The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kao, C.-Y.
Right arrow Articles by Wu, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kao, C.-Y.
Right arrow Articles by Wu, R.
The Journal of Immunology, 2005, 175: 6676-6685.
Copyright © 2005 by The American Association of Immunologists

Up-Regulation of CC Chemokine Ligand 20 Expression in Human Airway Epithelium by IL-17 through a JAK-Independent but MEK/NF-{kappa}B-Dependent Signaling Pathway1

Cheng-Yuan Kao, Fei Huang, Yin Chen, Philip Thai, Shinichiro Wachi, Christy Kim, Lucinda Tam and Reen Wu2

Center for Comparative Respiratory Biology and Medicine, University of California, Davis, CA 95616


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
CCL20, like human {beta}-defensin (hBD)-2, is a potent chemoattractant for CCR6-positive immature dendritic cells and T cells in addition to recently found antimicrobial activities. We previously demonstrated that IL-17 is the most potent cytokine to induce an apical secretion and expression of hBD-2 by human airway epithelial cells, and the induction is JAK/NF-{kappa}B-dependent. Similar to hBD-2, IL-17 also induced CCL20 expression, but the nature of the induction has not been elucidated. Compared with a panel of cytokines (IL-1{alpha}, 1{beta}, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 18, IFN-{gamma}, GM-CSF, and TNF-{alpha}), IL-17 was as potent as IL-1{alpha}, 1{beta}, and TNF-{alpha}, with a time- and dose-dependent phenomenon in stimulating CCL20 expression in both well-differentiated primary human and mouse airway epithelial cell culture systems. The stimulation was largely dependent on the treatment of polarized epithelial cultures from the basolateral side with IL-17, achieving an estimated 4- to 10-fold stimulation at both message and protein levels. More than 90% of induced CCL20 secretion was toward the basolateral compartment (23.02 ± 1.11 ng/chamber/day/basolateral vs 1.82 ± 0.82 ng/chamber/day/apical). Actinomycin D experiments revealed that enhanced expression did not occur at mRNA stability. Inhibitor studies showed that enhanced expression was insensitive to inhibitors of JAK/STAT, p38, JNK, and PI3K signaling pathways, but sensitive to inhibitors of MEK1/2 and NF-{kappa}B activation, suggesting a MEK/NF-{kappa}B-based mechanism. These results suggest that IL-17 can coordinately up-regulate both hBD-2 and CCL20 expressions in airways through differentially JAK-dependent and -independent activations of NF-{kappa}B-based transcriptional mechanisms, respectively.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Innate immunity in respiratory tract epithelia is critical to eliminate pathogens efficiently and control infection in the lung. Respiratory tract epithelia, in addition to providing an anatomic barrier, secrete a variety of peptides, such as {beta}-defensins and chemokines, which act either directly or indirectly against invading pathogens (1). The chemokines are a group of small (<15 kDa) inducible, proinflammatory chemoattractant cytokines that interact with leukocytes via specific receptors to elicit the departure of leukocytes from the circulation and the infiltration to tissues at sites of immune challenge (2). Thus far, over 40 chemokines have been identified, and can be classified into four subfamilies based on the arrangement of cysteine residues (C, CC, CXC, or CX3C) (3).

CCL20 (4) or MIP-3{alpha}, also known as liver and activation-regulated chemokine and Exodus-1, is a CC chemokine that has antimicrobial activity comparable to {beta}-defensins (5). It has been shown that CCL20 and human {beta}-defensin-2 (hBD-2)3 share structural, functional, and regulatory properties (6). In a structural sense, they both include antiparallel {beta}-sheet core structures and the charge distribution is similar. CCL20 has been demonstrated in tracheobronchial airways (4). CCL20 is up-regulated by proinflammatory stimuli, such as IL-1{beta}, TNF-{alpha}, and LPS (7, 8, 9, 10, 11, 12). CCL20 is the only chemokine known to interact with CCR6, a property also shared with the antimicrobial {beta}-defensins (13). CCR6 has an important role in mediating dendritic cell localization and lymphocyte homeostasis in mucosal tissues (14). It has been suggested that through the local production of CCL20, immature dendritic cells, effector or memory CD4+ T lymphocytes, and B lymphocytes migrate to the site of inflammation to encounter the invading pathogens (15, 16). In airway epithelium, CCL20 expression by airway epithelium is inducible by TNF-{alpha}, IL-1{beta}, and Th2 cytokines (6, 17), and the level of CCL20 is significantly higher in bronchoalveolar lavage fluid (BALF) from patients with cystic fibrosis compared with BALF from healthy volunteers (6).

Our recent work established that IL-17-stimulated mucin genes MUC5AC and MUC5B (18) and hBD-2 (19) expressions in well-differentiated primary human tracheobronchial epithelial (TBE) cells. Through a gene expression profile analysis, we have also observed a similar stimulation of CCL20 transcript by IL-17 (19). Human IL-17 (or IL-17A) is exclusively expressed by activated CD4+ and CD8+ T memory cells, primarily of the prototypic CD45+RO+ subtype. In mouse lung, IL-17 is produced by CD4+ and CD8+ cells through IL-23-mediated and TLR4-dependent pathways (20). IL-17 stimulates the expression of proinflammatory and neutrophil-mobilizing cytokines, such as IL-1{beta}, IL-6, TNF-{alpha}, IL-8, MIP-2, growth-related oncogene, granulocyte chemotactic protein 2, and GM-CSF in rodent and human cells (21, 22). IL-17 has recently been shown as an important cytokine against the microbial infection in airways, and the levels of IL-17 were also significantly elevated in BALF of infected lung diseases and in allergic asthmatic airways (23).

In this communication, we set out to examine the effects of IL-17 and its signaling pathways that are potentially involved in the stimulation of CCL20 expression by well-differentiated primary human TBE cells. Similar to hBD-2 stimulation, we have found that IL-17 is as potent as TNF-{alpha} and IL-1{beta} in the stimulation of CCL20 expression, as compared with a panel of cytokines (IL-1{alpha}, 1{beta}, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 18, TNF-{alpha}, IFN-{gamma}, and GM-CSF). Moreover, we found that IL-17 may stimulate CCL20 expression via a JAK-independent but MEK/NF-{kappa}B activation-based transcriptional mechanism, when applied basally to the TBE cells. In contrast to an apical secretion of hBD-2 (19), >90% of stimulated CCL20 was basolaterally secreted by IL-17-treated TBE cells.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Reagents

Recombinant human IL-1{alpha}, 1{beta}, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 18, TNF-{alpha}, IFN-{gamma}, GM-CSF, and goat anti-IL-17RA Ab were purchased from R&D Systems. Mouse anti-p65 mAb was purchased from Santa Cruz Biotechnology. Helenalin, LY29402, U0126, SB203580, JNK inhibitor II, actinomycin D, and JAK inhibitor I were purchased from Calbiochem-Novabiochem.

Cell culture from human and mouse airway tissues

Human tracheobronchial tissues were obtained from the University of California at Davis, School of Medicine (Sacramento, CA) with patient consent and also from the National Disease Research Interchange (Philadelphia, PA). The University Human Subjects Review Committee approved all procedures involved in tissue procurement. In this study, tissues were collected only from patients without diagnosed lung-related disease or known history of airway disease. Primary cultures derived from these airway tissues have been previously established (24, 25). Briefly, protease-dissociated TBE cells were plated on Transwell chambers (25 mm, Corning; Costar) at 1–2 x 104 cells/cm2 in Ham’s F12/DMEM (1:1) supplemented with insulin (5 µg/ml), transferrin (5 µg/ml), epidermal growth factor (10 ng/ml), dexamethasone (0.1 µM), cholera toxin (10 ng/ml), bovine hypothalamus extract (15 µg/ml), BSA (0.5 mg/ml), and all-trans-retinoic acid (30 nM). After 1 wk in an immersed culture condition, the primary TBE cultures were transferred to an air-liquid interface (ALI) culture condition. At full confluence, the culture in the chamber achieved an elevated transepithelial resistance as measured using a "chopstick" voltmeter (Millicell-ERS; Millipore). Briefly, one of the chopstick electrodes was immersed to the basal side of the culture, the other electrode was immersed into the apical side of the Transwell chamber and then the transepithelial resistance was measured. By 2 wk a well-established mucociliary cell layer was developed under the ALI culture condition. At this time point, cultures were treated with IL-17 and various cytokines and inhibitors as described below. Human bronchial epithelial HBE1 cell line is an immortalized line of normal human airway epithelial cells (26). These cells were maintained in serum-free Ham’s F12 medium supplemented with six hormonal supplements, as described earlier for primary TBE cultures, but without all-trans-retinoic acid. C57BL/6 mouse tracheal epithelial cells were isolated and cultured under an ALI condition, similar to that of human primary TBE cells.

Treatments of cytokines and inhibitors of signaling pathways

Recombinant human cytokines were dissolved in PBS with 1% BSA, as suggested by the manufacturer’s protocol (R&D System). Inhibitors were dissolved in the appropriate solvent as suggested by the manufacturer’s protocol (Sigma-Aldrich). Before the treatment or media change, cytokines (0–100 ng/ml) and inhibitors were diluted to the desired levels in fresh culture media. Control culture media contained similar levels of PBS/1% BSA and/or solvent (<0.1%) as treatment media. The apical side of the Transwell chamber received 0.5 ml of the freshly made culture media containing the cytokines or inhibitors. The basal side of the chamber received 2 ml of the same. Within 5 min of the addition, the Transwell chambers were returned to ALI culture conditions in a well-humidified CO2 incubator until the next media change. Media changes were done once every other day until harvest. For the mRNA stability study, cells were pretreated with or without 20 ng/ml IL-17 for 24 h. Then, 5 µg/ml actinomycin D was added to these cultures, which were harvested for RNA isolation at various hours as indicated. JAK inhibitor I, LY29402, helenalin, U0126, SB203580, and JNK inhibitor II were dissolved in DMSO and added to both sides of the culture media 30 min before IL-17 treatment. The optimal doses for each of the selected inhibitors were determined based on the current literature and the manufacturer’s recommendations. No obvious cytotoxicity (based on trypan blue dye exclusion) was observed in these cultures after these inhibitor treatments.

Measurement of CCL20 secretion by ELISA

To determine the polarity of CCL20 secretion in culture, both sides of the Transwell chambers containing ALI cultures of primary human TBE cells were rinsed three times with fresh culture media and then treated with various doses of IL-17 as described in the study. Apical secretions were recovered by washing the apical side of the culture with 300 µl of culture media. Basolateral secretions were recovered by directly collecting the basal culture media (2 ml). After a brief centrifugation to remove cell debris and particulates, these collected washes and media were stored at –20°C before ELISA analysis. A CCL20 ELISA kit (R&D Systems) was purchased and used per manufacturer’s instructions. Samples were run in triplicate to ensure reproducibility. Three separate primary TBE cultures derived from different donors were assayed and only one set of representative results is shown.

Real-time RT-PCR expression analysis

Five µg of total RNA was reverse transcribed with Moloney murine leukemia virus-reverse transcriptase (Promega) by oligo(dT) primers for 90 min at 42°C in 20 µl of reaction mixtures and then further diluted to 100 µl with water for the subsequent procedures. Diluted cDNA (2 µl) was analyzed using 2x SYBR Green PCR Master Mix (Applied Biosystems) by an ABI 5700 or ABI PRISM 7900HT Sequence Detection System (Applied Biosystems) following the manufacturer’s protocol. Gene-specific primers were designed according to the sequences to cover the conserved peptide sequence regions. PCR primers used were: human CCL20 forward CTGGCTGCTTTGATGTCAGT, reverse CGTGTGAAGCCCACAATAAA; mouse CCL20 forward GTGGGTTTCACAAGACAGATG, reverse TTTTCACCCAGTTCTGCTTTG; human I{kappa}B-{alpha} forward CTTCAGATGCTGCCAGAGAGT, reverse GCCTCCAAACACACAGTCATC; human {beta}-actin forward AGAAAATCTGGCACCACACC, reverse GGGGTGTTGAAGGTCTCAAA; human GAPDH forward CAATGACCCCTTCATTGACC, reverse GACAAGCTTCCCGTTCTCAG; and mouse GAPDH forward TGTGTCCGTCGTGGATCTGA, reverse CCTGCTTCACCACCTTCTTGAT. The PCR was conducted in 96-well optical reaction plates as described (19). Briefly, each well contained a 50-µl reaction mixture that contained 25 µl of the SYBR Green PCR Master mix, 1 µl of each forward and reverse primer, 21 µl of water, and 2 µl of cDNA samples. The SYBR green dye was measured at 530 nm during the extension phase. The threshold cycle (Ct) value reflects the cycle number at which the fluorescence generated within a reaction crosses a given threshold. The threshold cycle value assigned to each well thus reflects the point during the reaction at which a sufficient number of amplicons have been accumulated. The relative mRNA amount in each sample was calculated based on its threshold cycle in comparison to the threshold cycle of housekeeping genes, such as {beta}-actin and GAPDH. The results were presented as 2(Ct of CCL20 – Ct of housekeeping gene) in arbitrary units. The purity of amplified product was determined as a single peak of dissociation curve. Real-time PCR was conducted in duplicate for each sample, and the mean value was calculated. This procedure was performed in at least two or three independent experiments.

Cloning of the CCL20 promoter-luciferase reporter plasmid

A DNA fragment containing the proximal 687 bp of the CCL20 promoter region (–626 to +61) was amplified from PstI-digested genomic DNA by PCR with the following primers: GTTGCTAGCAAATCAAGGTGAAGCTGAGGTTT (forward primer with NheI tail) and CCATAAGCTTCATGGTTTTTAGCTCAAAGAACAG (reverse primer with HindIII tail). The amplified product was subcloned into a pGL-3-basic vector (Promega) with firefly luciferase reporter gene to generate CCL20–687/Luc plasmid. The authenticity of the clone was confirmed by DNA sequencing.

Transient transfection and luciferase assay

HBE1 cells were seeded into 12-well plates at a density of 1 x 105 cells/well. One day after plating, cells were transfected with 0.5 µg of CCL20–687/Luc plasmid DNA and 50 ng of Renilla luciferase expression vector pRL-TK (Promega) using FuGENE 6-based gene transfer protocol (Roche Diagnostics) according to the manufacturer’s instruction. Eighteen hours after the transfection, cells were treated with various concentrations of IL-17, and cell extracts were prepared for reporter gene assays 24 h after the IL-17 treatment. The reporter gene assays were conducted with the Dual-Glo Luciferase Assay System (Promega) according to the manufacturer’s protocol. The relative CCL20 promoter activities were expressed as relative luciferase units after normalization to the internal control, Renilla luciferase activity. The results were averaged from triplicate wells of three separate experiments.

Immunofluorescence microcopy

For IL-17RA staining, primary cells were cultured on Transwell chambers. Membranes were then mounted to a slide, washed three times with PBS for 5 min each, and then incubated with goat anti-IL-17RA polyclonal primary Abs at 1/200 dilution in blocking buffer for overnight at 4°C. Blocking buffer is made of 2% rabbit serum and 2% BSA in PBS with Tween 20 (PBST). Then samples were washed three times with PBST for 5 min each, and incubated with fluorescent-labeled Alexa Fluor 488 rabbit anti-goat IgG secondary Abs (1/500 dilution in blocking buffer) (Molecular Probes) for 1 h at room temperature. Slides were then fixed at room temperature for 30 min in PBS supplemented with 4% paraformaldehyde solution. Nuclei were counterstained with propidium iodide using VECTASHIELD mounting medium (Vector Laboratories). The staining was visualized using a Zeiss LSM 510 confocal fluorescence microscope (x60 objective).

For p65 staining, primary cells were allowed to adhere to sterile Lab-Tek II chamber slide systems (Nalge Nunc International) incubated in previously outlined experimental conditions. Cells were fixed at 4°C for overnight in PBS supplemented with 4% paraformaldehyde solution. The slide chambers were washed three times with PBS for 5 min each, permeabilized with 0.1% Triton X-100 in PBS for 30 min at 37°C, and then blocked for 30 min at 37°C. Blocking buffer is 2% rabbit serum in PBST. The samples were then stained with mouse anti-p65 monoclonal primary Abs (1/200 dilution in blocking buffer) for 1 h at 37°C, washed three times with PBST for 5 min each, and incubated with fluorescent-labeled Alexa Fluor 488 rabbit anti-mouse IgG secondary Abs (1/500 dilution in blocking buffer) (Molecular Probes) for 1 h at 37°C. Nuclei were counterstained with VECTASHIELD mounting medium with DAPI (4',6'-diamidino-2-phenylindole; Vector Laboratories). The staining was visualized using a Zeiss AxioSkop fluorescence microscope (x40 objective).

Statistical analysis

Data are expressed as mean ± SE. The number of repetitions for each experiment is described in the results. Group differences were calculated by t test or one-way ANOVA with Bonferroni post hoc test as described in the figures. Values of p < 0.05 were considered significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Effect of IL-17 on the stimulation of CCL20 expression in human primary TBE cells

Real-time RT-PCR analysis was conducted for CCL20 expression in these cytokine-treated samples. As shown in Fig. 1, CCL20 message was elevated 4- to 10-fold in TBE cells by IL-1{alpha}, IL-1{beta}, TNF-{alpha}, and IL-17. In contrast, other cytokines, especially the Th2 cytokines from 10 to 100 ng/ml, had very little influence on inducing CCL20 messages. Overnight (16 h) treatment of airway epithelial cells with IL-17 consistently resulted in a 10-fold induction of CCL20 message. This level of stimulation is the highest among the cytokine panel of the study.



View larger version (18K):
[in this window]
[in a new window]
 
FIGURE 1. Real-time PCR analysis of CCL20 mRNA in primary human TBE cells after cytokine treatment. Primary cultures were conducted under an ALI culture condition. At day 21 after plating, cytokines (10 ng/ml) were added to both the apical and basal sides of the culture. Total RNA was collected next day (16 h). Cytokines: IL-1{alpha}, 1{beta}, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, 18, TNF-{alpha}, IFN-{gamma}, and GM-CSF. The level of CCL20 mRNA was normalized to {beta}-actin, and the relative quantity was further normalized with the control cultures treated with vehicle (PBS/1% BSA). Results are expressed as mean ± SE for triplicate samples from one representative experiment of three independent primary cultures from different donors. Only the induction data were analyzed by t test compared with control. *, p < 0.05.

 
Kinetics studies of IL-17 effects on CCL20 expression

The effect of IL-17 on CCL20 gene expression was dose- and time-dependent (Fig. 2). As low as 1 ng/ml IL-17 could elicit a significant stimulation of CCL20 gene expression in primary TBE cells after 48 h of treatment. Peak stimulation occurred at 20 ng/ml level, with no further increase at 100 ng/ml but mean went up compared with 20 ng/ml IL-17. Throughout this dose study, we did not observe any cytokine-induced cytotoxicity. Cell viability, as assessed by the trypan blue exclusion method, was routinely higher than 95%.



View larger version (13K):
[in this window]
[in a new window]
 
FIGURE 2. Dose- and time-dependent effects of IL-17 on the stimulation of CCL20 gene expression and the promoter activity. A, Dose effects of IL-17 on CCL20 expression. Primary human TBE cells were treated with 1–100 ng/ml recombinant human IL-17, as indicated. RNA samples were harvested 48 h after the treatment and analyzed by real time RT-PCR as described in Materials and Methods. B, Time course effects of IL-17 on CCL20 expression. Primary human TBE cells were treated with or without 20 ng/ml IL-17 and cultures were harvested at various times after the treatment for RNA isolation. Real-time RT-PCR was conducted to quantify the level of the expression as described in Materials and Methods. C, Dose effects of IL-17 on CCL20 promoter-driven reporter gene activity. HBE1 cells were transfected with CCL20–687/Luc chimeric construct DNA and the control plasmid DNA, pRL-TK as described in Materials and Methods. The relative CCL20 reporter gene luciferase activity, after normalization for the transfection efficiency with the pRL-TK reporter gene activity, was expressed as fold of activation relative to the unstimulated control. Results were expressed as mean ± SE of triplicate samples from three independent primary cultures. Multiple comparisons were done between control and IL-17-treated samples by one-way ANOVA with Bonferroni post hoc test. *, p < 0.05.

 
A significant level of stimulation of CCL20 message by IL-17 was seen within 3 h and an accumulating stimulation was seen at 48 h. At this time point, there was an 80-fold abundance of CCL20 messages compared with the control. To further determine whether the observed effect of IL-17 on CCL20 expression was due to a transcriptional activation, study of the effect of IL-17 on CCL20 promoter activity was conducted in HBE1 cells using a transient transfection approach with CCL20–687/Luc chimeric construct DNA. The HBE1 cell line was used because the cell line has a similar response to IL-17 for CCL20 expression (data not shown) and it is difficult to carry out gene transfection study on primary TBE cells. As shown in Fig. 2C, there was a dose-dependent increase in the relative CCL20 promoter based luciferase activity by IL-17. At 20 and 100 ng/ml levels, IL-17 had a significant stimulation on the hBD-2 promoter activity based on ANOVA. These results further support a transcriptional mechanism of IL-17 in the regulation of CCL20 expression.

IL-17 has been shown to stabilize the mRNA of a short-lived NF-{kappa}B regulator, I{kappa}B-{zeta}, in NIH 3T3 cells (27). To elucidate whether IL-17 also stabilizes CCL20 mRNA, cultures treated with or without IL-17 for 24 h were exposed to the RNA synthesis inhibitor, actinomycin D. RNA were isolated at 0.5, 1, 2, 4, and 6 h after the inhibitor treatment. The stable housekeeping gene, {beta}-actin, was chosen as the control. The relative mRNA stability of CCL20 transcript, as compared with that of {beta}-actin, was plotted against the time of actinomycin D treatment (Fig. 3). CCL20 transcripts were as stable as {beta}-actin mRNA in these studies, and IL-17 obviously had no influence on the half-life of the message. In contrast, the I{kappa}B-{alpha} messages, well-known short-lived mRNAs, were much less stable than {beta}-actin in both IL-17-treated and untreated cultures after actinomycin D treatment. These results suggested that CCL20 message is as stable as {beta}-actin in airway epithelial cultures, and the stability of CCL20 transcript is not affected by IL-17 treatment.



View larger version (16K):
[in this window]
[in a new window]
 
FIGURE 3. Characterization of mRNA stability in IL-17-treated and untreated cultures after addition of a transcription inhibitor, actinomycin D. Primary human TBE cells cultured under an ALI condition were treated with or without IL-17 (20 ng/ml). Twenty-four hours later, actinomycin D (5 µg/ml) was added to these cultures, and the cultures were harvested for RNA at 0.5, 1, 2, 4, and 6 h after the addition. Real-time RT-PCR analysis was conducted for {beta}-actin, CCL20, and I{kappa}B-{alpha} messages in these RNA samples. A, Relative level of CCL20 message after normalization with {beta}-actin level in each RNA sample was plotted against the time of actinomycin D treatment. B, Relative level of I{kappa}B{alpha} message after normalization with {beta}-actin level in each RNA sample was plotted against the time of actinomycin D treatment. Values are mean ± SE of triplicates of one representative experiment. It has been repeated with two independent primary cultures derived from different donors.

 
Stimulation of the mouse homologue mCCL20 gene message by IL-17

The evolutionary conservation of IL-17-induced CCL20 expression was tested by analyzing the expression of its mouse homologue, mCCL20, by mouse primary tracheal epithelial cells. Various concentrations of IL-17 were added to these cultures, and RNA was harvested 24 h later for real-time RT-PCR quantification as described in Materials and Methods. The baseline mCCL20 expression in mouse TBE cells was lower than human CCL20 expression, but IL-17 was still able to significantly increase mCCL20 message in primary mouse TBE cells (Fig. 4). Peak stimulation occurred at 100 ng/ml dose, with no further increase at 200 ng/ml level. This result further supports the potency of IL-17 in enhancing CCL20 expression by various airway epithelial cells.



View larger version (17K):
[in this window]
[in a new window]
 
FIGURE 4. Evolutionary conservation of IL-17 effect on mouse mCCL20 gene expression. C57BL/6 mouse primary tracheal epithelial cells were isolated and cultured under an ALI condition. One week later, cultures were treated with media containing 10–200 ng/ml IL-17 and PBS-BSA vehicle. Cultures were maintained for an additional week under the same condition and media changed every other day. RNA samples were isolated from these cultures and subjected to real-time RT-PCR analysis. The level of mCCL20 message was normalized to mouse mGAPDH. Relative levels of expression are expressed as mean ± SE of triplicates in one representative primary culture and the results have been repeated in two independent primary cultures. Multiple comparisons were done between control and IL-17-treated samples by one-way ANOVA with Bonferroni post hoc test. *, p < 0.05.

 
IL-17-stimulated CCL20 secretion bidirectionally

IL-17 also stimulated CCL20 peptide secretion in primary human TBE cultures. As shown in Fig. 5, both apical and basolateral secretions of CCL20 peptide were significantly increased in these ALI cultures after IL-17 treatment. Because the volumes of the apical and basolateral secretions are considerably different, it is more accurate to make a comparison of secretion per Transwell chamber. On the apical side of the culture chamber, IL-17 significantly increased CCL20 secretion from a baseline of 0.56 ± 0.02 to 1.82 ± 0.08 ng/chamber 24 h after treatment. On the basolateral side of the secretion, IL-17 increased CCL20 secretion from a baseline of 6.10 ± 0.22 to 23.02 ± 1.11 ng/chamber. These results suggest that IL-17 also stimulates the production of CCL20 at the peptide level. Although IL-17 stimulates CCL20 secretion ~3.5-fold on both sides, >90% of the total CCL20 secretion was toward the basal side of the culture chamber.



View larger version (10K):
[in this window]
[in a new window]
 
FIGURE 5. Quantification of CCL20 secretion by ELISA in primary human TBE cultures after IL-17 treatment. Primary human TBE cultures were treated with 1–100 ng/ml IL-17. Twenty-four hours after the treatment, both the apical secretion and the culture medium underneath were collected. Data are expressed as the mean ± SE of the total CCL20 content (in nanograms) per culture chamber from triplicate dishes of the culture. Multiple comparisons were done between control and IL-17-treated samples by one-way ANOVA with Bonferroni post hoc test. *, p < 0.05. A, The peptide level of CCL20 in the apical side of the culture chamber. B, The peptide level of CCL20 secreted to the basolateral side of the culture chamber.

 
Differential effects of apical and basolateral IL-17 treatments on CCL20 expression

To gain an insight into the effectiveness of IL-17 treatment on the induction of CCL20 expression, the polarized ALI cultures were treated with IL-17 on either the apical and/or basal side of the culture. As shown in Fig. 6A, there was no stimulation of CCL20 in cultures that were treated with IL-17 on the apical side only. In contrast, the treatment from the basal side was as effective as the treatment from both the apical and basal sides of the culture. To further demonstrate the polarity, anti-IL-17RA Ab was used to stain the receptor distribution in these ALI primary TBE cultures. Using the confocal microscope, a polarized expression of IL-17RA (Alexa Fluor 488, green stain) was mainly seen on the basolateral side of the culture (Fig. 6B). These results are consistent with the treatment study to further suggest the polarity of IL-17RA expression in these ALI primary TBE cultures.



View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 6. Differential basal and apical effect of IL-17 treatment on CCL20 expression. A, Primary cultures were ALI cultured as described in Materials and Methods. IL-17 (10 ng/ml) was added to the apical side only, basal side only, or both sides of the culture as indicated. Total RNA was collected after 48 h incubation. The expression of CCL20 mRNA was normalized to {beta}-actin. Results are expressed as mean ± SE for triplicate samples from one representative experiment of three independent primary cultures from different donors. Group differences were calculated by t test. *, p < 0.05. B, Immunofluorescent localization of IL-17RA in primary human TBE cells cultured under ALI condition. Transwell cultures were stained directly to the Ab specific to the native form of IL-17RA followed by the treatment with Alexa Fluor 488-conjugated goat anti-rabbit IgG Ab (green) as described in Materials and Methods. This was followed by the treatment with ice-cold methanol (for 5 min) and the exposure to the propidium iodide for nuclear staining (red). The specimen was then examined under a Zeiss confocal fluorescent microscope and scanned at 0.5-µm thick with a x60 lens. In the same region of the specimen, images of different scans at apical, median, and basal area (from left to right) were present. A polarized expression of IL-17RA on the basolateral side of well-differentiated culture was observed. Similar images and conclusion have been obtained from different regions of the same specimen as well as from different specimens derived from three independent primary cultures.

 
Inhibition of IL-17-stimulated CCL20 expression by inhibitors of NF-{kappa}B and MEK1/2 but not by inhibitors of JAK, PI3K, p38, and JNK pathways

To elucidate the possible signaling pathways involved in IL-17-enhanced CCL20 expression, inhibitors of various signaling pathways were used (Fig. 7). Among these inhibitors, we found that helenalin, an inhibitor for the DNA-binding activity of NF-{kappa}B p65 subunit (28), was the most potent inhibitor to suppress the IL-17-induced CCL20 expression. As shown in Fig. 7C, helenalin inhibition of IL-17-mediated CCL20 expression was dose-dependent. In contrast, both the JAK universal inhibitor (JAK inhibitor I) (Fig. 7A) and PI3K inhibitor (LY29402) (Fig. 7B) had no suppressive effect on IL-17-stimulated CCL20 expression. Because it has been reported that IL-17 may activate the MAPK pathways (29, 30, 31), inhibitors of these pathways were used to see whether any of these pathways were involved. As shown in Fig. 7, U0126, an inhibitor of MEK1/2, was very effectively to suppress IL-17-induced CCL20 expression and a dose-dependent suppression was observed (Fig. 7D). In contrast to this finding, JNK inhibitor II had a significant super-enhancement of IL-17-stimulated CCL20 expression at low doses (Fig. 7E). At the highest dose (50 µM), the super-enhanced phenomenon was not noted, presumably due to nonspecific nature of the inhibitor. For p38 pathway, the specific inhibitor SB203580 had no effect at any dose (Fig. 7F).



View larger version (33K):
[in this window]
[in a new window]
 
FIGURE 7. Effect of JAK, PI3K, NF-{kappa}B, and MAPK inhibitors on IL-17-induced CCL20 expression. Primary TBE cells were pretreated with various inhibitors for 30 min, then further treated with IL-17 (20 ng/ml). Twenty-four hours after the treatment, cells were harvested for RNA and real-time PCR quantitation. Only U0126 and helenalin showed a significant suppression of IL-17-enhanced CCL20 expression. Graph values are for bars 3, 4, and 5, respectively. A, JAK inhibitor I (10, 100, and 1000 nM). B, PI3K inhibitor, LY29402 (2, 10, and 50 µM). C, NF-{kappa}B inhibitor, helenalin (5, 20, and 50 µM). D, MEK1/2 inhibitor, U0126 (2, 10, and 50 µM). E, JNK inhibitor II (2, 10, and 50 µM). F, p38 kinase inhibitor, SB203580 (2, 10, and 50 µM). Values are expressed as mean ± SE from three independent experiments. Group differences were calculated by t test. *, p < 0.05.

 
Induced p65 nuclear translocation by IL-17

To confirm NF-{kappa}B activation, induced p65 nuclear translocation was conducted. As shown in the upper panel of Fig. 8, before IL-17 treatment, a majority of anti-p65 staining (green, Alexa Fluor 488) was in the cytoplasm of cultured TBE cells. There was no green staining in the nucleus, as shown by the DAPI-specific blue fluorescent stain. Thirty minutes after IL-17 treatment, nuclear translocation of p65 was clearly seen in many of these TBE cells, although a small fraction of these cells still retained p65 in their cytoplasm (Fig. 8, middle panel). As a comparison, p65 nuclear translocation was more extensive in these TBE cells after IL-1{beta} treatment (Fig. 8, lower panel). These results are consistent with the NF-{kappa}B inhibitor study, further suggesting the significant role of IL-17-mediated NF-{kappa}B activation in the regulation of CCL20 expression.



View larger version (95K):
[in this window]
[in a new window]
 
FIGURE 8. Nuclear translocation of p65 subunit of NF-{kappa}B transcriptional factors in primary human TBE cells after IL-17 and IL-1{beta} treatments. Primary TBE cells were plated on Lab-Tek II chamber slide and treated with IL-17 and IL-1{beta} as described in Materials and Methods. Thirty minutes after the treatment, these slides were fixed with ice-cold 4% paraformaldehyde solution overnight, followed by staining with anti-p65 mAb and Alexa Fluor 488-conjugated rabbit anti-mouse IgG Ab (green fluorescence) as described. For counterstaining, nuclei were stained with DAPI (blue fluorescence). These slides were examined by a Zeiss fluorescent microscope with a x40 lens under appropriate filters for anti-p65 (green, left row), DAPI (blue, center row), and merge (right row). Control cultures without cytokine treatment (upper), IL-17-treated (20 ng/ml) cultures (middle), IL-1{beta}-treated (20 ng/ml) cultures (lower) are shown.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Previously we observed that IL-17 could stimulate CCL20 expression through Affymetrix gene chip-based microarray analysis (19). The current study further extends the microarray data through a quantitative real-time RT-PCR approach and also provides three additional findings. First, through a comparison with a panel of cytokines, we have shown that IL-17 is as potent as TNF-{alpha}, IL-1{alpha}, and IL-1{beta} in stimulating CCL20 expression. This finding together with the previous study of IL-17-dependent hBD-2 expression (19) suggests an important role of IL-17 in the regulation of airway innate immunity. Second, we have shown that IL-17-dependent CCL20 expression is independent from JAK-mediated signaling but sensitive to inhibitors of MEK1 pathway and NF-{kappa}B-mediated transcriptional regulation. The JAK-independent phenomenon is in contrast to the JAK-dependent IL-17-mediated hBD-2 expression (19). Despite a coordinated induction of CCL20 and hBD-2 expression by IL-17, the regulation of these genes is different. In addition to these divergent signaling pathways, the third finding has shown a polarity of IL-17 effect and the distribution of these innate molecules in well-differentiated epithelium. For both CCL20 and hBD-2, IL-17 treatment is effective only from the basal side of the epithelial layer, whereas the stimulated secretions for CCL20 and hBD-2 are different with a preferential secretion toward basal and apical sides of the culture, respectively.

We have demonstrated that IL-17 is as potent as TNF-{alpha}, IL-1{alpha}, and IL-1{beta} in stimulating CCL20 expression (32). Inductions of CCL20 by IL-1{alpha}, IL-1{beta}, and TNF-{alpha} treatment are consistent with previous reports (10, 33, 34). However, we could not reproduce the stimulatory effect of Th2 cytokines, as reported recently by Gordon and colleagues (17). The nature of the discrepancy between this study and the other is difficult to assess. One possible difference might be related to the culture conditions used in these studies. The primary TBE cells used in this study were cultured under ALI conditions and treated continuously with IL-17 until the cells reached to a well-established mucociliary stage with evidences of cilia beating, mucin secretion (measured by ELISA), and transepithelial resistance. Gordon and colleagues (17) used immersed cultures, which may not differentiate as well. The response of TBE cells to cytokines may depend upon their state of differentiation.

CCL20 is constitutively expressed in a variety of normal human mucosa-associated tissues, especially in the mucosal epithelial cells, including the airways surface epithelia cells (35, 36, 37). Although the up-regulation of CCL20 by IL-17 has been reported in synoviocytes and cultured primary keratinocytes (32, 38, 39), the influence of IL-17 on CCL20 in airway epithelial cells has not been reported before. IL-17 is an important cytokine that has gained more recognition for its role in various airway diseases. Initially, IL-17 was found to play a major role in antimicrobial infections (20, 40). Lately, the level of IL-17 has been found significantly elevated in BALF of various chronic lung diseases (41, 42), including allergy-induced asthma (23). We have previously shown that IL-17 is one of the most potent cytokines to stimulate the expression of mucin genes, MUC5AC and MUC5B, and hBD-2 in primary human TBE cells (18, 19). Both CCL20 and hBD-2 have a potent antimicrobial activity and chemotactic activity to CCR6-positive dendritic and T cells (4). Although these two peptides have no sequence homology and they belong to two different gene families, they share many similarities in terms of their antimicrobial and chemotactic activities, binding to CCR6 receptor, regulation by IL-1{beta} and TNF-{alpha}, and now, the coordinated regulation by IL-17.

Several previous reports have shown that IL-17 may augment or enhance certain gene expression via stabilizing the mRNAs. For example, IL-17 was able to stabilize the I{kappa}B-{zeta} mRNA in NIH 3T3 cells (27). It has also been reported previously that LPS is able to prolong CCL20 mRNA turnover in neutrophils in the presence of fMLP or IFN-{gamma} (11). Thus, it is possible that a part of IL-17-stmulated CCL20 expression is through the enhancement of mRNA stability. However, results from the actinomycin D experiments do not support this possibility. Instead, we have found that CCL20 message has a relative long half-life, regardless of IL-17 treatment, compared with the {beta}-actin message in TBE cells. This stability is in contrast to the I{kappa}B-{alpha} message, which is well known for its instability in cells (Fig. 3). Therefore, it is unlikely that a regulatory step at the posttranscriptional level is involved in IL-17-induced CCL20 expression.

Consistent with the above notion of possible transcriptional regulation, we found that helenalin, an inhibitor for the DNA-binding activity of NF-{kappa}B p65 subunit (28), could dramatically suppress IL-17-stimulated CCL20 expression in a dose-dependent fashion. A similar sensitivity to this inhibitor was seen in IL-17-mediated hBD-2 expression (19). Although helenalin induces apoptosis (10–50 µM) in Jurkat T cells (43), there were no effects on cell viability or on total RNA levels at concentrations of helenalin as high as 50 µM, suggesting that the inhibitory effect observed in primary TBE cells was not due to toxicity (data not shown). Another study had used a similar level of helenalin to inhibit NF-{kappa}B-based transcriptional regulation in pulmonary epithelial cells (9). Although there might be nonspecific effect at the highest dose of helenalin, we have further demonstrated IL-17 induced-NF-{kappa}B activation by enhancing the nuclear translocation of p65 from the cytoplasm (Fig. 8). IL-17 has been shown to activate NF-{kappa}B in several other cell types (30, 44, 45). This study and the ones previous suggest that IL-17 is a potential inducer for NF-{kappa}B-dependent transcriptional events, a common property shared by various proinflammatory cytokines, including TNF-{alpha} and IL-1{beta}.

To elucidate the upstream signaling pathways involved in CCL20 induction, various inhibitors were used in this study. To our surprise, we found that CCL20 induction was not blocked by JAK inhibitor I, which is a pan inhibitor for various receptor-associated JAK gene family members (JAK-1, -2, -3, and Tyk-2). This result is in contrast to the regulation of hBD-2, which is sensitive to JAK inhibitor I (19). Although IL-17 has a low affinity with its receptor (IL-17RA), it has been shown in human U937 monocytic leukemia cells that various JAK isotypes (JAK-1, -2, -3, and Tyk-2) could interact with IL-17RA upon the binding of its ligand (46). The insensitivity to JAK inhibitor 1 in this study suggests that an alternative signaling pathway, other than the traditional receptor/JAK activation system is involved in IL-17-induced CCL20 expression. To elucidate this alternative signaling pathway is beyond the scope of this communication.

In addition to JAK activation by the receptor-ligand interaction, PI3K and MAPK pathways have been shown to be involved in IL-17-stimulated gene expression in various cell types (29, 31, 47). In this study, we found that inhibitors of PI3K and two of MAPK pathways, JNK and p38, could not attenuate IL-17-induced CCL20 expression. There was a superinduction of the expression by the JNK inhibitor. The nature of this superinduction is not clear to date. However, the MEK1/2 inhibitor U0126 showed a dose-dependent inhibitory effect to CCL20 induction, with a significant inhibition observed as low as 2 µM. We have found no toxicity to cells at these doses (2–50 µM). Others have used a similar range of doses for their MEK1/2 inhibitor studies on airway epithelial cells (48, 49). Higher concentrations (up to 100 µM) of U0126 have proven to keep a selective effect on ERK, JNK, and p38 phosphorylation in human monocytes (50), whereas <20% of JNK or p38 activities were inhibited by U0126 at lower doses. Therefore, it is less likely that the effect of U0126 is due to its nonspecific nature on pathways other than MEK1/2. Interestingly, U0126 was shown to partially inhibit NF-{kappa}B-binding activity and the NF-{kappa}B-dependent transcription as well as the degradation of I{kappa}B in mouse proximal tubular cells (51). Recent findings in melanoma cells also suggest that NF-{kappa}B-induced kinase (NIK) was found to regulate NF-{kappa}B activation through a novel NIK-MEK-ERK-NF-{kappa}B signaling pathway in addition to the classical NIK-IKK-I{kappa}B-NF-{kappa}B pathway (52). These results suggested a possible cross-talk between the MEK-ERK pathway and the I{kappa}B-NF-{kappa}B activation existed in IL-17-treated TBE cells.

In addition to the molecular mechanism of induction, we also demonstrated a polarity effect of IL-17 treatment and the bidirectional secretion of CCL20 by TBE cells. We have observed that the treatment of IL-17 from the basolateral side of the polarized TBE cultures was the most effective way to stimulate CCL20 expression. Treatment of IL-17 from the apical side of the culture produced no stimulation. A similar effect was also seen for IL-17-enhanced hBD-2 expression (data not shown). Thus, it is possible that the distribution of the IL-17 receptor, especially IL-17RA form, is largely located at the basal layer of the polarized TBE culture. This notion is further confirmed by a confocal fluorescence microscope study, which showed a preferential immunofluorescent staining on the basal side of the culture with an Ab specific to the native form of IL-17RA (Fig. 6B). We have shown previously that this Ab can block IL-17-enhanced hBD-2 expression (19). Consistent with this finding, Kolls and colleagues (53) have shown recently that IL-17RA is indeed expressed on the basolateral side of well-differentiated trachea epithelial cells in vitro.

We also observed a bidirectional secretion of CCL20 in both steady and IL-17-stimulated conditions. Based on ELISA data, we found that polarized TBE cultures secreted 0.56 ± 0.02 ng per day (at a confluent culture density of 2 million cells/chamber) to the apical side of the culture, whereas 6.1 ± 0.22 ng was secreted to the basolateral side of the underneath culture medium. These secretions toward the apical and basal compartments were coordinately elevated to 1.82 ± 0.08 and 23.02 ± 1.11 ng levels, respectively, in cultures after IL-17 treatment. Although there was a similar 3- to 4-fold stimulation of the secretion in both directions by IL-17, the apical secretion accounted for <10% of the total amount of CCL20 secretion. These results support a bidirectional secretion of CCL20, with a preferential secretion toward the basolateral side by airway epithelial cells. Furthermore, IL-17 has stimulatory effects with no apparent influence on the property of the secretion. These results are opposite to IL-17-induced hBD-2 secretion, which is preferential toward the apical side of the culture (19). Because CCL20 and hBD-2 shared similar functions, the differential secretion but coordinate stimulation by IL-17 may suggest a complementary activity in exerting the innate nature of IL-17 in host defense.

IL-17, mainly secreted by activated T cells (54, 55), is prominently elevated in the airway lumen after microbial infections (40, 56) and has a proinflammatory role in mediating neutrophil migration (57) and the production of IL-6 and IL-8 (58, 59). Because IL-17 is a very potent cytokine in the stimulation of CCL20 and hBD-2, and IL-17 elevation in airways has been related to the microbial infection (22), the following innate/adaptive immune response model of IL-17 in respiratory airways is proposed. We postulate that during the early stage of bacterial infection in the airways, microbial products such as LPS bind to pattern recognition receptors such as the TLR4 on epithelial cells and directly or indirectly stimulate a low level induction of CCL20 and hBD-2 (9, 12, 60). The innate nature of this response may provide an initial antimicrobial defense. After the acquired immune response has time to develop, certain types of T cells are chemoattracted to the site of infection in the subepithelial compartment to locally release IL-17. The locally secreted IL-17 further enhances the antimicrobial activity by binding to the IL-17 receptor underneath epithelial cells via an NF-{kappa}B-dependent gene expression mechanism for the expression of hBD-2 and CCL20 genes. Interestingly, present and previous studies (19) have shown that IL-17 can exert signaling pathways through JAK-dependent and -independent activation of NF-{kappa}B for stimulating hBD-2 and CCL20 expression, respectively, in the same airway epithelial culture. Noteworthy is that the secretion of hBD-2 is mainly apical, whereas CCL20 secretion is basolateral. Such a scenario in the coordination and differential secretions exerted by a single cytokine IL-17 may have a very significant implication in protecting airways against the microbial infection. For hBD-2, a preferentially apical secretion is consistent with the antimicrobial nature of this molecule. A preferential secretion of CCL20 to the basolateral side of airways would support the chemotactic function of this cytokine in recruiting other leukocyte types, including memory T cells to the infected sites of airways to ensure the clearance of invaders. The cross-talk between IL-17-induced gene expression and the recruitment of various inflammatory cells might be instrumental to direct the transition from an innate immunity to an adaptive immune response.

In summary, the present study demonstrates that IL-17 directly stimulates CCL20 gene expression in primary airway epithelial cells. This effect mainly occurs through the basolateral treatment of cells with IL-17. It appears that there is a coordinate expression and secretion between hBD-2 and CCL20 in airway epithelia after IL-17 treatment. Further studies on the molecular basis of the coordinated activation of NF-{kappa}B by IL-17-induced JAK-dependent and -independent signaling pathways are needed. Our results with IL-17 widen the spectrum of known cytokines that can regulate CCL20 expression and offer preliminary evidence for a novel mechanism in coordinating both innate and adaptive immune responses.


    Acknowledgments
 
We thank Yu Hua Zhao for suggestions on performing the ELISA for CCL20 and the superior cell culture work in providing primary human TBE cell cultures used in the study. Dr. Suzette Smiley-Jewell is thanked for editing of the manuscript.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by Grants HL35635, HL077315, HL077902, ES00628, and AI 50496 from the National Institutes of Health. This work was also supported by the National Institutes of Health T32 Training Grant HL07013. Back

2 Address correspondence and reprint requests to Dr. Reen Wu, Center for Comparative Respiratory Biology and Medicine, Genome and Biomedical Science Facility, Suite 6523, University of California, 451 East Health Science Drive, Davis, CA 95616. E-mail address: rwu{at}ucdavis.edu Back

3 Abbreviations used in this paper: hBD, human {beta}-defensin; TBE, tracheobronchial epithelial; ALI, air-liquid interface; BALF, bronchoalveolar lavage fluid; NIK, NF-{kappa}B-induced kinase. Back

Received for publication May 5, 2005. Accepted for publication August 23, 2005.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Stumbles, P. A., D. H. Strickland, C. L. Pimm, S. F. Proksch, A. M. Marsh, A. S. McWilliam, A. Bosco, I. Tobagus, J. A. Thomas, S. Napoli, et al 2001. Regulation of dendritic cell recruitment into resting and inflamed airway epithelium: use of alternative chemokine receptors as a function of inducing stimulus. J. Immunol. 167:228.-234. [Abstract/Free Full Text]
  2. Zlotnik, A., J. Morales, J. A. Hedrick. 1999. Recent advances in chemokines and chemokine receptors. Crit. Rev. Immunol. 19:1.-47. [Medline]
  3. Murphy, P. M., M. Baggiolini, I. F. Charo, C. A. Hebert, R. Horuk, K. Matsushima, L. H. Miller, J. J. Oppenheim, C. A. Power. 2000. International union of pharmacology. XXII. Nomenclature for chemokine receptors. Pharmacol. Rev. 52:145.-176. [Abstract/Free Full Text]
  4. Schutyser, E., S. Struyf, J. Van Damme. 2003. The CC chemokine CCL20 and its receptor CCR6. Cytokine Growth Factor Rev. 14:409.-426. [Medline]
  5. Yang, D., Q. Chen, D. M. Hoover, P. Staley, K. D. Tucker, J. Lubkowski, J. J. Oppenheim. 2003. Many chemokines including CCL20/MIP-3{alpha} display antimicrobial activity. J. Leukocyte Biol. 74:448.-455. [Abstract/Free Full Text]
  6. Starner, T. D., C. K. Barker, H. P. Jia, Y. Kang, P. B. McCray, Jr. 2003. CCL20 is an inducible product of human airway epithelia with innate immune properties. Am. J. Respir. Cell Mol. Biol. 29:627.-633. [Abstract/Free Full Text]
  7. Becker, M. N., G. Diamond, M. W. Verghese, S. H. Randell. 2000. CD14-dependent lipopolysaccharide-induced {beta}-defensin-2 expression in human tracheobronchial epithelium. J. Biol. Chem. 275:29731.-29736. [Abstract/Free Full Text]
  8. Liu, L., A. A. Roberts, T. Ganz. 2003. By IL-1 signaling, monocyte-derived cells dramatically enhance the epidermal antimicrobial response to lipopolysaccharide. J. Immunol. 170:575.-580. [Abstract/Free Full Text]
  9. Tsutsumi-Ishii, Y., I. Nagaoka. 2003. Modulation of human {beta}-defensin-2 transcription in pulmonary epithelial cells by lipopolysaccharide-stimulated mononuclear phagocytes via proinflammatory cytokine production. J. Immunol. 170:4226.-4236. [Abstract/Free Full Text]
  10. Harder, J., U. Meyer-Hoffert, L. M. Teran, L. Schwichtenberg, J. Bartels, S. Maune, J. M. Schroder. 2000. Mucoid Pseudomonas aeruginosa, TNF-{alpha}, and IL-1{beta}, but not IL-6, induce human {beta}-defensin-2 in respiratory epithelia. Am. J. Respir. Cell Mol. Biol. 22:714.-721. [Abstract/Free Full Text]
  11. Scapini, P., L. Crepaldi, C. Pinardi, F. Calzetti, M. A. Cassatella. 2002. CCL20/macrophage inflammatory protein-3{alpha} production in LPS-stimulated neutrophils is enhanced by the chemoattractant formyl-methionyl-leucyl-phenylalanine and IFN-{gamma} through independent mechanisms. Eur. J. Immunol. 32:3515.-3524. [Medline]
  12. Sugita, S., T. Kohno, K. Yamamoto, Y. Imaizumi, H. Nakajima, T. Ishimaru, T. Matsuyama. 2002. Induction of macrophage-inflammatory protein-3{alpha} gene expression by TNF-dependent NF-{kappa}B activation. J. Immunol. 168:5621.-5628. [Abstract/Free Full Text]
  13. Yang, D., O. Chertov, S. N. Bykovskaia, Q. Chen, M. J. Buffo, J. Shogan, M. Anderson, J. M. Schroder, J. M. Wang, O. M. Howard, J. J. Oppenheim. 1999. {beta}-defensins: linking innate and adaptive immunity through dendritic and T cell CCR6. Science 286:525.-528. [Abstract/Free Full Text]
  14. Cook, D. N., D. M. Prosser, R. Forster, J. Zhang, N. A. Kuklin, S. J. Abbondanzo, X. D. Niu, S. C. Chen, D. J. Manfra, M. T. Wiekowski, et al 2000. CCR6 mediates dendritic cell localization, lymphocyte homeostasis, and immune responses in mucosal tissue. Immunity 12:495.-503. [Medline]
  15. Dieu, M. C., B. Vanbervliet, A. Vicari, J. M. Bridon, E. Oldham, S. Ait-Yahia, F. Briere, A. Zlotnik, S. Lebecque, C. Caux. 1998. Selective recruitment of immature and mature dendritic cells by distinct chemokines expressed in different anatomic sites. J. Exp. Med. 188:373.-386. [Abstract/Free Full Text]
  16. Sierro, F., B. Dubois, A. Coste, D. Kaiserlian, J. P. Kraehenbuhl, J. C. Sirard. 2001. Flagellin stimulation of intestinal epithelial cells triggers CCL20-mediated migration of dendritic cells. Proc. Natl. Acad. Sci. USA 98:13722.-13727. [Abstract/Free Full Text]
  17. Reibman, J., Y. Hsu, L. C. Chen, B. Bleck, T. Gordon. 2003. Airway epithelial cells release MIP-3{alpha}/CCL20 in response to cytokines and ambient particulate matter. Am. J. Respir. Cell Mol. Biol. 28:648.-654. [Abstract/Free Full Text]
  18. Chen, Y., P. Thai, Y. H. Zhao, Y. S. Ho, M. M. DeSouza, R. Wu. 2003. Stimulation of airway mucin gene expression by interleukin (IL)-17 through IL-6 paracrine/autocrine loop. J. Biol. Chem. 278:17036.-17043. [Abstract/Free Full Text]
  19. Kao, C. Y., Y. Chen, P. Thai, S. Wachi, F. Huang, C. Kim, R. W. Harper, R. Wu. 2004. IL-17 markedly up-regulates {beta}-defensin-2 expression in human airway epithelium via JAK and NF-{kappa}B signaling pathways. J. Immunol. 173:3482.-3491. [Abstract/Free Full Text]
  20. Happel, K. I., M. Zheng, E. Young, L. J. Quinton, E. Lockhart, A. J. Ramsay, J. E. Shellito, J. R. Schurr, G. J. Bagby, S. Nelson, J. K. Kolls. 2003. Cutting edge: roles of Toll-like receptor 4 and IL-23 in IL-17 expression in response to Klebsiella pneumoniae infection. J. Immunol. 170:4432.-4436. [Abstract/Free Full Text]
  21. Kawaguchi, M., M. Adachi, N. Oda, F. Kokubu, S. K. Huang. 2004. IL-17 cytokine family. J. Allergy Clin. Immunol. 114:1265.-1274. [Medline]
  22. Kolls, J. K., S. T. Kanaly, A. J. Ramsay. 2003. Interleukin-17: an emerging role in lung inflammation. Am. J. Respir. Cell Mol. Biol. 28:9.-11. [Free Full Text]
  23. Molet, S., Q. Hamid, F. Davoine, E. Nutku, R. Taha, N. Page, R. Olivenstein, J. Elias, J. Chakir. 2001. IL-17 is increased in asthmatic airways and induces human bronchial fibroblasts to produce cytokines. J. Allergy Clin. Immunol. 108:430.-438. [Medline]
  24. Wu, R., W. R. Martin, C. B. Robinson, J. A. St. George, C. G. Plopper, G. Kurland, J. A. Last, C. E. Cross, R. J. McDonald, R. Boucher. 1990. Expression of mucin synthesis and secretion in human tracheobronchial epithelial cells grown in culture. Am. J. Respir. Cell Mol. Biol. 3:467.-478.
  25. Wu, R., Y. H. Zhao, M. M. Chang. 1997. Growth and differentiation of conducting airway epithelial cells in culture. Eur. Respir. J. 10:2398.-2403. [Abstract]
  26. Yankaskas, J. R., J. E. Haizlip, M. Conrad, D. Koval, E. Lazarowski, A. M. Paradiso, C. A. Rinehart, Jr, B. Sarkadi, R. Schlegel, R. C. Boucher. 1993. Papilloma virus immortalized tracheal epithelial cells retain a well-differentiated phenotype. Am. J. Physiol. 264:C1219.-C1230.
  27. Yamazaki, S., T. Muta, S. Matsuo, K. Takeshige. 2005. Stimulus-specific induction of a novel NF-{kappa}B regulator, I{kappa}B-{zeta}, via Toll/interleukin-1 receptor is mediated by mRNA stabilization. J. Biol. Chem. 280:1678.-1687. [Abstract/Free Full Text]
  28. Lyss, G., A. Knorre, T. J. Schmidt, H. L. Pahl, I. Merfort. 1998. The anti-inflammatory sesquiterpene lactone helenalin inhibits the transcription factor NF-{kappa}B by directly targeting p65. J. Biol. Chem. 273:33508.-33516. [Abstract/Free Full Text]
  29. Martel-Pelletier, J., F. Mineau, D. Jovanovic, J. A. Di Battista, J. P. Pelletier. 1999. Mitogen-activated protein kinase and nuclear factor {kappa}B together regulate interleukin-17-induced nitric oxide production in human osteoarthritic chondrocytes: possible role of transactivating factor mitogen-activated protein kinase-activated proten kinase (MAPKAPK). Arthritis Rheum. 42:2399.-2409. [Medline]
  30. Hata, K., A. Andoh, M. Shimada, S. Fujino, S. Bamba, Y. Araki, T. Okuno, Y. Fujiyama, T. Bamba. 2002. IL-17 stimulates inflammatory responses via NF-{kappa}B and MAP kinase pathways in human colonic myofibroblasts. Am. J. Physiol. 282:G1035.-G1044.
  31. Hsieh, H. G., C. C. Loong, C. Y. Lin. 2002. Interleukin-17 induces src/MAPK cascades activation in human renal epithelial cells. Cytokine 19:159.-174. [Medline]
  32. Homey, B., M.-C. Dieu-Nosjean, A. Wiesenborn, C. Massacrier, J.-J. Pin, E. Oldham, D. Catron, M. E. Buchanan, A. Müller, R. deWaal Malefyt, et al 2000. Up-regulation of macrophage inflammatory protein-3{alpha}/CCL20 and CC chemokine receptor 6 in psoriasis. J. Immunol. 164:6621.-6632. [Abstract/Free Full Text]
  33. Singh, P. K., H. P. Jia, K. Wiles, J. Hesselberth, L. Liu, B. A. Conway, E. P. Greenberg, E. V. Valore, M. J. Welsh, T. Ganz, et al 1998. Production of {beta}-defensins by human airway epithelia. Proc. Natl. Acad. Sci. USA 95:14961.-14966. [Abstract/Free Full Text]
  34. O’Neil, D. A., E. M. Porter, D. Elewaut, G. M. Anderson, L. Eckmann, T. Ganz, M. F. Kagnoff. 1999. Expression and regulation of the human {beta}-defensins hBD-1 and hBD-2 in intestinal epithelium. J. Immunol. 163:6718.-6724. [Abstract/Free Full Text]
  35. Fujiie, S., K. Hieshima, D. Izawa, T. Nakayama, R. Fujisawa, H. Ohyanagi, O. Yoshie. 2001. Proinflammatory cytokines induce liver and activation-regulated chemokine/macrophage inflammatory protein-3{alpha}/CCL20 in mucosal epithelial cells through NF-{kappa}B. Int. Immunol. 13:1255.-1263. [Abstract/Free Full Text]
  36. Izadpanah, A., M. B. Dwinell, L. Eckmann, N. M. Varki, M. F. Kagnoff. 2001. Regulated MIP-3{alpha}/CCL20 production by human intestinal epithelium: mechanism for modulating mucosal immunity. Am. J. Physiol. 280:G710.-G719.
  37. Abiko, Y., M. Nishimura, K. Kusano, K. Nakashima, K. Okumura, T. Arakawa, T. Takuma, I. Mizoguchi, T. Kaku. 2003. Expression of MIP-3{alpha}/CCL20, a macrophage inflammatory protein in oral squamous cell carcinoma. Arch. Oral Biol. 48:171.-175. [Medline]
  38. Chabaud, M., T. Aarvak, P. Garnero, J. B. Natvig, P. Miossec. 2001. Potential contribution of IL-17-producing Th1 cells to defective repair activity in joint inflammation: partial correction with Th2-promoting conditions. Cytokine 13:113.-118. [Medline]
  39. Chabaud, M., G. Page, P. Miossec. 2001. Enhancing effect of IL-1, IL-17, and TNF-{alpha} on macrophage inflammatory protein-3{alpha} production in rheumatoid arthritis: regulation by soluble receptors and Th2 cytokines. J. Immunol. 167:6015.-6020. [Abstract/Free Full Text]
  40. Ye, P., P. B. Garvey, P. Zhang, S. Nelson, G. Bagby, W. R. Summer, P. Schwarzenberger, J. E. Shellito, J. K. Kolls. 2001. Interleukin-17 and lung host defense against Klebsiella pneumoniae infection. Am. J. Respir. Cell Mol. Biol. 25:335.-340. [Abstract/Free Full Text]
  41. Laan, M., L. Palmberg, K. Larsson, A. Linden. 2002. Free, soluble interleukin-17 protein during severe inflammation in human airways. Eur. Respir. J. 19:534.-537. [Abstract/Free Full Text]
  42. Oda, N., P. B. Canelos, D. M. Essayan, B. A. Plunkett, A. C. Myers, S. K. Huang. 2005. Interleukin-17F induces pulmonary neutrophilia and amplifies antigen-induced allergic response. Am. J. Respir. Crit. Care Med. 171:12.-18. [Abstract/Free Full Text]
  43. Dirsch, V. M., H. Stuppner, A. M. Vollmar. 2001. Helenalin triggers a CD95 death receptor-independent apoptosis that is not affected by overexpression of Bcl-xL or Bcl-2. Cancer Res. 61:5817.-5823. [Abstract/Free Full Text]
  44. Shalom-Barak, T., J. Quach, M. Lotz. 1998. Interleukin-17-induced gene expression in articular chondrocytes is associated with activation of mitogen-activated protein kinases and NF-{kappa}B. J. Biol. Chem. 273:27467.-27473. [Abstract/Free Full Text]
  45. Awane, M., P. G. Andres, D. J. Li, H. C. Reinecker. 1999. NF-{kappa}B-inducing kinase is a common mediator of IL-17-, TNF-{alpha}-, and IL-1{beta}-induced chemokine promoter activation in intestinal epithelial cells. J. Immunol. 162:5337.-5344. [Abstract/Free Full Text]
  46. Subramaniam, S. V., R. S. Cooper, S. E. Adunyah. 1999. Evidence for the involvement of JAK/STAT pathway in the signaling mechanism of interleukin-17. Biochem. Biophys. Res. Commun. 262:14.-19. [Medline]
  47. Hwang, S. Y., J. Y. Kim, K. W. Kim, M. K. Park, Y. Moon, W. U. Kim, H. Y. Kim. 2004. IL-17 induces production of IL-6 and IL-8 in rheumatoid arthritis synovial fibroblasts via NF-{kappa}B- and PI3-kinase/Akt-dependent pathways. Arthritis Res. Ther. 6:R120.-R128. [Medline]
  48. Kawaguchi, M., F. Kokubu, S. Matsukura, K. Ieki, M. Odaka, S. Watanabe, S. Suzuki, M. Adachi, S. K. Huang. 2003. Induction of C-X-C chemokines, growth-related oncogene {alpha} expression, and epithelial cell-derived neutrophil-activating protein-78 by ML-1 (interleukin-17F) involves activation of Raf1-mitogen-activated protein kinase kinase-extracellular signal-regulated kinase 1/2 pathway. J. Pharmacol. Exp. Ther. 307:1213.-1220. [Abstract/Free Full Text]
  49. Tjabringa, G. S., J. Aarbiou, D. K. Ninaber, J. W. Drijfhout, O. E. Sorensen, N. Borregaard, K. F. Rabe, P. S. Hiemstra. 2003. The antimicrobial peptide LL-37 activates innate immunity at the airway epithelial surface by transactivation of the epidermal growth factor receptor. J. Immunol. 171:6690.-6696. [Abstract/Free Full Text]
  50. Scherle, P. A., E. A. Jones, M. F. Favata, A. J. Daulerio, M. B. Covington, S. A. Nurnberg, R. L. Magolda, J. M. Trzaskos. 1998. Inhibition of MAP kinase kinase prevents cytokine and prostaglandin E2 production in lipopolysaccharide-stimulated monocytes. J. Immunol. 161:5681.-5686. [Abstract/Free Full Text]
  51. Takaya, K., D. Koya, M. Isono, T. Sugimoto, T. Sugaya, A. Kashiwagi, M. Haneda. 2003. Involvement of ERK pathway in albumin-induced MCP-1 expression in mouse proximal tubular cells. Am. J. Physiol. 284:F1037.-F1045.
  52. Dhawan, P., A. Richmond. 2002. A novel NF-{kappa}B-inducing kinase-MAPK signaling pathway up-regulates NF-{kappa}B activity in melanoma cells. J. Biol. Chem. 277:7920.-7928. [Abstract/Free Full Text]
  53. McAllister, F., A. Henry, J. L. Kreindler, P. J. Dubin, L. Ulrich, C. Steele, J. D. Finder, J. M. Pilewski, B. M. Carreno, S. J. Goldman, et al 2005. Role of IL-17A, IL-17F, and the IL-17 receptor in regulating growth-related oncogene-{alpha} and granulocyte colony-stimulating factor in bronchial epithelium: implications for airway inflammation in cystic fibrosis. J. Immunol. 175:404.-412. [Abstract/Free Full Text]
  54. Yao, Z., S. L. Painter, W. C. Fanslow, D. Ulrich, B. M. Macduff, M. K. Spriggs, R. J. Armitage. 1995. Human IL-17: a novel cytokine derived from T cells. J. Immunol. 155:5483.-5486. [Abstract]
  55. Yao, Z., W. C. Fanslow, M. F. Seldin, A. M. Rousseau, S. L. Painter, M. R. Comeau, J. I. Cohen, M. K. Spriggs. 1995. Herpesvirus Saimiri encodes a new cytokine, IL-17, which binds to a novel cytokine receptor. Immunity 3:811.-821. [Medline]
  56. Ye, P., F. H. Rodriguez, S. Kanaly, K. L. Stocking, J. Schurr, P. Schwarzenberger, P. Oliver, W. Huang, P. Zhang, J. Zhang, et al 2001. Requirement of interleukin 17 receptor signaling for lung CXC chemokine and granulocyte colony-stimulating factor expression, neutrophil recruitment, and host defense. J. Exp. Med. 194:519.-527. [Abstract/Free Full Text]
  57. Hoshino, H., J. Lotvall, B. E. Skoogh, A. Linden. 1999. Neutrophil recruitment by interleukin-17 into rat airways in vivo: role of tachykinins. Am. J. Respir. Crit. Care Med. 159:1423.-1428. [Abstract/Free Full Text]
  58. Kawaguchi, M., F. Kokubu, H. Kuga, S. Matsukura, H. Hoshino, K. Ieki, T. Imai, M. Adachi, S. K. Huang. 2001. Modulation of bronchial epithelial cells by IL-17. J. Allergy Clin. Immunol. 108:804.-809. [Medline]
  59. Jones, C. E., K. Chan. 2002. Interleukin-17 stimulates the expression of interleukin-8, growth-related oncogene-{alpha}, and granulocyte-colony-stimulating factor by human airway epithelial cells. Am. J. Respir. Cell Mol. Biol. 26:748.-753. [Abstract/Free Full Text]
  60. Tsutsumi-Ishii, Y., I. Nagaoka. 2002. NF-{kappa}B-mediated transcriptional regulation of human {beta}-defensin-2 gene following lipopolysaccharide stimulation. J. Leukocyte Biol. 71:154.-162. [Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Immunol.Home page
T. Fujisawa, S. Velichko, P. Thai, L.-Y. Hung, F. Huang, and R. Wu
Regulation of Airway MUC5AC Expression by IL-1{beta} and IL-17A; the NF-{kappa}B Paradigm
J. Immunol., November 15, 2009; 183(10): 6236 - 6243.
[Abstract] [Full Text] [PDF]


Home page
Sci Transl MedHome page
M. Shan, H.-F. Cheng, L.-z. Song, L. Roberts, L. Green, J. Hacken-Bitar, J. Huh, F. Bakaeen, H. O. Coxson, C. Storness-Bliss, et al.
Lung Myeloid Dendritic Cells Coordinately Induce TH1 and TH17 Responses in Human Emphysema
Science Translational Medicine, October 28, 2009; 1(4): 4ra10 - 4ra10.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
B. D. Medoff, A. L. Landry, K. A. Wittbold, B. P. Sandall, M. C. Derby, Z. Cao, J. C. Adams, and R. J. Xavier
CARMA3 Mediates Lysophosphatidic Acid-Stimulated Cytokine Secretion by Bronchial Epithelial Cells
Am. J. Respir. Cell Mol. Biol., March 1, 2009; 40(3): 286 - 294.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
H. R. Conti, F. Shen, N. Nayyar, E. Stocum, J. N. Sun, M. J. Lindemann, A. W. Ho, J. H. Hai, J. J. Yu, J. W. Jung, et al.
Th17 cells and IL-17 receptor signaling are essential for mucosal host defense against oral candidiasis
J. Exp. Med., February 16, 2009; 206(2): 299 - 311.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
J. L. Kreindler, C. A. Bertrand, R. J. Lee, T. Karasic, S. Aujla, J. M. Pilewski, R. A. Frizzell, and J. K. Kolls
Interleukin-17A induces bicarbonate secretion in normal human bronchial epithelial cells
Am J Physiol Lung Cell Mol Physiol, February 1, 2009; 296(2): L257 - L266.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Peric, S. Koglin, S.-M. Kim, S. Morizane, R. Besch, J. C. Prinz, T. Ruzicka, R. L. Gallo, and J. Schauber
IL-17A Enhances Vitamin D3-Induced Expression of Cathelicidin Antimicrobial Peptide in Human Keratinocytes
J. Immunol., December 15, 2008; 181(12): 8504 - 8512.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
E. Guttman-Yassky, M. A. Lowes, J. Fuentes-Duculan, L. C. Zaba, I. Cardinale, K. E. Nograles, A. Khatcherian, I. Novitskaya, J. A. Carucci, R. Bergman, et al.
Low Expression of the IL-23/Th17 Pathway in Atopic Dermatitis Compared to Psoriasis
J. Immunol., November 15, 2008; 181(10): 7420 - 7427.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. Song, L. Luo, Z. Lei, B. Li, Z. Liang, G. Liu, D. Li, G. Zhang, B. Huang, and Z.-H. Feng
IL-17-Producing Alveolar Macrophages Mediate Allergic Lung Inflammation Related to Asthma
J. Immunol., November 1, 2008; 181(9): 6117 - 6124.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Pene, S. Chevalier, L. Preisser, E. Venereau, M.-H. Guilleux, S. Ghannam, J.-P. Moles, Y. Danger, E. Ravon, S. Lesaux, et al.
Chronically Inflamed Human Tissues Are Infiltrated by Highly Differentiated Th17 Lymphocytes
J. Immunol., June 1, 2008; 180(11): 7423 - 7430.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C.-Y. Kao, C. Kim, F. Huang, and R. Wu
Requirements for Two Proximal NF-{kappa}B Binding Sites and I{kappa}B-{zeta} in IL-17A-induced Human {beta}-Defensin 2 Expression by Conducting Airway Epithelium
J. Biol. Chem., May 30, 2008; 283(22): 15309 - 15318.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
J. S. Tzartos, M. A. Friese, M. J. Craner, J. Palace, J. Newcombe, M. M. Esiri, and L. Fugger
Interleukin-17 Production in Central Nervous System-Infiltrating T Cells and Glial Cells Is Associated with Active Disease in Multiple Sclerosis
Am. J. Pathol., January 1, 2008; 172(1): 146 - 155.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
F. Huang, C.-Y. Kao, S. Wachi, P. Thai, J. Ryu, and R. Wu
Requirement for Both JAK-Mediated PI3K Signaling and ACT1/TRAF6/TAK1-Dependent NF-{kappa}B Activation by IL-17A in Enhancing Cytokine Expression in Human Airway Epithelial Cells
J. Immunol., November 15, 2007; 179(10): 6504 - 6513.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. R. Kim, K. S. Lee, S. J. Park, K. H. Min, K. Y. Lee, Y. H. Choe, Y. R. Lee, J. S. Kim, S. J. Hong, and Y. C. Lee
PTEN Down-Regulates IL-17 Expression in a Murine Model of Toluene Diisocyanate-Induced Airway Disease
J. Immunol., November 15, 2007; 179(10): 6820 - 6829.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
M. Facco, I. Baesso, M. Miorin, M. Bortoli, A. Cabrelle, E. Boscaro, C. Gurrieri, L. Trentin, R. Zambello, F. Calabrese, et al.
Expression and role of CCR6/CCL20 chemokine axis in pulmonary sarcoidosis
J. Leukoc. Biol., October 1, 2007; 82(4): 946 - 955.
[Abstract] [Full Text] [PDF]


Home page
Sci SignalHome page
A. Linden
A Role for the Cytoplasmic Adaptor Protein Act1 in Mediating IL-17 Signaling
Sci. Signal., August 7, 2007; 2007(398): re4 - re4.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
A. Elizur, T. L. Adair-Kirk, D. G. Kelley, G. L. Griffin, D. E. deMello, and R. M. Senior
Clara cells impact the pulmonary innate immune response to LPS
Am J Physiol Lung Cell Mol Physiol, August 1, 2007; 293(2): L383 - L392.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
S. Wiehler and D. Proud
Interleukin-17A modulates human airway epithelial responses to human rhinovirus infection
Am J Physiol Lung Cell Mol Physiol, August 1, 2007; 293(2): L505 - L515.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
R. Malley, A. Srivastava, M. Lipsitch, C. M. Thompson, C. Watkins, A. Tzianabos, and P. W. Anderson
Antibody-Independent, Interleukin-17A-Mediated, Cross-Serotype Immunity to Pneumococci in Mice Immunized Intranasally with the Cell Wall Polysaccharide
Infect. Immun., April 1, 2006; 74(4): 2187 - 2195.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kao, C.-Y.
Right arrow Articles by Wu, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kao, C.-Y.
Right arrow Articles by Wu, R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS