|
|
||||||||





* Laboratory of Experimental Internal Medicine,
Department of Pathology,
Department of Vascular Medicine, and
Department of Infectious Diseases, Tropical Medicine and AIDS, Academic Medical Center, University of Amsterdam, Amsterdam, The Netherlands; and
¶ Department of Pediatrics, Leiden University Medical Center Leiden, The Netherlands
| Abstract |
|---|
|
|
|---|
and IL-6 levels. These data argue against an important part for TAFI in the regulation of the procoagulant-fibrinolytic balance in sepsis and reveals a thus far unknown role of TAFI in the occurrence of hepatic necrosis. | Introduction |
|---|
|
|
|---|
| Materials and Methods |
|---|
|
|
|---|
TAFI / mice (backcrossed six times to a C57BL/6 background) were generated as described previously (24). Age- and sex-matched C57BL/6 wild-type (Wt) mice were purchased from Harlan Sprague Dawley. The mice were kept on a 12 h light/dark cycle and received food and water ad libitum. TAFI/ mice have undetectable TAFI mRNA, protein, and activity levels (24). TAFI deficiency has no effect on baseline levels of plasminogen (23),
2-antiplasmin, plasminogen activator inhibitor type I (27), fibrinogen, prothrombin time, activated partial thromboplastin time, and blood cell counts (22). The Institutional Animal Care and Use Committee approved all experiments.
Induction of peritonitis
Peritonitis was induced in 8- to 10-wk-old male Wt and TAFI/ mice as described previously (28, 29, 30). In brief, E. coli O18:K1 was cultured in Luria-Bertani medium (Difco) at 37°C, harvested at mid-log phase, and washed twice with sterile saline before injection. Mice were injected i.p. with 1 x 104 CFU of E. coli O18:K1 in 200 µl of sterile isotonic saline.
Sample harvesting
At the time of sacrifice, mice were first anesthetized by inhalation of isoflurane (Abbott Laboratories). A peritoneal lavage was then performed with 5 ml of sterile isotonic saline using an 18-gauge needle, and peritoneal lavage fluid was collected in sterile tubes (Plastipack; BD Biosciences). After collection of peritoneal fluid, deeper anesthesia was induced by i.p. injection of 0.07 ml of FFM mixture (fentanyl (0.315 mg/ml)-fluanisone (10 mg/ml; Janssen), midazolam (5 mg/ml; Roche) per gram of body weight. The abdomen was opened, and blood was drawn from the vena cava inferior into a sterile syringe, transferred to tubes containing heparin, and immediately placed on ice. Thereafter, livers and lungs were harvested and processed for RNA isolation, histology and measurements of CFU, cytokines and myeloperoxidase (MPO).
Evaluation of mRNA levels by quantitative RT-PCR
Total RNA was isolated using the RNeasy Mini kit system (Qiagen) and treated with RQ1 RNase-Free DNase (Promega) and reverse-transcribed using oligo(dT) primer and Moloney murine leukemia virus reverse transcriptase (Invitrogen Life Technologies) according to recommendations of the suppliers. RT-PCRs were performed on cDNA samples that were 4-fold diluted in H2O using FastStart DNA Master SYBR Green I (Roche) with 2.5 mM MgCl2 in a LightCycler (Roche) apparatus. PCR conditions were: 5 min 95°C hot-start, followed by 40 cycles of amplification (95°C for 15 s, 60°C for 5 s, 72°C for 20 s). For quantification, standard curves were constructed by PCR on serial dilutions of a concentrated cDNA and data were analyzed using the LightCycler software as described by the manufacturer. Gene expression is presented as a ratio of the expression of the housekeeping gene
2-microglobulin (31). All PCRs generated a single DNA product of the expected length as judged by evaluation on ethidium bromide-stained 1.2% agarose gel electrophoresis. Primers used for murine TAFI were mTAFI S633 TGGATTTCACCTGCTTTCTGT and mTAFI AS784 GGTTCTTCCTCCACATTCGAT. Primers for the housekeeping gene were mB2M S74 TGGTCTTTCTGGTGCTTGTCT and mB2M AS231 ATTTTTTTCCCGTTCTTCAGC. Oligonucleotides were derived from Eurogentec.
Assays
TAFI and thrombin-anti-thrombin complexes (TATc) were measured by mouse-specific ELISAs as described previously (24, 28, 32). Protein was measured by the bicinchoninic acid assay kit (Pierce). D-dimer was quantitated by a sandwich-type ELISA from Asserachrom D-dimer (Diagnostica Stago). Fibrin deposition in lungs and liver was determined by Western blot analysis as described previously (33, 34). Aspartate aminotransferase (ASAT) and alanine aminotransferase (ALAT) were determined with commercially available kits (Sigma-Aldrich), using a Hitachi analyzer (Roche) according to the manufacturers instructions. Levels of MPO in lung tissues were measured as described previously (35, 36). MIP-2 and keratinocyte-derived chemokine (KC) were measured by ELISAs according to the instructions of the manufacturer (R&D Systems). TNF-
, IL-6, and IL-10 were measured by cytometric bead array multiplex assay (BD Biosciences) in accordance with the manufacturers recommendations. For these cytokine measurements, livers were homogenized at 4°C in 5 volumes of sterile isotonic saline with a tissue homogenizer (Biospect Products), which was carefully cleaned and disinfected with 70% ethanol after each homogenization. The liver homogenates were lysed in lysis buffer (300 mM NaCl, 15 mM Tris [tris(hydroxymethyl)aminomethane], 2 mM MgCl, 2 mM Triton X-100, pepstatin A, leupeptin, and aprotinin (20 ng/ml) (pH 7.4)) on ice for 30 min and spun at 1500 x g at 4°C for 15 min. The supernatant was frozen at 20°C until assayed. Serum amyloid P was measured in plasma by a sandwich ELISA as described previously (37, 38).
Histology
Directly after sacrifice liver and lung samples were fixed with 4% formalin and embedded in paraffin. Paraffin sections (4-µm thick) were stained with H&E. All slides were coded and scored by a pathologist without knowledge of the strain of mice. The liver and lungs were scored according to the following parameters: 1) the number of thrombi counted in five fields at a magnification of x200 (lungs) or x100 (liver); 2) the presence and degree of inflammation, which included the interstitial influx of leukocytes and the presence of endothelialitis; 3) for liver only: the presence and degree of necrosis. Inflammation and hepatic necrosis were rated from 0 to 3, wherein 0 = absent, 1 = occasionally, 2 = regularly, 3 = massively. Granulocyte immunostaining was performed as described previously (39, 40). Granulocytes were counted in five random fields (magnification, x200).
Cell counts and differentials
Cell counts were determined in peritoneal lavage fluid using a hemacytometer (Beckman Coulter). Subsequently, the pellet was diluted in PBS to a final concentration of 105 cells/ml and differential cell counts were performed on cytospin preparations stained with a modified Giemsa stain (Diff-Quick; Dade Behring).
Determination of bacterial outgrowth
Lungs and livers were homogenized at 4°C in 5 volumes of sterile isotonic saline with a tissue homogenizer (Biospect Products) which was carefully cleaned and disinfected with 70% ethanol after each homogenization. Serial 10-fold dilutions in sterile saline were made from these homogenates, blood, and peritoneal lavage fluid, and 50-µl volumes were plated onto sheep-blood agar plates and incubated at 37°C and 5% CO2. CFU were counted after 16 h.
Statistical analysis
Differences between groups were calculated by using the Mann-Whitney U test. Values were expressed as means ± SE. A p value of <0.05 was considered statistically significant.
| Results |
|---|
|
|
|---|
To determine whether TAFI expression changes during peritonitis, we measured TAFI mRNA in liver and lung samples at 0, 2, 6, and 20 h after i.p. injection of E. coli. We chose these time points for our experiments because they represent two stages in the clinical course of the disease: the beginning of the infection (2 and 6 h) without clinical symptoms and the end-stage of the infection (20 h) at which the mice are very ill. At 20 h after infection, TAFI mRNA was significantly increased in the livers of Wt mice (Fig. 1A; p < 0.05); in the lungs TAFI mRNA remained undetectable throughout. To investigate whether the increased TAFI expression resulted in a rise in protein levels we measured the concentration of TAFI Ag in liver homogenates, plasma, and peritoneal lavage fluid. In liver homogenates TAFI protein levels were slightly decreased at 2 h postinfection (nonsignificant); however, at 20 h postinfection TAFI levels were significantly up-regulated (Fig. 1B; p < 0.05). At 6 h after E. coli injection, plasma TAFI levels showed a decrease of 20% vs t = 0. However, after 20 h, TAFI levels were increased by 2.8-fold vs t = 0 (Fig. 1C; p < 0.01). TAFI remained undetectable in peritoneal lavage fluid at all time points.
|
Thrombin is a very important activator of TAFI and its levels rise during coagulation activation. Our group previously established that this model of abdominal sepsis is associated with thrombin generation and activation of the coagulation system (28). To determine the influence of TAFI hereon, we measured TATc levels in plasma of TAFI/ and Wt mice before and 6 and 20 h after i.p. injection of E. coli. TATc concentrations were unchanged at 6 h postinfection when compared with uninfected mice (data not shown). At 20 h, TATc were significantly elevated in plasma of TAFI/ and Wt mice; however, TATc levels were not different between the two mouse strains (Fig. 2A). TAFI can inhibit fibrinolysis by preventing the binding of plasminogen to fibrin and the subsequent facilitated conversion into the active protease plasmin (8, 13). To investigate whether the up-regulation of TAFI production during abdominal sepsis influenced the fibrinolytic activity, we measured D-dimer. Plasma D-dimer levels were strongly elevated at 20 h after E. coli injection, but no differences were observed between TAFI/ and Wt mice (Fig. 2B). To measure the extent of fibrin deposition in liver and lung tissue in TAFI / and Wt mice, these organs were harvested before and at 20 h after the induction of E. coli infection. Western blot analysis for fibrin showed increased fibrin accumulation in liver and lung tissue in animals with peritonitis, but the extent of fibrin deposition did not differ between TAFI/ and Wt mice (Fig. 3). Together, these data indicate that TAFI deficiency does not influence coagulation or fibrinolysis during E. coli sepsis.
|
|
This experimental model of abdominal sepsis is associated with profound liver injury (28, 29, 30). Considering the strong expression of TAFI in the liver and the possible role of TAFI in fibrinolytic and inflammatory responses, which probably play a role in the induction of organ damage, we examined the influence of TAFI deficiency on liver damage 20 h postinfection. Upon histopathological examination, both TAFI/ and Wt mice showed mild inflammation of liver tissue as characterized by the influx of leukocytes into the hepatic parenchyma (Fig. 4, A and B). The numbers of infiltrating granulocytes (as determined by immunostaining of liver sections) were similar in TAFI/ and Wt mice (Fig. 4C), indicating that TAFI deficiency did not impact on the extent of hepatic inflammation. In accordance with our previous investigations (28, 29, 30), all Wt mice showed foci of liver necrosis, which were predominantly localized in the midlobular region of the liver lobule, whereas the periportal area was unaffected (Fig. 4A, arrows). Remarkably, only 42% of TAFI/ mice had any sign of liver necrosis (Fig. 4B, arrows). Furthermore, the extent of liver necrosis (quantified according to the scoring system described in Materials and Methods) was also markedly reduced in TAFI/ mice (Fig. 4D; p < 0.05). The relative protection of TAFI/ mice against liver necrosis was confirmed by clinical chemistry, i.e., TAFI/ mice had lower plasma levels of ALAT and ASAT compared with Wt mice (Fig. 4E).
|
To obtain insight into the role of TAFI in the development of inflammation in another organ even more susceptible to inflammation-induced injury, lungs were harvested at 20 h after the induction of E. coli infection. Lungs showed clear signs of inflammation in both TAFI/ and Wt mice, as reflected by accumulation of leukocytes in the interstitium (Fig. 5, A and B). Histological scores were similar in both strains (Fig. 5C). Granulocyte stainings of lung tissues revealed a similarly strong accumulation of neutrophils in lungs of both mouse strains (data not shown). In line, MPO levels in lung homogenates were similar in TAFI/ and Wt mice before and at 6 and 20 h postinfection (Fig. 5D). Thus, TAFI deficiency did not influence the inflammatory response in the lung during E. coli sepsis.
|
The recruitment of leukocytes to the site of an infection is an essential part of the host defense to invading bacteria. Therefore, we determined leukocyte counts and differentials in peritoneal lavage fluid 6 and 20 h after E. coli injection in TAFI/ and Wt mice. Peritonitis was associated with a profound rise in the number of cells in the peritoneal lavage fluid, which was mainly the result of neutrophil influx into the peritoneal cavity. TAFI/ mice had two times higher neutrophil counts in their peritoneal fluid than Wt mice at 20 h postinfection (Table I; p < 0.05).
|
CXC chemokines play a role in the attraction of neutrophils to the site of inflammation. To investigate whether the increased neutrophil influx in TAFI/ mice might be the result of an effect on local chemokine levels, the concentrations of MIP-2 and KC were measured in the peritoneal lavage fluid at 6 and 20 h after E. coli injection. However, MIP-2 or KC levels were similar in TAFI/ and Wt mice at both time points (Table II). To determine whether TAFI influenced the local or systemic production of cytokines during septic peritonitis, TNF-
, IL-6, and IL-10 were measured in peritoneal lavage fluid, plasma, and liver homogenates. Cytokine levels in the peritoneal lavage fluid tended to be higher in TAFI/ mice, but these differences did not reach statistical significance (Table II). At 6 h postinfection, TAFI/ mice had significantly higher plasma levels of TNF-
and IL-6 compared with Wt mice (Table II; both p < 0.05); at 20 h plasma cytokine levels were similar in both mouse strains. There were no differences between the two mouse strains in plasma IL-10 levels at either time point (Table II). In liver homogenates, all cytokine concentrations were similar on both time points (Table II). To examine whether the acute phase protein response was influenced by the difference in early IL-6 levels between TAFI/ and Wt mice during E. coli-induced abdominal sepsis, we measured the murine acute phase protein serum amyloid P in plasma at 20 h postinfection. Circulating serum amyloid P concentrations were increased in both strains but much higher in TAFI/ mice than in Wt mice (Table II).
|
To determine whether TAFI influences antibacterial host defense, we compared the bacterial load in peritoneal lavage fluid, blood, and liver of TAFI/ and Wt mice at 6 and 20 h postinfection. At 6 h, TAFI/ mice had more bacteria in their peritoneal lavage fluid and blood than Wt mice (Fig. 6; p < 0.05), whereas the bacterial loads in liver tended to be higher in TAFI/ mice (not significant). After 20 h, bacterial loads had increased strongly in both mouse strains and no significant differences in the number of E. coli CFU existed anymore between TAFI/ and Wt mice (Fig. 6).
|
| Discussion |
|---|
|
|
|---|
TAFI mRNA is strongly expressed in the liver of humans, mice, and rats (7, 19, 20). Hepatic TAFI mRNA expression rapidly increased after endotoxin administration to rodents (19, 20) and TAFI plasma levels were elevated during peritonitis induced by cecal ligation and puncture in rats (41). In line with these previous studies, we found that TAFI mRNA was expressed in the liver and became up-regulated during E. coli-induced peritonitis, which was accompanied by elevated TAFI protein levels in liver and plasma. In humans, TAFI protein levels vary in different diseases. In contrast to murine sepsis, decreased TAFI levels have been found during infections in humans (16, 17), which might be the consequence of enhanced consumption. Furthermore, in healthy humans exposed to low dose endotoxin circulating TAFI levels decreased 16% relative to baseline (18). We found a decrease of 20% in the early phase after infection. However, later on plasma TAFI levels showed a profound rise of 2.8-fold relative to baseline. Possibly, the low-grade human endotoxemia model was too mild to induce this secondary increase in TAFI concentrations; otherwise, it is possible that the response differs between humans and mice. Of note, TAFI plasma levels were elevated and correlated with acute phase proteins in other noninfectious human diseases, including inflammatory diseases like inflammatory bowel diseases, Reiters syndrome, Behcets syndrome, and celiac disease (42, 43), and also during coronary artery disease (44) and ischemic stroke (45).
In line with previous findings (28), E. coli peritonitis was associated with activation of the coagulation system as reflected by a rise in TATc concentrations in plasma, and increased fibrin deposition in liver and lungs. Although TAFI deficiency is not expected to influence TATc levels, it would impact on fibrin deposition if TAFI plays a significant role as an inhibitor of fibrinolysis in sepsis in vivo. In vitro, activated TAFI can inhibit plasmin formation by removing the plasminogen binding sites on fibrin, an effect by which it might promote thrombus formation. In accordance, previous in vivo studies have shown that activated TAFI plays an important role in the susceptibility of a clot to lysis, i.e., inhibitors of active TAFI increased endogenous thrombolysis in experimental jugular vein and arterial thrombolysis models in mice and rabbits (46, 47, 48). Furthermore, increased TAFI Ag levels are associated with a mild risk for thrombosis (48). Surprisingly, TAFI/ mice did not show any differences in venous or arterial thrombosis models or in mortality induced by acute pulmonary thromboembolism or LPS-induced disseminated intravascular coagulation (22, 23, 24). In line, our study demonstrates that during abdominal sepsis TAFI/ mice display an unaltered activation of the fibrinolytic system as reflected by the plasma levels of D-dimer and did not show a decreased tendency to form fibrin depositions in either liver or lungs. Together, these data strongly argue against an important role for endogenous TAFI as regulator of the procoagulant-fibrinolytic balance in sepsis.
Surprisingly, TAFI/ mice showed significantly less and smaller foci of liver necrosis and decreased plasma transaminase levels indicating less hepatocellular injury. These data suggest that TAFI deficiency protects against sepsis-induced liver necrosis and possibly explain the distribution pattern of foci within the liver of Wt mice, which coincides with the lobular distribution pattern of TAFI mRNA, showing highest expression in the pericentral and midlobular area of the liver unit (49). The periportal area, in which TAFI expression is low or even absent, was protected from sepsis-induced liver injury. Because TAFI deficiency was not accompanied with changes in fibrinolytic or coagulant responses in our model, these differences in liver necrosis seem independent of TAFIs anti-fibrinolytic properties. Campbell et al. (14, 15) established that TAFI can remove arginine from the C terminus of C3a and C5a, which inactivates these complement factors. Interestingly, recent studies using C3a and C5a gene-deficient mice have shown that these complement factors play a very important protective role in acute liver necrosis induced by carbon tetrachloride or partial hepatectomy (50, 51, 52). Because TAFI-deficient mice might have a higher C3a and C5a activity, this could play a role in their relative protection from liver necrosis in our model. To directly demonstrate an effect of TAFI deficiency on complement, analytical separation of intact C5a and C3a from C5a and C3a that lack an arginine residue would be required; mere measurement of these complement factors by ELISA would not suffice. Unfortunately, at present the technique required for such analyses is not operational in our laboratory. In addition, we are currently not able to reliably measure complement activity in mice. Besides complement products, cytokines, including TNF and IL-6, have been implicated as mediators of liver inflammation and injury (53); however, the concentrations of TNF and IL-6 did not differ in liver homogenates prepared from TAFI/ and Wt mice after induction of abdominal sepsis. More studies are needed to investigate the mechanism by which TAFI impacts on liver injury during sepsis.
Peritonitis is characterized by recruitment of leukocytes to the site of infection (28, 29, 30). TAFI is able to inactivate complement-derived inflammatory peptides C5a and C3a, which are involved in leukocyte chemotaxis (14, 15). Furthermore, an increased number of leukocytes was found in the peritoneal cavity after i.p. injection of thioglycolate in TAFI/ mice superimposed on a partial plasminogen-deficient setting (23). We found that neutrophil influx into the peritoneal cavity was markedly increased in TAFI/ mice at 20 h after infection. Besides neutrophils, C5a is also able to attract macrophages and lymphocytes (54, 55). In our study, the numbers of macrophages and lymphocytes were also increased in TAFI/ mice compared with Wt mice; however; this difference was not significantly different. This is the first in vivo evidence of a specific role of TAFI in the attraction of leukocytes to the site of an infection. It has been suggested that TAFI might play a protective role during Gram-negative sepsis by preventing hyperreactivity of the inflammatory response and subsequent septic shock (15). However, we found no effect of TAFI deficiency on the inflammatory responses in the liver and lungs.
Because the inflammatory response of phagocytic cells can influence antibacterial host defense, we investigated the bacterial outgrowth in both genotypes. We found an increased bacterial load in peritoneal lavage fluid and blood in TAFI/ mice at 6 h after E. coli injection. A clear explanation for this finding is lacking; it cannot be explained by differences in the inflammatory response because the cellular influx to the peritoneal cavity was similar at that time point. Possibly, TAFI contributes to fibrin-mediated i.p. adhesion formation, which can wall off the infection and prevent early local and systemic bacterial spread (56, 57, 58). The difference in bacterial load disappeared after 20 h, probably due to the overwhelming local and systemic bacterial outgrowth overruling the modest effect of TAFI. Considering that there is no evidence that TAFI can influence cytokine production, the elevated plasma levels of TNF-
and IL-6 in TAFI/ mice at 6 h postinfection were most likely the consequence of the presence of an increased bacterial load in blood, providing a more potent proinflammatory stimulus.
Intraperitoneal administration of E. coli results in a paradigm that resembles the clinical condition commonly associated with septic peritonitis, with diaphragmatic lymphatic clearance, systemic bacteremia, and profound activation of coagulation and inflammation (28, 29, 30, 59). To our knowledge this is the first study to show an in vivo role for TAFI in a bacterial sepsis model. We demonstrate that TAFI does not play a role in facilitating the development of fibrin depositions in organs during E. coli- induced septic peritonitis. Rather, the enhanced production of TAFI in the liver during abdominal sepsis significantly contributed to the occurrence of hepatocellular necrosis. These data point to a thus far undiscovered function of endogenous TAFI in the liver during severe bacterial infection.
| Acknowledgments |
|---|
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported by a grant from The Netherlands Heart Foundation (No. 2001B114) (to R.R.) and a grant from The Netherlands Organization for Health Research and Development to S.A.J.t.H. (No. 920-03-213). ![]()
2 Address correspondence and reprint requests to Dr. Rosemarijn Renckens, Laboratory of Experimental Internal Medicine, Academic Medical Center, Room G2-132, Meibergdreef 9, 1105 AZ Amsterdam, The Netherlands. E-mail address: r.renckens{at}amc.uva.nl ![]()
3 Abbreviations used in this paper: TAFI, thrombin-activatable fibrinolysis inhibitor; Wt, wild type; MPO, myeloperoxidase; TATc, thrombin-anti-thrombin complex; ASAT, aspartate aminotransferase; ALAT, alanine aminotransferase; KC, keratinocyte-derived chemokine. ![]()
Received for publication June 16, 2005. Accepted for publication September 14, 2005.
| References |
|---|
|
|
|---|
-actin,
-2-microglobulin and porphobilinogen deaminase mRNA and their comparison as control transcripts for RT-PCR. Mol. Cell Probes 16:25.-30. [Medline]
-induced lethal hepatitis, shock, and skin necrosis. Infect. Immun. 68:5026.-5029. This article has been cited by other articles:
![]() |
N. Okumura, T. Koh, Y. Hasebe, T. Seki, and T. Ariga A Novel Function of Thrombin-activatable Fibrinolysis Inhibitor during Rat Liver Regeneration and in Growth-promoted Hepatocytes in Primary Culture J. Biol. Chem., June 12, 2009; 284(24): 16553 - 16561. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. T. H. Roelofs, K. M. A. Rouschop, G. J. D. Teske, G. T. M. Wagenaar, N. Claessen, J. J. Weening, T. van der Poll, and S. Florquin Endogenous tissue-type plasminogen activator is protective during ascending urinary tract infection Nephrol. Dial. Transplant., March 1, 2009; 24(3): 801 - 808. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Sood, L. Sholl, B. Isermann, M. Zogg, S. R. Coughlin, and H. Weiler Maternal Par4 and platelets contribute to defective placenta formation in mouse embryos lacking thrombomodulin Blood, August 1, 2008; 112(3): 585 - 591. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. M. Binette, F. B. Taylor Jr, G. Peer, and L. Bajzar Thrombin-thrombomodulin connects coagulation and fibrinolysis: more than an in vitro phenomenon Blood, November 1, 2007; 110(9): 3168 - 3175. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Nishimura, T. Myles, A. M. Piliposky, P. N. Kao, G. J. Berry, and L. L. K. Leung Thrombin-activatable procarboxypeptidase B regulates activated complement C5a in vivo Blood, March 1, 2007; 109(5): 1992 - 1997. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Knapp, U. Matt, N. Leitinger, and T. van der Poll Oxidized Phospholipids Inhibit Phagocytosis and Impair Outcome in Gram-Negative Sepsis In Vivo J. Immunol., January 15, 2007; 178(2): 993 - 1001. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. O. Mosnier and B. N. Bouma Regulation of Fibrinolysis by Thrombin Activatable Fibrinolysis Inhibitor, an Unstable Carboxypeptidase B That Unites the Pathways of Coagulation and Fibrinolysis Arterioscler. Thromb. Vasc. Biol., November 1, 2006; 26(11): 2445 - 2453. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |