, E. S., A. D. Steinberg, A. L. DeFranco, J.-H. Tijo. 1982. Cell cycle analysis of lymphocyte activation in normal and autoimmune strains of mice. J. Immunol. 129: 1219-1226. [Abstract]
  9. Ando, D. G., F. M. Ebling, B. H. Hahn. 1986. Detection of native and denatured DNA antibody forming cells by the enzyme-linked immunospot assay: a clinical study of (New Zealand Black x New Zealand White)F1 mice. Arthritis Rheum. 29: 1139-1146. [Medline]
  10. Moutsopolous, H. M., M. Boehm-Truitt, S. S. Kassan, T. M. Chused. 1977. Demonstration of activation of B lymphocytes in New Zealand Black mice at birth by an immunoradiometric assay for murine IgM. J. Immunol. 119: 1639-1644. [Abstract/Free Full Text]
  11. Manny, N., S. K. Datta, R. S. Schwartz. 1979. Synthesis of IgM by cells of NZB and SWR mice and their crosses. J. Immunol. 122: 1220-1227. [Abstract/Free Full Text]
  12. Bishop, G. A., L. M. Ramirez, T. J. Waldschmidt. 1994. Differential responses to Ig and class II-mediated signals in splenic B cell subsets from normal and autoimmune mice. Int. Immunol. 6: 1049-1059. [Abstract/Free Full Text]
  13. Jongstra-Bilen, J., B. Vukusic, K. Boras, J. E. Wither. 1997. Resting B cells from autoimmune lupus-prone New Zealand Black and (New Zealand Black x New Zealand White)F1 mice are hyper-responsive to T-cell-derived stimuli. J. Immunol. 159: 5810-5820. [Abstract]
  14. Cornall, R. J., C. C. Goodnow, J. G. Cyster. 1995. The regulation of self-reactive B cells. Curr. Opin. Immunol. 7: 804-811. [Medline]
  15. Gay, D., T. Saunders, S. Camper, M. Weigert. 1993. Receptor editing: an approach by autoreactive B cells to escape tolerance. J. Exp. Med. 177: 999-1008. [Abstract/Free Full Text]
  16. Benschop, R. J., D. Melamed, D. Nemazee, J. C. Cambier. 1999. Distinct signal thresholds for the unique antigen receptor-linked gene expression programs in mature and immature B cells. J. Exp. Med. 190: 749-756. [Abstract/Free Full Text]
  17. Benschop, R. J., E. Brandl, A. C. Chan, J. C. Cambier. 2001. Unique signaling properties of B cell antigen receptor in mature and immature B cells: implications for tolerance and activation. J. Immunol. 167: 4172-4179. [Abstract/Free Full Text]
  18. Melamed, D., R. J. Benshop, J. C. Cambier, D. Nemazee. 1998. Developmental regulation of B lymphocyte immune tolerance compartmentalizes clonal selection from receptor selection. Cell 92: 173-182. [Medline]
  19. Sandel, P. C., J. G. Monroe. 1999. Negative selection of immature B cells by receptor editing or deletion is determined by site of antigen encounter. Immunity 10: 289-299. [Medline]
  20. Sater, R. A., P. C. Sandel, J. G. Monroe. 1998. B cell receptor-induced apoptosis in primary transitional murine B cells: signaling requirements and modulation by T cell help. Int. Immunol. 10: 1673-1682. [Abstract/Free Full Text]
  21. Yellen, A. J., W. Glenn, V. P. Sukhatme, X. M. Cao, J. G. Monroe. 1991. Signaling through surface IgM in tolerance-susceptible immature murine B lymphocytes: developmentally regulated differences in transmembrane signaling in splenic B cells from adult and neonatal mice. J. Immunol. 146: 1446-1454. [Abstract]
  22. Kozono, Y., B. L. Kotzin, V. M. Holers. 1996. Resting B cells from New Zealand Black mice demonstrate a defect in apoptosis induction following surface IgM ligation. J. Immunol. 156: 4498-4503. [Abstract]
  23. Nicoletti, I., G. Migliorati, M. C. Pagliacci, F. Grignani, C. Riccardi. 1991. A rapid and simple method for measuring thymocyte apoptosis by propidium iodide staining and flow cytometry. J. Immunol. Methods 139: 271-279. [Medline]
  24. Wither, J. E., V. Roy, L. A. Brennan. 2000. Activated B cells express increased levels of costimulatory molecules in young autoimmune NZB and (NZB x NZW)F1 mice. Clin. Immunol. 94: 51-63. [Medline]
  25. Parry, S. L., J. Hasbold, M. Holman, G. G. Klaus. 1994. Hypercross-linking surface IgM or IgD receptors on mature B cells induces apoptosis that is reversed by costimulation with IL-4 and anti-CD40. J. Immunol. 152: 2821-2829. [Abstract]
  26. Sieckmann, D. G., R. Asofsky, D. E. Mosier, I. M. Zitron, W. E. Paul. 1978. Activation of mouse lymphocytes by anti-immunoglobulin. I. Parameters of proliferative response. J. Exp. Med. 147: 814-829. [Abstract/Free Full Text]
  27. Julius, M. H., C. H. Heusser, K.-U. Hartmann. 1984. Induction of resting B cells to DNA synthesis by soluble monoclonal anti-immunoglobulin. Eur. J. Immunol. 14: 753-757. [Medline]
  28. Cambier, J. C., C. H. Heusser, M. H. Julius. 1986. Abortive activation of B lymphocytes by monoclonal anti-immunoglobulin antibodies. J. Immunol. 136: 3140-3146. [Abstract]
  29. Kovesdi, D., K. Paszty, A. Enyedi, E. Kiss, J. Matko, K. Ludanyi, E. Rajnavolgyi, G. Sarmay. 2004. Antigen receptor-mediated signaling pathways in transitional immature B cells. Cell. Signal. 16: 881-889. [Medline]
  30. Hartley, S. B., M. P. Cooke, D. A. Fulcher, A. W. Harris, S. Cory, A. Basten, C. C. Goodnow. 1993. Elimination of self-reactive B lymphocytes proceeds in two stages: arrested development and cell death. Cell 72: 325-335. [Medline]
  31. Goodnow, C. C., J. Crosbie, S. Adelstein, T. B. Lavoie, S. J. Smith-Gill, R. A. Brink, H. Pritchard-Briscoe, J. S. Wotherspoon, R. H. Loblay, K. Raphael, et al 1988. Altered immunoglobulin expression and functional silencing of self-reactive B lymphocytes in transgenic mice. Nature 334: 676-682. [Medline]
  32. Tze, L. E., E. A. Baness, K. L. Hippen, T. W. Behrens. 2000. Ig light chain receptor editing in anergic B cells. J. Immunol. 165: 6796-6802. [Abstract/Free Full Text]
  33. Grillot, D. A., R. Merino, J. C. Pena, W. C. Fanslow, F. D. Finkelman, C. B. Thompson, G. Nunez. 1996. bcl-x exhibits regulated expression during B cell development and activation and modulates lymphocyte survival in transgenic mice. J. Exp. Med. 183: 381-391. [Abstract/Free Full Text]
  34. Niiro, H., E. A. Clark. 2002. Regulation of B-cell fate by antigen-receptor signals. Nat. Rev. Immunol. 2: 945-956. [Medline]
  35. King, L. B., A. Norvell, J. G. Monroe. 1999. Antigen receptor-induced signal transduction imbalances associated with the negative selection of immature B cells. J. Immunol. 162: 2655-2662. [Abstract/Free Full Text]
  36. Gugasyan, R., R. Grumont, M. Grossman, Y. Nakamura, T. Pohl, D. Nesic, S. Gerondakis. 2000. Rel/NF-{kappa}B transcription factors: key mediators of B-cell activation. Immunol. Rev. 176: 134-140. [Medline]
  37. Thien, M., T. G. Phan, S. Gardam, M. Amesbury, A. Basten, F. Mackay, R. Brink. 2004. Excess BAFF rescues self-reactive B cells from peripheral deletion and allows them to enter forbidden follicular and marginal zone niches. Immunity 20: 785-798. [Medline]
  38. Lesley, R., Y. Xu, S. L. Kalled, D. M. Hess, S. R. Schwab, H.-B. Shu, J. G. Cyster. 2004. Reduced competitiveness of autoantigen-engaged B cells due to increased dependence on BAFF. Immunity 20: 441-453. [Medline]
  39. Chung, J. B., A. D. Wells, S. Adler, A. Jacob, L. A. Turka, J. G. Monroe. 2003. Incomplete activation of CD4 T cells by antigen-presenting transitional immature B cells: implications for peripheral B and T cell responsiveness. J. Immunol. 171: 1758-1767. [Abstract/Free Full Text]
  40. Chang, N.-H., R. MacLeod, J. E. Wither. 2004. Autoreactive B cells in lupus-prone New Zealand Black mice exhibit aberrant survival and proliferation in the presence of self-antigen in vivo. J. Immunol. 172: 1553-1560. [Abstract/Free Full Text]
  41. Strasser, A., S. Whittingham, D. L. Vaux, M. L. Bath, J. M. Adams, S. Cory, A. W. Harris. 1991. Enforced BCL2 expression in B-lymphoid cells prolongs antibody responses and elicits autoimmune disease. Proc. Natl. Acad. Sci. USA 88: 8661-8665. [Abstract/Free Full Text]
  42. Yurasov, S., H. Wardemann, J. Hammersen, M. Tsuiji, E. Meffre, V. Pascual, M. C. Nussenzweig. 2005. Defective B cell tolerance checkpoints in systemic lupus erythematosus. J. Exp. Med. 201: 703-711. [Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Immunol.Home page
M. Kuraoka, D. Liao, K. Yang, S. D. Allgood, M. C. Levesque, G. Kelsoe, and Y. Ueda
Activation-Induced Cytidine Deaminase Expression and Activity in the Absence of Germinal Centers: Insights into Hyper-IgM Syndrome
J. Immunol., September 1, 2009; 183(5): 3237 - 3248.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. L. Fletcher, N. Seach, J. J. Reiseger, T. E. Lowen, M. V. Hammett, H. S. Scott, and R. L. Boyd
Reduced Thymic Aire Expression and Abnormal NF-{kappa}B2 Signaling in a Model of Systemic Autoimmunity
J. Immunol., March 1, 2009; 182(5): 2690 - 2699.
[Abstract] [Full Text] [PDF]


Home page
LupusHome page
P. Piotrowski, M. Lianeri, M. Mostowska, M. Wudarski, H. Chwalinska-Sadowska, and P. Jagodzinski
Contribution of polymorphism in codon 72 of p53 gene to systemic lupus erythematosus in Poland
Lupus, February 1, 2008; 17(2): 148 - 151.
[Abstract] [PDF]


Home page
J. Immunol.Home page
S. Rieken, A. Sassmann, S. Herroeder, B. Wallenwein, A. Moers, S. Offermanns, and N. Wettschureck
G12/G13 family g proteins regulate marginal zone B cell maturation, migration, and polarization.
J. Immunol., September 1, 2006; 177(5): 2985 - 2993.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y.-H. Cheung, N.-H. Chang, Y.-C. Cai, G. Bonventi, R. MacLeod, and J. E. Wither
Functional Interplay between Intrinsic B and T Cell Defects Leads to Amplification of Autoimmune Disease in New Zealand Black Chromosome 1 Congenic Mice
J. Immunol., December 15, 2005; 175(12): 8154 - 8164.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Roy, V.
Right arrow Articles by Wither, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Roy, V.
Right arrow Articles by Wither, J.
Right arrowPubmed/NCBI databases
*Substance via MeSH
Medline Plus Health Information
*Lupus


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS