The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Renckens, R.
Right arrow Articles by van der Poll, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Renckens, R.
Right arrow Articles by van der Poll, T.
The Journal of Immunology, 2005, 175: 6764-6771.
Copyright © 2005 by The American Association of Immunologists

Absence of Thrombin-Activatable Fibrinolysis Inhibitor Protects against Sepsis-Induced Liver Injury in Mice1

Rosemarijn Renckens2,*, Joris J. T. H. Roelofs{dagger}, Simone A. J. ter Horst, Cornelis van 't Veer*, Stefan R. Havik{ddagger}, Sandrine Florquin{dagger}, Gerry T. M. Wagenaar, Joost C. M. Meijers{ddagger} and Tom van der Poll*,§

* Laboratory of Experimental Internal Medicine, {dagger} Department of Pathology, {ddagger} Department of Vascular Medicine, and § Department of Infectious Diseases, Tropical Medicine and AIDS, Academic Medical Center, University of Amsterdam, Amsterdam, The Netherlands; and Department of Pediatrics, Leiden University Medical Center Leiden, The Netherlands


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Thrombin-activatable fibrinolysis inhibitor (TAFI), also known as carboxypeptidase R, has been implicated as an important negative regulator of the fibrinolytic system. In addition, TAFI is able to inactivate inflammatory peptides such as complement factors C3a and C5a. To determine the role of TAFI in the hemostatic and innate immune response to abdominal sepsis, TAFI gene-deficient (TAFI–/–) and normal wild-type mice received an i.p. injection with Escherichia coli. Liver TAFI mRNA and TAFI protein concentrations increased during sepsis. In contrast to the presumptive role of TAFI as a natural inhibitor of fibrinolysis, TAFI–/– mice did not show any difference in E. coli-induced activation of coagulation or fibrinolysis, as measured by plasma levels of thrombin-anti-thrombin complexes and D-dimer and the extent of fibrin depositions in lung and liver tissues. However, TAFI–/– mice were protected from liver necrosis as indicated by histopathology and clinical chemistry. Furthermore, TAFI–/– mice displayed an altered immune response to sepsis, as indicated by an increased neutrophil recruitment to the peritoneal cavity and a transiently increased bacterial outgrowth together with higher plasma TNF-{alpha} and IL-6 levels. These data argue against an important part for TAFI in the regulation of the procoagulant-fibrinolytic balance in sepsis and reveals a thus far unknown role of TAFI in the occurrence of hepatic necrosis.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Abdominal sepsis is a life-threatening disease with a mortality rate of up to 60% (1). During sepsis the coagulation system is activated, which in severe cases may result in the clinical syndrome of disseminated intravascular coagulation, characterized by microvascular thrombosis and fibrin depositions in many organs (2, 3, 4). The fibrinolytic system plays an important role in preserving the microcirculation by degrading fibrin and thrombi at intra- and extravascular sites (2, 3, 4). Thrombin-activatable fibrinolysis inhibitor (TAFI),3 also called carboxypeptidase R, U, or B, is a recently discovered inhibitor of the fibrinolytic system (5, 6, 7). TAFI is synthesized in the liver and circulates in plasma as a proenzyme (7). In vitro TAFI can be activated by thrombin (8), thrombin/thrombomodulin complex (9), plasmin (10), trypsin (11), and elastase (12). Activated TAFI exerts its anti-fibrinolytic action by removing C-terminal lysine and arginine residues from partially degraded fibrin, thereby inhibiting the high-affinity binding of plasminogen to fibrin and the subsequent facilitated conversion into the active protease plasmin (8, 13). In addition, TAFI can also cleave lysine and arginine from inflammatory mediators like complement-derived C3a and C5a, leading to inactivation (14, 15). Complement factors C3a and C5a can induce chemotaxis, adhesion, and aggregation of cells during inflammation. Therefore, TAFI could influence the outcome of severe infection not only by inhibiting fibrinolysis, but also by inactivating proinflammatory mediators (14). Knowledge of the role of TAFI in the host response to severe infection is highly limited. TAFI plasma concentrations were decreased in patients with evidence of coagulation activation in the setting of dengue hemorrhagic fever or other infections (16, 17) and in healthy humans injected with low dose endotoxin (18). In mice and rats, however, endotoxin administration rapidly up-regulated TAFI mRNA in the liver (19, 20) resulting in enhanced plasma TAFI activity after 24 h (19). Furthermore, a DNA polymorphism that increases TAFI stability and activity was associated with a 3.1-fold increased risk of death from meningococcal disease (21). The recent generation of TAFI –/– mice has enabled investigations of the physiological role of this glycoprotein in vivo (22, 23, 24). Remarkably, TAFI–/– mice do not display bleeding disorders or abnormal clotting tests. In addition, TAFI deficiency did not influence endotoxin-induced lethality in mice (22, 25). However, after LPS sensitization, TAFI–/– mice were highly susceptible to cobra venom factor, which activates and depletes the complement system, suggesting an important role of TAFI in complement inactivation in vivo (25). Thus far, the function of TAFI during sepsis induced by intact bacteria has not been investigated. Therefore, we here used TAFI–/– mice to determine the role of TAFI in the procoagulant, fibrinolytic, inflammatory, and antibacterial host responses during abdominal sepsis caused by Escherichia coli, one of the most frequently found pathogens in peritonitis (26).


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Animals

TAFI –/– mice (backcrossed six times to a C57BL/6 background) were generated as described previously (24). Age- and sex-matched C57BL/6 wild-type (Wt) mice were purchased from Harlan Sprague Dawley. The mice were kept on a 12 h light/dark cycle and received food and water ad libitum. TAFI–/– mice have undetectable TAFI mRNA, protein, and activity levels (24). TAFI deficiency has no effect on baseline levels of plasminogen (23), {alpha}2-antiplasmin, plasminogen activator inhibitor type I (27), fibrinogen, prothrombin time, activated partial thromboplastin time, and blood cell counts (22). The Institutional Animal Care and Use Committee approved all experiments.

Induction of peritonitis

Peritonitis was induced in 8- to 10-wk-old male Wt and TAFI–/– mice as described previously (28, 29, 30). In brief, E. coli O18:K1 was cultured in Luria-Bertani medium (Difco) at 37°C, harvested at mid-log phase, and washed twice with sterile saline before injection. Mice were injected i.p. with 1 x 104 CFU of E. coli O18:K1 in 200 µl of sterile isotonic saline.

Sample harvesting

At the time of sacrifice, mice were first anesthetized by inhalation of isoflurane (Abbott Laboratories). A peritoneal lavage was then performed with 5 ml of sterile isotonic saline using an 18-gauge needle, and peritoneal lavage fluid was collected in sterile tubes (Plastipack; BD Biosciences). After collection of peritoneal fluid, deeper anesthesia was induced by i.p. injection of 0.07 ml of FFM mixture (fentanyl (0.315 mg/ml)-fluanisone (10 mg/ml; Janssen), midazolam (5 mg/ml; Roche) per gram of body weight. The abdomen was opened, and blood was drawn from the vena cava inferior into a sterile syringe, transferred to tubes containing heparin, and immediately placed on ice. Thereafter, livers and lungs were harvested and processed for RNA isolation, histology and measurements of CFU, cytokines and myeloperoxidase (MPO).

Evaluation of mRNA levels by quantitative RT-PCR

Total RNA was isolated using the RNeasy Mini kit system (Qiagen) and treated with RQ1 RNase-Free DNase (Promega) and reverse-transcribed using oligo(dT) primer and Moloney murine leukemia virus reverse transcriptase (Invitrogen Life Technologies) according to recommendations of the suppliers. RT-PCRs were performed on cDNA samples that were 4-fold diluted in H2O using FastStart DNA Master SYBR Green I (Roche) with 2.5 mM MgCl2 in a LightCycler (Roche) apparatus. PCR conditions were: 5 min 95°C hot-start, followed by 40 cycles of amplification (95°C for 15 s, 60°C for 5 s, 72°C for 20 s). For quantification, standard curves were constructed by PCR on serial dilutions of a concentrated cDNA and data were analyzed using the LightCycler software as described by the manufacturer. Gene expression is presented as a ratio of the expression of the housekeeping gene {beta}2-microglobulin (31). All PCRs generated a single DNA product of the expected length as judged by evaluation on ethidium bromide-stained 1.2% agarose gel electrophoresis. Primers used for murine TAFI were mTAFI S633 TGGATTTCACCTGCTTTCTGT and mTAFI AS784 GGTTCTTCCTCCACATTCGAT. Primers for the housekeeping gene were mB2M S74 TGGTCTTTCTGGTGCTTGTCT and mB2M AS231 ATTTTTTTCCCGTTCTTCAGC. Oligonucleotides were derived from Eurogentec.

Assays

TAFI and thrombin-anti-thrombin complexes (TATc) were measured by mouse-specific ELISAs as described previously (24, 28, 32). Protein was measured by the bicinchoninic acid assay kit (Pierce). D-dimer was quantitated by a sandwich-type ELISA from Asserachrom D-dimer (Diagnostica Stago). Fibrin deposition in lungs and liver was determined by Western blot analysis as described previously (33, 34). Aspartate aminotransferase (ASAT) and alanine aminotransferase (ALAT) were determined with commercially available kits (Sigma-Aldrich), using a Hitachi analyzer (Roche) according to the manufacturer’s instructions. Levels of MPO in lung tissues were measured as described previously (35, 36). MIP-2 and keratinocyte-derived chemokine (KC) were measured by ELISAs according to the instructions of the manufacturer (R&D Systems). TNF-{alpha}, IL-6, and IL-10 were measured by cytometric bead array multiplex assay (BD Biosciences) in accordance with the manufacturer’s recommendations. For these cytokine measurements, livers were homogenized at 4°C in 5 volumes of sterile isotonic saline with a tissue homogenizer (Biospect Products), which was carefully cleaned and disinfected with 70% ethanol after each homogenization. The liver homogenates were lysed in lysis buffer (300 mM NaCl, 15 mM Tris [tris(hydroxymethyl)aminomethane], 2 mM MgCl, 2 mM Triton X-100, pepstatin A, leupeptin, and aprotinin (20 ng/ml) (pH 7.4)) on ice for 30 min and spun at 1500 x g at 4°C for 15 min. The supernatant was frozen at –20°C until assayed. Serum amyloid P was measured in plasma by a sandwich ELISA as described previously (37, 38).

Histology

Directly after sacrifice liver and lung samples were fixed with 4% formalin and embedded in paraffin. Paraffin sections (4-µm thick) were stained with H&E. All slides were coded and scored by a pathologist without knowledge of the strain of mice. The liver and lungs were scored according to the following parameters: 1) the number of thrombi counted in five fields at a magnification of x200 (lungs) or x100 (liver); 2) the presence and degree of inflammation, which included the interstitial influx of leukocytes and the presence of endothelialitis; 3) for liver only: the presence and degree of necrosis. Inflammation and hepatic necrosis were rated from 0 to 3, wherein 0 = absent, 1 = occasionally, 2 = regularly, 3 = massively. Granulocyte immunostaining was performed as described previously (39, 40). Granulocytes were counted in five random fields (magnification, x200).

Cell counts and differentials

Cell counts were determined in peritoneal lavage fluid using a hemacytometer (Beckman Coulter). Subsequently, the pellet was diluted in PBS to a final concentration of 105 cells/ml and differential cell counts were performed on cytospin preparations stained with a modified Giemsa stain (Diff-Quick; Dade Behring).

Determination of bacterial outgrowth

Lungs and livers were homogenized at 4°C in 5 volumes of sterile isotonic saline with a tissue homogenizer (Biospect Products) which was carefully cleaned and disinfected with 70% ethanol after each homogenization. Serial 10-fold dilutions in sterile saline were made from these homogenates, blood, and peritoneal lavage fluid, and 50-µl volumes were plated onto sheep-blood agar plates and incubated at 37°C and 5% CO2. CFU were counted after 16 h.

Statistical analysis

Differences between groups were calculated by using the Mann-Whitney U test. Values were expressed as means ± SE. A p value of <0.05 was considered statistically significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
TAFI is up-regulated during E. coli-induced abdominal sepsis

To determine whether TAFI expression changes during peritonitis, we measured TAFI mRNA in liver and lung samples at 0, 2, 6, and 20 h after i.p. injection of E. coli. We chose these time points for our experiments because they represent two stages in the clinical course of the disease: the beginning of the infection (2 and 6 h) without clinical symptoms and the end-stage of the infection (20 h) at which the mice are very ill. At 20 h after infection, TAFI mRNA was significantly increased in the livers of Wt mice (Fig. 1A; p < 0.05); in the lungs TAFI mRNA remained undetectable throughout. To investigate whether the increased TAFI expression resulted in a rise in protein levels we measured the concentration of TAFI Ag in liver homogenates, plasma, and peritoneal lavage fluid. In liver homogenates TAFI protein levels were slightly decreased at 2 h postinfection (nonsignificant); however, at 20 h postinfection TAFI levels were significantly up-regulated (Fig. 1B; p < 0.05). At 6 h after E. coli injection, plasma TAFI levels showed a decrease of 20% vs t = 0. However, after 20 h, TAFI levels were increased by 2.8-fold vs t = 0 (Fig. 1C; p < 0.01). TAFI remained undetectable in peritoneal lavage fluid at all time points.



View larger version (11K):
[in this window]
[in a new window]
 
FIGURE 1. Enhanced TAFI production during septic peritonitis. A, Liver TAFI mRNA expression was determined by RT-PCR. TAFI protein levels were measured by ELISA in liver homogenates (B) and plasma (C). Mice were injected i.p. with 104 CFU E. coli at t = 0 and were sacrificed before and 2, 6, and 20 h postinfection. Results are expressed as means ± SE of four mice per time point. *, p < 0.05; **, p < 0.01 vs t = 0.

 
TAFI deficiency does not influence the hemostatic response

Thrombin is a very important activator of TAFI and its levels rise during coagulation activation. Our group previously established that this model of abdominal sepsis is associated with thrombin generation and activation of the coagulation system (28). To determine the influence of TAFI hereon, we measured TATc levels in plasma of TAFI–/– and Wt mice before and 6 and 20 h after i.p. injection of E. coli. TATc concentrations were unchanged at 6 h postinfection when compared with uninfected mice (data not shown). At 20 h, TATc were significantly elevated in plasma of TAFI–/– and Wt mice; however, TATc levels were not different between the two mouse strains (Fig. 2A). TAFI can inhibit fibrinolysis by preventing the binding of plasminogen to fibrin and the subsequent facilitated conversion into the active protease plasmin (8, 13). To investigate whether the up-regulation of TAFI production during abdominal sepsis influenced the fibrinolytic activity, we measured D-dimer. Plasma D-dimer levels were strongly elevated at 20 h after E. coli injection, but no differences were observed between TAFI–/– and Wt mice (Fig. 2B). To measure the extent of fibrin deposition in liver and lung tissue in TAFI –/– and Wt mice, these organs were harvested before and at 20 h after the induction of E. coli infection. Western blot analysis for fibrin showed increased fibrin accumulation in liver and lung tissue in animals with peritonitis, but the extent of fibrin deposition did not differ between TAFI–/– and Wt mice (Fig. 3). Together, these data indicate that TAFI deficiency does not influence coagulation or fibrinolysis during E. coli sepsis.



View larger version (13K):
[in this window]
[in a new window]
 
FIGURE 2. TAFI deficiency does not influence the hemostatic response. Plasma TATc (A) and D-dimer (B) levels were measured by ELISA at 0 and 20 h postinfection. Mice were injected i.p. with 104 CFU E. coli at t = 0. Results are expressed as means ± SE of eight mice per time point. There were no statistical differences between both strains.

 


View larger version (12K):
[in this window]
[in a new window]
 
FIGURE 3. TAFI deficiency does not influence the extent of fibrin deposition in liver and lung tissue. Western blot was performed for fibrin deposition in liver and lung tissue of Wt and TAFI mice before and at 20 h after E. coli injection. Fibrin standards were used to quantify fibrin deposition. Data are means ± SE. There were no statistical differences between both strains.

 
TAFI-deficient mice are protected from liver damage

This experimental model of abdominal sepsis is associated with profound liver injury (28, 29, 30). Considering the strong expression of TAFI in the liver and the possible role of TAFI in fibrinolytic and inflammatory responses, which probably play a role in the induction of organ damage, we examined the influence of TAFI deficiency on liver damage 20 h postinfection. Upon histopathological examination, both TAFI–/– and Wt mice showed mild inflammation of liver tissue as characterized by the influx of leukocytes into the hepatic parenchyma (Fig. 4, A and B). The numbers of infiltrating granulocytes (as determined by immunostaining of liver sections) were similar in TAFI–/– and Wt mice (Fig. 4C), indicating that TAFI deficiency did not impact on the extent of hepatic inflammation. In accordance with our previous investigations (28, 29, 30), all Wt mice showed foci of liver necrosis, which were predominantly localized in the midlobular region of the liver lobule, whereas the periportal area was unaffected (Fig. 4A, arrows). Remarkably, only 42% of TAFI–/– mice had any sign of liver necrosis (Fig. 4B, arrows). Furthermore, the extent of liver necrosis (quantified according to the scoring system described in Materials and Methods) was also markedly reduced in TAFI–/– mice (Fig. 4D; p < 0.05). The relative protection of TAFI–/– mice against liver necrosis was confirmed by clinical chemistry, i.e., TAFI–/– mice had lower plasma levels of ALAT and ASAT compared with Wt mice (Fig. 4E).



View larger version (90K):
[in this window]
[in a new window]
 
FIGURE 4. TAFI–/– mice are protected from liver necrosis. Livers were harvested at 20 h after i.p. injection of 104 CFU E. coli. Representative HE stainings of liver sections from Wt (A) and TAFI–/– (B) mice are shown. Arrows point out the necrotic areas. Original magnification, x100. C, Granulocyte stainings of liver sections were performed and the numbers of neutrophils per five random microscopic fields were counted. Magnification, x200. D, Graphical representation of the degree of liver necrosis determined according to the scoring system described in Materials and Methods. E, Plasma concentrations of ASAT and ALAT were measured at the same time point. Data are expressed in units per liter (U/L). Data are means ± SE of eight mice per genotype. *, p < 0.05 vs Wt mice.

 
TAFI deficiency does not influence lung inflammation

To obtain insight into the role of TAFI in the development of inflammation in another organ even more susceptible to inflammation-induced injury, lungs were harvested at 20 h after the induction of E. coli infection. Lungs showed clear signs of inflammation in both TAFI–/– and Wt mice, as reflected by accumulation of leukocytes in the interstitium (Fig. 5, A and B). Histological scores were similar in both strains (Fig. 5C). Granulocyte stainings of lung tissues revealed a similarly strong accumulation of neutrophils in lungs of both mouse strains (data not shown). In line, MPO levels in lung homogenates were similar in TAFI–/– and Wt mice before and at 6 and 20 h postinfection (Fig. 5D). Thus, TAFI deficiency did not influence the inflammatory response in the lung during E. coli sepsis.



View larger version (87K):
[in this window]
[in a new window]
 
FIGURE 5. No difference in pulmonary inflammation. Representative HE stainings of lung tissue at 20 h after i.p. injection of 104 CFU E. coli in Wt (A) and TAFI–/– (B) mice. Original magnification, x200. C, Graphical representation of the degree of lung inflammation at the same time point, determined according to the scoring system described in Materials and Methods. D, Myeloperoxidase (MPO) activity levels in lung tissues were determined before and at 6 and 20 h postinfection. Data are means ± SE of eight mice per genotype. There were no statistical differences in lung inflammation between both strains.

 
TAFI deficiency enhances neutrophil recruitment to the peritoneal cavity

The recruitment of leukocytes to the site of an infection is an essential part of the host defense to invading bacteria. Therefore, we determined leukocyte counts and differentials in peritoneal lavage fluid 6 and 20 h after E. coli injection in TAFI–/– and Wt mice. Peritonitis was associated with a profound rise in the number of cells in the peritoneal lavage fluid, which was mainly the result of neutrophil influx into the peritoneal cavity. TAFI–/– mice had two times higher neutrophil counts in their peritoneal fluid than Wt mice at 20 h postinfection (Table I; p < 0.05).


View this table:
[in this window]
[in a new window]
 
Table I. TAFI deficiency results in an enhanced neutrophil recruitmenta

 
Chemokines, cytokines, and serum amyloid P

CXC chemokines play a role in the attraction of neutrophils to the site of inflammation. To investigate whether the increased neutrophil influx in TAFI–/– mice might be the result of an effect on local chemokine levels, the concentrations of MIP-2 and KC were measured in the peritoneal lavage fluid at 6 and 20 h after E. coli injection. However, MIP-2 or KC levels were similar in TAFI–/– and Wt mice at both time points (Table II). To determine whether TAFI influenced the local or systemic production of cytokines during septic peritonitis, TNF-{alpha}, IL-6, and IL-10 were measured in peritoneal lavage fluid, plasma, and liver homogenates. Cytokine levels in the peritoneal lavage fluid tended to be higher in TAFI–/– mice, but these differences did not reach statistical significance (Table II). At 6 h postinfection, TAFI–/– mice had significantly higher plasma levels of TNF-{alpha} and IL-6 compared with Wt mice (Table II; both p < 0.05); at 20 h plasma cytokine levels were similar in both mouse strains. There were no differences between the two mouse strains in plasma IL-10 levels at either time point (Table II). In liver homogenates, all cytokine concentrations were similar on both time points (Table II). To examine whether the acute phase protein response was influenced by the difference in early IL-6 levels between TAFI–/– and Wt mice during E. coli-induced abdominal sepsis, we measured the murine acute phase protein serum amyloid P in plasma at 20 h postinfection. Circulating serum amyloid P concentrations were increased in both strains but much higher in TAFI–/– mice than in Wt mice (Table II).


View this table:
[in this window]
[in a new window]
 
Table II. Chemokine and cytokine concentrationsa

 
TAFI deficiency is associated with a transiently enhanced bacterial outgrowth

To determine whether TAFI influences antibacterial host defense, we compared the bacterial load in peritoneal lavage fluid, blood, and liver of TAFI–/– and Wt mice at 6 and 20 h postinfection. At 6 h, TAFI–/– mice had more bacteria in their peritoneal lavage fluid and blood than Wt mice (Fig. 6; p < 0.05), whereas the bacterial loads in liver tended to be higher in TAFI–/– mice (not significant). After 20 h, bacterial loads had increased strongly in both mouse strains and no significant differences in the number of E. coli CFU existed anymore between TAFI–/– and Wt mice (Fig. 6).



View larger version (14K):
[in this window]
[in a new window]
 
FIGURE 6. Bacterial outgrowth. Bacterial outgrowth in peritoneal lavage fluid, blood, and liver in Wt ({square}) and TAFI–/– ({blacksquare}) mice, at 6 and 20 h after i.p. injection with 104 CFU E. coli. Eight mice per genotype were used at each time point. *, p < 0.05 vs Wt at the same time point.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The clinical syndrome of sepsis is the result of a systemic response of the host to a severe infection, characterized by the concurrent activation of various mediator systems. TAFI is a carboxypeptidase B-type enzyme that may function as an important regulator at the crossroad of coagulation, fibrinolysis, and inflammation. We here determined the role of endogenous TAFI in the host response to abdominal sepsis induced by i.p. injection of E. coli. In contrast to its presumptive role as a natural inhibitor of fibrinolysis, TAFI appeared to have no part in the procoagulant or fibrinolytic response to Gram-negative sepsis. Instead, the present investigation links the local production of TAFI in the liver with the occurrence of hepatic necrosis, as indicated by abundant expression of TAFI mRNA and protein in the livers of Wt mice and a strongly reduced occurrence and severity of hepatic necrosis in TAFI–/– mice. Furthermore, we show for the first time a role for TAFI in inflammatory cell recruitment to the site of infection in vivo, because the TAFI–/– mice had a markedly increased number of inflammatory cells in their peritoneal cavity.

TAFI mRNA is strongly expressed in the liver of humans, mice, and rats (7, 19, 20). Hepatic TAFI mRNA expression rapidly increased after endotoxin administration to rodents (19, 20) and TAFI plasma levels were elevated during peritonitis induced by cecal ligation and puncture in rats (41). In line with these previous studies, we found that TAFI mRNA was expressed in the liver and became up-regulated during E. coli-induced peritonitis, which was accompanied by elevated TAFI protein levels in liver and plasma. In humans, TAFI protein levels vary in different diseases. In contrast to murine sepsis, decreased TAFI levels have been found during infections in humans (16, 17), which might be the consequence of enhanced consumption. Furthermore, in healthy humans exposed to low dose endotoxin circulating TAFI levels decreased 16% relative to baseline (18). We found a decrease of 20% in the early phase after infection. However, later on plasma TAFI levels showed a profound rise of 2.8-fold relative to baseline. Possibly, the low-grade human endotoxemia model was too mild to induce this secondary increase in TAFI concentrations; otherwise, it is possible that the response differs between humans and mice. Of note, TAFI plasma levels were elevated and correlated with acute phase proteins in other noninfectious human diseases, including inflammatory diseases like inflammatory bowel diseases, Reiter’s syndrome, Behcet’s syndrome, and celiac disease (42, 43), and also during coronary artery disease (44) and ischemic stroke (45).

In line with previous findings (28), E. coli peritonitis was associated with activation of the coagulation system as reflected by a rise in TATc concentrations in plasma, and increased fibrin deposition in liver and lungs. Although TAFI deficiency is not expected to influence TATc levels, it would impact on fibrin deposition if TAFI plays a significant role as an inhibitor of fibrinolysis in sepsis in vivo. In vitro, activated TAFI can inhibit plasmin formation by removing the plasminogen binding sites on fibrin, an effect by which it might promote thrombus formation. In accordance, previous in vivo studies have shown that activated TAFI plays an important role in the susceptibility of a clot to lysis, i.e., inhibitors of active TAFI increased endogenous thrombolysis in experimental jugular vein and arterial thrombolysis models in mice and rabbits (46, 47, 48). Furthermore, increased TAFI Ag levels are associated with a mild risk for thrombosis (48). Surprisingly, TAFI–/– mice did not show any differences in venous or arterial thrombosis models or in mortality induced by acute pulmonary thromboembolism or LPS-induced disseminated intravascular coagulation (22, 23, 24). In line, our study demonstrates that during abdominal sepsis TAFI–/– mice display an unaltered activation of the fibrinolytic system as reflected by the plasma levels of D-dimer and did not show a decreased tendency to form fibrin depositions in either liver or lungs. Together, these data strongly argue against an important role for endogenous TAFI as regulator of the procoagulant-fibrinolytic balance in sepsis.

Surprisingly, TAFI–/– mice showed significantly less and smaller foci of liver necrosis and decreased plasma transaminase levels indicating less hepatocellular injury. These data suggest that TAFI deficiency protects against sepsis-induced liver necrosis and possibly explain the distribution pattern of foci within the liver of Wt mice, which coincides with the lobular distribution pattern of TAFI mRNA, showing highest expression in the pericentral and midlobular area of the liver unit (49). The periportal area, in which TAFI expression is low or even absent, was protected from sepsis-induced liver injury. Because TAFI deficiency was not accompanied with changes in fibrinolytic or coagulant responses in our model, these differences in liver necrosis seem independent of TAFI’s anti-fibrinolytic properties. Campbell et al. (14, 15) established that TAFI can remove arginine from the C terminus of C3a and C5a, which inactivates these complement factors. Interestingly, recent studies using C3a and C5a gene-deficient mice have shown that these complement factors play a very important protective role in acute liver necrosis induced by carbon tetrachloride or partial hepatectomy (50, 51, 52). Because TAFI-deficient mice might have a higher C3a and C5a activity, this could play a role in their relative protection from liver necrosis in our model. To directly demonstrate an effect of TAFI deficiency on complement, analytical separation of intact C5a and C3a from C5a and C3a that lack an arginine residue would be required; mere measurement of these complement factors by ELISA would not suffice. Unfortunately, at present the technique required for such analyses is not operational in our laboratory. In addition, we are currently not able to reliably measure complement activity in mice. Besides complement products, cytokines, including TNF and IL-6, have been implicated as mediators of liver inflammation and injury (53); however, the concentrations of TNF and IL-6 did not differ in liver homogenates prepared from TAFI–/– and Wt mice after induction of abdominal sepsis. More studies are needed to investigate the mechanism by which TAFI impacts on liver injury during sepsis.

Peritonitis is characterized by recruitment of leukocytes to the site of infection (28, 29, 30). TAFI is able to inactivate complement-derived inflammatory peptides C5a and C3a, which are involved in leukocyte chemotaxis (14, 15). Furthermore, an increased number of leukocytes was found in the peritoneal cavity after i.p. injection of thioglycolate in TAFI–/– mice superimposed on a partial plasminogen-deficient setting (23). We found that neutrophil influx into the peritoneal cavity was markedly increased in TAFI–/– mice at 20 h after infection. Besides neutrophils, C5a is also able to attract macrophages and lymphocytes (54, 55). In our study, the numbers of macrophages and lymphocytes were also increased in TAFI–/– mice compared with Wt mice; however; this difference was not significantly different. This is the first in vivo evidence of a specific role of TAFI in the attraction of leukocytes to the site of an infection. It has been suggested that TAFI might play a protective role during Gram-negative sepsis by preventing hyperreactivity of the inflammatory response and subsequent septic shock (15). However, we found no effect of TAFI deficiency on the inflammatory responses in the liver and lungs.

Because the inflammatory response of phagocytic cells can influence antibacterial host defense, we investigated the bacterial outgrowth in both genotypes. We found an increased bacterial load in peritoneal lavage fluid and blood in TAFI–/– mice at 6 h after E. coli injection. A clear explanation for this finding is lacking; it cannot be explained by differences in the inflammatory response because the cellular influx to the peritoneal cavity was similar at that time point. Possibly, TAFI contributes to fibrin-mediated i.p. adhesion formation, which can wall off the infection and prevent early local and systemic bacterial spread (56, 57, 58). The difference in bacterial load disappeared after 20 h, probably due to the overwhelming local and systemic bacterial outgrowth overruling the modest effect of TAFI. Considering that there is no evidence that TAFI can influence cytokine production, the elevated plasma levels of TNF-{alpha} and IL-6 in TAFI–/– mice at 6 h postinfection were most likely the consequence of the presence of an increased bacterial load in blood, providing a more potent proinflammatory stimulus.

Intraperitoneal administration of E. coli results in a paradigm that resembles the clinical condition commonly associated with septic peritonitis, with diaphragmatic lymphatic clearance, systemic bacteremia, and profound activation of coagulation and inflammation (28, 29, 30, 59). To our knowledge this is the first study to show an in vivo role for TAFI in a bacterial sepsis model. We demonstrate that TAFI does not play a role in facilitating the development of fibrin depositions in organs during E. coli- induced septic peritonitis. Rather, the enhanced production of TAFI in the liver during abdominal sepsis significantly contributed to the occurrence of hepatocellular necrosis. These data point to a thus far undiscovered function of endogenous TAFI in the liver during severe bacterial infection.


    Acknowledgments
 
We thank Joost Daalhuisen and Anita de Boer for providing expert technical assistance.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by a grant from The Netherlands Heart Foundation (No. 2001B114) (to R.R.) and a grant from The Netherlands Organization for Health Research and Development to S.A.J.t.H. (No. 920-03-213). Back

2 Address correspondence and reprint requests to Dr. Rosemarijn Renckens, Laboratory of Experimental Internal Medicine, Academic Medical Center, Room G2-132, Meibergdreef 9, 1105 AZ Amsterdam, The Netherlands. E-mail address: r.renckens{at}amc.uva.nl Back

3 Abbreviations used in this paper: TAFI, thrombin-activatable fibrinolysis inhibitor; Wt, wild type; MPO, myeloperoxidase; TATc, thrombin-anti-thrombin complex; ASAT, aspartate aminotransferase; ALAT, alanine aminotransferase; KC, keratinocyte-derived chemokine. Back

Received for publication June 16, 2005. Accepted for publication September 14, 2005.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Holzheimer, R. G., K. H. Muhrer, N. L’Allemand, T. Schmidt, K. Henneking. 1991. Intraabdominal infections: classification, mortality, scoring and pathophysiology. Infection 19:447.-452. [Medline]
  2. Levi, M., H. Ten Cate. 1999. Disseminated intravascular coagulation. N. Engl. J. Med. 341:586.-592. [Free Full Text]
  3. Tapper, H., H. Herwald. 2000. Modulation of hemostatic mechanisms in bacterial infectious diseases. Blood 96:2329.-2337. [Free Full Text]
  4. Levi, M., T. van der Poll, H. R. Buller. 2004. Bidirectional relation between inflammation and coagulation. Circulation 109:2698.-2704. [Free Full Text]
  5. Hendriks, D., S. Scharpe, M. van Sande, M. P. Lommaert. 1989. Characterisation of a carboxypeptidase in human serum distinct from carboxypeptidase N. J. Clin. Chem. Clin. Biochem. 27:277.-285. [Medline]
  6. Campbell, W., H. Okada. 1989. An arginine specific carboxypeptidase generated in blood during coagulation or inflammation which is unrelated to carboxypeptidase N or its subunits. Biochem. Biophys. Res. Commun. 162:933.-939. [Medline]
  7. Eaton, D. L., B. E. Malloy, S. P. Tsai, W. Henzel, D. Drayna. 1991. Isolation, molecular cloning, and partial characterization of a novel carboxypeptidase B from human plasma. J. Biol. Chem. 266:21833.-21838. [Abstract/Free Full Text]
  8. Bajzar, L., R. Manuel, M. E. Nesheim. 1995. Purification and characterization of TAFI, a thrombin-activable fibrinolysis inhibitor. J. Biol. Chem. 270:14477.-14484. [Abstract/Free Full Text]
  9. Bajzar, L., J. Morser, M. Nesheim. 1996. TAFI, or plasma procarboxypeptidase B, couples the coagulation and fibrinolytic cascades through the thrombin-thrombomodulin complex. J. Biol. Chem. 271:16603.-16608. [Abstract/Free Full Text]
  10. Wang, W., D. F. Hendriks, S. S. Scharpe. 1994. Carboxypeptidase U, a plasma carboxypeptidase with high affinity for plasminogen. J. Biol. Chem. 269:15937.-15944. [Abstract/Free Full Text]
  11. Tan, A. K., D. L. Eaton. 1995. Activation and characterization of procarboxypeptidase B from human plasma. Biochemistry 34:5811.-5816. [Medline]
  12. Kawamura, T., N. Okada, H. Okada. 2002. Elastase from activated human neutrophils activates procarboxypeptidase R. Microbiol. Immunol. 46:225.-230. [Medline]
  13. Redlitz, A., A. K. Tan, D. L. Eaton, E. F. Plow. 1995. Plasma carboxypeptidases as regulators of the plasminogen system. J. Clin. Invest. 96:2534.-2538.
  14. Campbell, W. D., E. Lazoura, N. Okada, H. Okada. 2002. Inactivation of C3a and C5a octapeptides by carboxypeptidase R and carboxypeptidase N. Microbiol. Immunol. 46:131.-134. [Medline]
  15. Campbell, W., N. Okada, H. Okada. 2001. Carboxypeptidase R is an inactivator of complement-derived inflammatory peptides and an inhibitor of fibrinolysis. Immunol. Rev. 180:162.-167. [Medline]
  16. van Gorp, E. C., M. C. Minnema, C. Suharti, A. T. Mairuhu, D. P. Brandjes, H. ten Cate, C. E. Hack, J. C. Meijers. 2001. Activation of coagulation factor XI, without detectable contact activation in dengue haemorrhagic fever. Br. J. Haematol. 113:94.-99. [Medline]
  17. Watanabe, R., H. Wada, Y. Watanabe, M. Sakakura, T. Nakasaki, Y. Mori, M. Nishikawa, E. C. Gabazza, T. Nobori, H. Shiku. 2001. Activity and antigen levels of thrombin-activatable fibrinolysis inhibitor in plasma of patients with disseminated intravascular coagulation. Thromb. Res. 104:1.-6. [Medline]
  18. Verbon, A., J. C. Meijers, C. A. Spek, C. E. Hack, J. P. Pribble, T. Turner, P. E. Dekkers, T. Axtelle, M. Levi, S. J. van Deventer, et al 2003. Effects of IC14, an anti-CD14 antibody, on coagulation and fibrinolysis during low-grade endotoxemia in humans. J. Infect. Dis. 187:55.-61. [Medline]
  19. Sato, T., T. Miwa, H. Akatsu, N. Matsukawa, K. Obata, N. Okada, W. Campbell, H. Okada. 2000. Pro-carboxypeptidase R is an acute phase protein in the mouse, whereas carboxypeptidase N is not. J. Immunol. 165:1053.-1058. [Abstract/Free Full Text]
  20. Kato, T., H. Akatsu, T. Sato, S. Matsuo, T. Yamamoto, W. Campbell, N. Hotta, N. Okada, H. Okada. 2000. Molecular cloning and partial characterization of rat procarboxypeptidase R and carboxypeptidase N. Microbiol. Immunol. 44:719.-728. [Medline]
  21. Kremer Hovinga, J. A., R. F. Franco, M. A. Zago, H. Ten Cate, R. G. Westendorp, P. H. Reitsma. 2004. A functional single nucleotide polymorphism in the thrombin-activatable fibrinolysis inhibitor (TAFI) gene associates with outcome of meningococcal disease. J. Thromb. Haemost. 2:54.-57. [Medline]
  22. Nagashima, M., Z. F. Yin, L. Zhao, K. White, Y. Zhu, N. Lasky, M. Halks-Miller, G. J. Broze, Jr, W. P. Fay, J. Morser. 2002. Thrombin-activatable fibrinolysis inhibitor (TAFI) deficiency is compatible with murine life. J. Clin. Invest. 109:101.-110. [Medline]
  23. Swaisgood, C. M., D. Schmitt, D. Eaton, E. F. Plow. 2002. In vivo regulation of plasminogen function by plasma carboxypeptidase B. J. Clin. Invest. 110:1275.-1282. [Medline]
  24. te Velde, E. A., G. T. Wagenaar, A. Reijerkerk, M. Roose-Girma, I. H. Borel Rinkes, E. E. Voest, B. N. Bouma, M. F. Gebbink, J. C. Meijers. 2003. Impaired healing of cutaneous wounds and colonic anastomoses in mice lacking thrombin-activatable fibrinolysis inhibitor. J. Thromb. Haemost. 1:2087.-2096. [Medline]
  25. Asai, S., T. Sato, T. Tada, T. Miyamoto, N. Kimbara, N. Motoyama, H. Okada, N. Okada. 2004. Absence of procarboxypeptidase R induces complement-mediated lethal inflammation in lipopolysaccharide-primed mice. J. Immunol. 173:4669.-4674. [Abstract/Free Full Text]
  26. McClean, K. L., G. J. Sheehan, G. K. Harding. 1994. Intraabdominal infection: a review. Clin. Infect. Dis. 19:100.-116. [Medline]
  27. Reijerkerk, A., J. C. Meijers, S. R. Havik, B. N. Bouma, E. E. Voest, M. F. Gebbink. 2004. Tumor growth and metastasis are not affected in thrombin-activatable fibrinolysis inhibitor-deficient mice. J. Thromb. Haemost. 2:769.-779. [Medline]
  28. Weijer, S., S. H. Schoenmakers, S. Florquin, M. Levi, G. P. Vlasuk, W. E. Rote, P. H. Reitsma, C. A. Spek, T. van der Poll. 2004. Inhibition of the tissue factor/factor VIIa pathway does not influence the inflammatory or antibacterial response to abdominal sepsis induced by Escherichia coli in mice. J. Infect. Dis. 189:2308.-2317. [Medline]
  29. Sewnath, M. E., D. P. Olszyna, R. Birjmohun, F. J. ten Kate, D. J. Gouma, T. van Der Poll. 2001. IL-10-deficient mice demonstrate multiple organ failure and increased mortality during Escherichia coli peritonitis despite an accelerated bacterial clearance. J. Immunol. 166:6323.-6331. [Abstract/Free Full Text]
  30. van Westerloo, D. J., I. A. Giebelen, S. Florquin, J. Daalhuisen, M. J. Bruno, A. F. de Vos, K. J. Tracey, T. van der Poll. 2005. The cholinergic anti-inflammatory pathway regulates the host response during septic peritonitis. J. Infect. Dis. 191:2138.-2148. [Medline]
  31. Lupberger, J., K. A. Kreuzer, G. Baskaynak, U. R. Peters, P. le Coutre, C. A. Schmidt. 2002. Quantitative analysis of {beta}-actin, {beta}-2-microglobulin and porphobilinogen deaminase mRNA and their comparison as control transcripts for RT-PCR. Mol. Cell Probes 16:25.-30. [Medline]
  32. Rijneveld, A. W., S. Weijer, S. Florquin, C. T. Esmon, J. C. Meijers, P. Speelman, P. H. Reitsma, H. Ten Cate, T. van der Poll. 2004. Thrombomodulin mutant mice with a strongly reduced capacity to generate activated protein C have an unaltered pulmonary immune response to respiratory pathogens and lipopolysaccharide. Blood 103:1702.-1709. [Abstract/Free Full Text]
  33. Weiler-Guettler, H., P. D. Christie, D. L. Beeler, A. M. Healy, W. W. Hancock, H. Rayburn, J. M. Edelberg, R. D. Rosenberg. 1998. A targeted point mutation in thrombomodulin generates viable mice with a prethrombotic state. J. Clin. Invest. 101:1983.-1991. [Medline]
  34. ter Horst, S. A., G. T. Wagenaar, E. de Boer, M. A. van Gastelen, J. C. Meijers, B. J. Biemond, B. J. Poorthuis, F. J. Walther. 2004. Pentoxifylline reduces fibrin deposition and prolongs survival in neonatal hyperoxic lung injury. J. Appl. Physiol. 97:2014.-2019. [Abstract/Free Full Text]
  35. Lichtman, S. N., J. Wang, B. Hummel, S. Lacey, R. B. Sartor. 1998. A rat model of ileal pouch-rectal anastomosis. Inflamm. Bowel. Dis. 4:187.-195. [Medline]
  36. Knapp, S., J. C. Leemans, S. Florquin, J. Branger, N. A. Maris, J. Pater, N. van Rooijen, T. van der Poll. 2003. Alveolar macrophages have a protective antiinflammatory role during murine pneumococcal pneumonia. Am. J. Respir. Crit. Care Med. 167:171.-179. [Abstract/Free Full Text]
  37. Van Molle, W., T. Hochepied, P. Brouckaert, C. Libert. 2000. The major acute-phase protein, serum amyloid P component, in mice is not involved in endogenous resistance against tumor necrosis factor {alpha}-induced lethal hepatitis, shock, and skin necrosis. Infect. Immun. 68:5026.-5029. [Abstract/Free Full Text]
  38. Renckens, R., J. J. Roelofs, V. de Waard, S. Florquin, H. R. Lijnen, P. Carmeliet, T. van der Poll. 2005. The role of plasminogen activator inhibitor type 1 in the inflammatory response to local tissue injury. J. Thromb. Haemost. 3:1018.-1025. [Medline]
  39. Rijneveld, A. W., M. Levi, S. Florquin, P. Speelman, P. Carmeliet, T. van Der Poll. 2002. Urokinase receptor is necessary for adequate host defense against pneumococcal pneumonia. J. Immunol. 168:3507.-3511. [Abstract/Free Full Text]
  40. Leemans, J. C., M. J. Vervoordeldonk, S. Florquin, K. van Kessel, T. van der Poll. 2002. Differential role of interleukin-6 in lung inflammation induced by lipoteichoic acid and peptidoglycan from Staphylococcus aureus. Am. J. Respir. Crit. Care Med. 165:1445.-1450. [Abstract/Free Full Text]
  41. Ravindranath, T. M., M. Goto, M. Demir, M. Tobu, M. F. Kujawski, D. Hoppensteadt, V. Samonte, O. Iqbal, M. M. Sayeed, J. Fareed. 2004. Tissue factor pathway inhibitor and thrombin activatable fibrinolytic inhibitor plasma levels following burn and septic injuries in rats. Clin. Appl. Thromb. Hemost. 10:379.-385. [Abstract/Free Full Text]
  42. Saibeni, S., B. Bottasso, L. Spina, M. Bajetta, S. Danese, A. Gasbarrini, R. de Franchis, M. Vecchi. 2004. Assessment of thrombin-activatable fibrinolysis inhibitor (TAFI) plasma levels in inflammatory bowel diseases. Am. J. Gastroenterol. 99:1966.-1970. [Medline]
  43. Donmez, A., K. Aksu, H. A. Celik, G. Keser, S. Cagirgan, S. B. Omay, V. Inal, H. H. Aydin, M. Tombuloglu, E. Doganavsargil. 2005. Thrombin activatable fibrinolysis inhibitor in Behcet’s disease. Thromb. Res. 115:287.-292. [Medline]
  44. Schroeder, V., T. Chatterjee, H. Mehta, S. Windecker, T. Pham, N. Devantay, B. Meier, H. P. Kohler. 2002. Thrombin activatable fibrinolysis inhibitor (TAFI) levels in patients with coronary artery disease investigated by angiography. Thromb. Haemost. 88:1020.-1025. [Medline]
  45. Montaner, J., M. Ribo, J. Monasterio, C. A. Molina, J. Alvarez-Sabin. 2003. Thrombin-activable fibrinolysis inhibitor levels in the acute phase of ischemic stroke. Stroke 34:1038.-1040. [Abstract/Free Full Text]
  46. Minnema, M. C., P. W. Friederich, M. Levi, P. A. von dem Borne, L. O. Mosnier, J. C. Meijers, B. J. Biemond, C. E. Hack, B. N. Bouma, H. ten Cate. 1998. Enhancement of rabbit jugular vein thrombolysis by neutralization of factor XI. In vivo evidence for a role of factor XI as an anti-fibrinolytic factor. J. Clin. Invest. 101:10.-14. [Medline]
  47. Nagashima, M., M. Werner, M. Wang, L. Zhao, D. R. Light, R. Pagila, J. Morser, P. Verhallen. 2000. An inhibitor of activated thrombin-activatable fibrinolysis inhibitor potentiates tissue-type plasminogen activator-induced thrombolysis in a rabbit jugular vein thrombolysis model. Thromb. Res. 98:333.-342. [Medline]
  48. van Tilburg, N. H., F. R. Rosendaal, R. M. Bertina. 2000. Thrombin activatable fibrinolysis inhibitor and the risk for deep vein thrombosis. Blood 95:2855.-2859. [Abstract/Free Full Text]
  49. Marx, P. F., G. T. Wagenaar, A. Reijerkerk, M. J. Tiekstra, A. G. van Rossum, M. F. Gebbink, J. C. Meijers. 2000. Characterization of mouse thrombin-activatable fibrinolysis inhibitor. Thromb. Haemost. 83:297.-303. [Medline]
  50. Mastellos, D., J. C. Papadimitriou, S. Franchini, P. A. Tsonis, J. D. Lambris. 2001. A novel role of complement: mice deficient in the fifth component of complement (C5) exhibit impaired liver regeneration. J. Immunol. 166:2479.-2486. [Abstract/Free Full Text]
  51. Markiewski, M. M., D. Mastellos, R. Tudoran, R. A. DeAngelis, C. W. Strey, S. Franchini, R. A. Wetsel, A. Erdei, J. D. Lambris. 2004. C3a and C3b activation products of the third component of complement (C3) are critical for normal liver recovery after toxic injury. J. Immunol. 173:747.-754. [Abstract/Free Full Text]
  52. Strey, C. W., M. Markiewski, D. Mastellos, R. Tudoran, L. A. Spruce, L. E. Greenbaum, J. D. Lambris. 2003. The proinflammatory mediators C3a and C5a are essential for liver regeneration. J. Exp. Med. 198:913.-923. [Abstract/Free Full Text]
  53. Ramadori, G., T. Armbrust. 2001. Cytokines in the liver. Eur. J. Gastroenterol. Hepatol. 13:777.-784. [Medline]
  54. Bianco, C., O. Gotze, Z. A. Cohn. 1979. Regulation of macrophage migration by products of the complement system. Proc. Natl. Acad. Sci. USA 76:888.-891. [Abstract/Free Full Text]
  55. Kopf, M., B. Abel, A. Gallimore, M. Carroll, M. F. Bachmann. 2002. Complement component C3 promotes T-cell priming and lung migration to control acute influenza virus infection. Nat. Med. 8:373.-378. [Medline]
  56. Ahrenholz, D. H., R. L. Simmons. 1980. Fibrin in peritonitis. I. Beneficial and adverse effects of fibrin in experimental E. coli peritonitis. Surgery 88:41.-47. [Medline]
  57. Dunn, D. L., R. L. Simmons. 1982. Fibrin in peritonitis. III. The mechanism of bacterial trapping by polymerizing fibrin. Surgery 92:513.-519. [Medline]
  58. Rotstein, O. D.. 1992. Role of fibrin deposition in the pathogenesis of intraabdominal infection. Eur. J. Clin. Microbiol. Infect. Dis. 11:1064.-1068. [Medline]
  59. Fink, M. P., S. O. Heard. 1990. Laboratory models of sepsis and septic shock. J. Surg. Res. 49:186.-196. [Medline]



This article has been cited by other articles:


Home page
Am. J. Respir. Crit. Care Med.Home page
M. A. D. van Zoelen, T. Vogl, D. Foell, S. Q. Van Veen, J. W. O. van Till, S. Florquin, M. W. Tanck, X. Wittebole, P.-F. Laterre, M. A. Boermeester, et al.
Expression and Role of Myeloid-related Protein-14 in Clinical and Experimental Sepsis
Am. J. Respir. Crit. Care Med., December 1, 2009; 180(11): 1098 - 1106.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Okumura, T. Koh, Y. Hasebe, T. Seki, and T. Ariga
A Novel Function of Thrombin-activatable Fibrinolysis Inhibitor during Rat Liver Regeneration and in Growth-promoted Hepatocytes in Primary Culture
J. Biol. Chem., June 12, 2009; 284(24): 16553 - 16561.
[Abstract] [Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
J. J. T. H. Roelofs, K. M. A. Rouschop, G. J. D. Teske, G. T. M. Wagenaar, N. Claessen, J. J. Weening, T. van der Poll, and S. Florquin
Endogenous tissue-type plasminogen activator is protective during ascending urinary tract infection
Nephrol. Dial. Transplant., March 1, 2009; 24(3): 801 - 808.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
R. Sood, L. Sholl, B. Isermann, M. Zogg, S. R. Coughlin, and H. Weiler
Maternal Par4 and platelets contribute to defective placenta formation in mouse embryos lacking thrombomodulin
Blood, August 1, 2008; 112(3): 585 - 591.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. M. Binette, F. B. Taylor Jr, G. Peer, and L. Bajzar
Thrombin-thrombomodulin connects coagulation and fibrinolysis: more than an in vitro phenomenon
Blood, November 1, 2007; 110(9): 3168 - 3175.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. Nishimura, T. Myles, A. M. Piliposky, P. N. Kao, G. J. Berry, and L. L. K. Leung
Thrombin-activatable procarboxypeptidase B regulates activated complement C5a in vivo
Blood, March 1, 2007; 109(5): 1992 - 1997.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Knapp, U. Matt, N. Leitinger, and T. van der Poll
Oxidized Phospholipids Inhibit Phagocytosis and Impair Outcome in Gram-Negative Sepsis In Vivo
J. Immunol., January 15, 2007; 178(2): 993 - 1001.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
L. O. Mosnier and B. N. Bouma
Regulation of Fibrinolysis by Thrombin Activatable Fibrinolysis Inhibitor, an Unstable Carboxypeptidase B That Unites the Pathways of Coagulation and Fibrinolysis
Arterioscler Thromb Vasc Biol, November 1, 2006; 26(11): 2445 - 2453.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Renckens, R.
Right arrow Articles by van der Poll, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Renckens, R.
Right arrow Articles by van der Poll, T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS