The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nagarajan, U. M.
Right arrow Articles by Darville, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nagarajan, U. M.
Right arrow Articles by Darville, T.
The Journal of Immunology, 2005, 175: 450-460.
Copyright © 2005 by The American Association of Immunologists

Chlamydia trachomatis Induces Expression of IFN-{gamma}-Inducible Protein 10 and IFN-{beta} Independent of TLR2 and TLR4, but Largely Dependent on MyD881

Uma M. Nagarajan2,*,{dagger}, David M. Ojcius{ddagger},§, Lynn Stahl{ddagger},§, Roger G. Rank{dagger} and Toni Darville*,{dagger}

* Division of Pediatric Infectious Diseases, Arkansas Children’s Hospital, Little Rock, AR 72202; {dagger} Department of Microbiology and Immunology, University of Arkansas for Medical Sciences, Little Rock, AR 72205; {ddagger} Université Paris–Denis Diderot, Institut Jacques Monod, Paris, France; and § School of Natural Sciences, University of California, Merced, CA 95344


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
IFN-{gamma}-inducible protein 10 (IP-10) is a chemokine important in the attraction of T cells, which are essential for resolution of chlamydial genital tract infection. During infections with Gram-negative bacteria, the IP-10 response mediated through type I IFNs usually occurs as a result of TLR4 stimulation by bacterial LPS. However, we found that levels of IP-10 in genital tract secretions of Chlamydia trachomatis-infected female wild-type mice were similar to those of infected TLR2- and TLR4-deficient mice but significantly greater than those of infected MyD88-deficient mice. We investigated the mechanism of IP-10 and IFN-{beta} induction during chlamydial infection using mouse macrophages and fibroblasts infected ex vivo. The induction of IP-10 and IFN-{beta} was unchanged in Chlamydia-infected TLR2- and TLR4-deficient cells compared with wild-type cells. However, infection of MyD88-deficient cells resulted in significantly decreased responses. These results suggest a role for MyD88-dependent pathways in induction of IP-10 and IFN-{beta} during chlamydial infection. Furthermore, treatment of infected macrophages with an endosomal maturation inhibitor significantly reduced chlamydial-induced IFN-{beta}. Because endosomal maturation is required for MyD88-dependent intracellular pathogen recognition receptors to function, our data suggest a role for the intracellular pathogen recognition receptor(s) in induction of IFN-{beta} and IP-10 during chlamydial infection. Furthermore, the intracellular pathways that lead to chlamydial-induced IFN-{beta} function through TANK-binding kinase mediated phosphorylation and nuclear translocation of IFN regulatory factor-3.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Chlamydia trachomatis is a common sexually transmitted bacterial pathogen (1) that can cause oviduct inflammation and subsequent tubal infertility (2). The first line of defense against chlamydiae is the innate immune response. The cytokines/chemokines produced during the innate response recruit inflammatory cells and T cells that are needed for adaptive immunity. The T cell-dependent adaptive immune response and subsequent chlamydial clearance is predominated by IL-12- and IFN-{gamma}-dependent mechanisms (3, 4, 5, 6, 7).

One of the major players of the innate immune response to pathogens is the TLR, which is expressed on immune cells (reviewed in Ref. 8) as well as multiple other cell types (9, 10). The recognition of pathogen-associated molecular patterns (PAMP)3 by TLRs leads to signaling events and coordinated activation of transcription factors that induce the expression of antimicrobial molecules, chemokines, cytokines, and costimulatory molecules (11). Therefore, elucidating the TLR involved in initiation of the immune response to chlamydial infection is clearly a primary step to understanding its molecular pathogenesis.

We reported previously that Tlr2 knockout mice (TLR2–/–) infected genitally with the mouse pneumonitis (MoPn) agent of C. trachomatis (also known as C. muridarum) had significantly lower inflammatory cytokine responses, including TNF-{alpha} and MIP-2, and less oviduct pathology compared with infected wild-type (WT) mice (12). Despite lower cytokine responses, the TLR2–/– mice cleared infection at a rate similar to WT mice. Tlr4 knockout mice (TLR4–/–) infected with MoPn responded like WT mice with respect to both cytokine response and clearance of infection. Because it is well documented that T cells play a major role in clearing Chlamydia infection (7, 13, 14), the results from the TLR2–/– and TLR4–/– mice suggest the influx of T cells to the site of infection was unaffected.

IFN-{gamma}-inducible protein 10 (IP-10) is an important chemokine involved in T cell recruitment (15). IP-10 is induced by both type I (IFN-{alpha} and IFN-{beta}) and type II IFN (16, 17). Besides its role in inducing IP-10, type I IFNs also induce expression of MCP-5, RANTES, and GARG-16 and has been implicated in Th1 maturation (18). IFN-{beta} has also been shown to augment dendritic cell (DC) expression of IL-12 and CD40, both essential in generating robust T cell responses (19). It has been reported that IP-10 is produced in the upper and lower genital tract of mice infected with chlamydiae (20). Furthermore, murine DC pulsed in vitro with C. trachomatis (21) and a murine oviduct epithelial cell line have been reported to up-regulate expression of IP-10 during MoPn infection (22). It has also been shown that IFN-{beta} is induced in McCoy cells during C. trachomatis infection (23). However, the molecular pathways involved in IP-10 and IFN-{beta} induction during chlamydial infection have not yet been described.

TLRs play a major role in induction of type I IFN, in response to bacterial and viral infection (reviewed in Ref. 24). Cross-linking TLR3 and TLR4 by viral dsRNA and LPS, respectively, has been shown to induce IFN-{alpha} and IFN-{beta} (25, 26). Type I IFNs are also induced when TLR7 and TLR9 bind to their ligands, ssRNA and bacterial CpG DNA, respectively (27, 28). However, the signaling pathways by which the different TLRs mediate induction of type I IFNs differ distinctly. TLR3- and TLR4-mediated type I IFN induction is independent of the central downstream adaptor molecule MyD88 (reviewed in Ref. 29), whereas TLR7 and TLR9 mediate induction of type I IFNs in a MyD88-dependent manner (27, 28). However, both pathways lead to phosphorylation of IFN regulatory factor-3 (IRF3), a transcription factor essential for IFN-{beta} production by the TANK-binding kinase (TBK) (30).

In this study, the role of IFN-{beta} in the induction of IP-10 during MoPn (C. trachomatis) infection was established in vitro, and the contribution of TLR in IP-10 and IFN-{beta} induction was explored using murine macrophages and fibroblasts. Chlamydial-induced IP-10 and IFN-{beta} were found to be completely independent of TLR2 and TLR4 but significantly dependent on MyD88. The TLR4 independence of chlamydial-induced IFN-{beta} expression was surprising, because TLR4 is the major receptor that binds bacterial LPS to induce IFN-{beta} (31). Preliminary evidence using an endosomal maturation inhibitor suggests a role for intracellular TLR or other pathogen recognition receptors (PRRs) that function in a MyD88-dependent manner to induce IFN-{beta} during chlamydial infection. Furthermore, the role of TBK-mediated phosphorylation of IRF3 and its nuclear translocation for IFN-{beta} induction was established.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Reagents and immunochemicals

Escherichia coli LPS (InvivoGen) and Staphylococcus aureus peptidoglycan (PGN; Lee Labs) were used as positive controls for TLR4 and TLR2 stimulation, respectively. Although PGN is no longer considered a ligand for TLR2, contaminants in the S. aureus PGN preparation are known to be strong agonists for TLR2 (32). Bafilomycin was obtained from Sigma-Aldrich. Anti-mouse IFN-{beta} (PBL Biomedical Laboratories), anti-mouse actin (Sigma Immunochemicals), and anti-mouse IRF3 (Zymed Laboratories) Abs were purchased as indicated. All ELISA kits were from R&D Laboratories.

Animals and cell lines

Tlr2 gene knockout mice (TLR2–/–) were kind gifts from Dr. S. Akira (Department of Host Defense, Research Institute for Microbial Diseases, Osaka, Japan) (33). Because they have not been sufficiently backcrossed to the C57BL/6 background, the heterozygous F1 generations from a cross of C57BL/6 and TLR2–/– mice were used as controls for TLR2–/– mice. However, because there were no differences in infection rates or cytokine levels between C57BL/6 mice and F1 progeny of C57BL/6 x TLR2–/– mice (12), C57BL/6 mice were used as controls for macrophage experiments. MyD88 gene knockout mice or MyD88–/– mice (originally from Dr. Akira) (34) were purchased from the Centre de La Recherche Scientifique and have been previously backcrossed with C57BL/6 mice over 10 generations (35, 36); therefore, C57BL/6 mice were used as controls for MyD88–/– mice. TLR4lps-del (hereafter referred to as TLR4–/–) mice have a deletion in the TLR4 gene (C57BL/10SCN) and were obtained from The Jackson Laboratory. C57BL/10 mice (The Jackson Laboratory) or C57BL/6 mice were used as controls for TLR4–/– in vivo experiments, because they displayed similar infection kinetics. IFN-{alpha}{beta} receptor–/– mice (A129) and their corresponding WT controls (129Sv/Ev) were obtained from B & K Universal. Mice between 8 and 12 wk of age were used and were age matched for all experiments. Mice were given food and water ad libitum in an environmentally controlled room with 12-h light and 12-h dark cycles. All animal experiments were preapproved by the Institutional Animal Care and Use Committee of the University of Arkansas Medical Sciences. WT and TBK–/– mouse embryonic fibroblasts were kind gifts from Dr. W.-C. Yeh (University Health Network, Toronto, Ontario, Canada) (37) and were maintained in DMEM with 10% FBS, 1 mM glutamine, and 50 µg/ml gentamicin.

Murine genital infection with MoPn and analysis of IP-10 in genital secretions

Mice received 2.5 mg of Depoprovera (medroxyprogesterone acetate) in 0.1 ml of saline (Upjohn) s.c., 7 days before vaginal infection. Mice were anesthetized using sodium pentobarbital and infected by placing MoPn (1 x 107 inclusion-forming units (IFU) in 30 µl of buffer (250 mM sucrose, 10 mM sodium phosphate, and 5 mM L-glutamic acid (pH 7.2)) into the vaginal vault. Mice were monitored by swabbing the vaginal vault and cervix with a calcium alginate swab (Spectrum Medical Industries) at various times after infection and by enumerating IFU using McCoy cell monolayers (38). Mice were infected in groups of five, and each experiment was repeated at least once. Genital tract secretions were collected as described previously (12), and IP-10 levels in individual genital tract sponge eluates were determined by ELISA.

Isolation of murine macrophages and lung fibroblasts

Peritoneal macrophages were obtained from mice that were given injections of 3% thioglycolate medium 3 days before harvesting. To harvest macrophages, mice were killed, and their peritoneal cavities were washed three times with culture medium (RPMI 1640 containing 10% FBS, 2 mM glutamine, 10 mM HEPES (pH 7.4), 100 µM nonessential amino acids, 1 mM sodium pyruvate, 50 µM 2-ME, and 50 µg/ml gentamicin). The macrophages in culture medium were plated either in 24-well plates (7 x 105 cells/well) containing coverslips to stain for chlamydial inclusions or in 6-well plates (2.5 x 106 cells/well) for RNA preparations. Mouse peritoneal macrophages collected after thioglycolate treatment were kept in culture conditions for 24–48 h before infection. Bone marrow-derived macrophages (BMDMs) were prepared by flushing the femur and tibia of mice using a 27.5-gauge needle and culturing the cells as described by Kambayashi et al. (39) in the presence of IL-4 (10 ng/ml) and GM-CSF (100 ng/ml) for 5 days at 37°C in a 7.5% CO2 incubator. After removing the nonadherent DCs, the adherent macrophages were used for infection. Lung fibroblasts from WT or TLR-deficient mice were isolated as described previously (12, 40) and cultured for 5–6 days before infecting with C. trachomatis.

Chlamydial stocks and in vitro infection of macrophages

The MoPn agent of C. trachomatis (Nigg) was grown in mycoplasma-free McCoy cells. Elementary bodies (EBs) were harvested from infected cells, resuspended in buffer (250 mM sucrose, 10 mM sodium phosphate, and 5 mM L-glutamic acid (pH 7.2)), and quantified as IFU as described previously (41). One multiplicity of infection (MOI) is equivalent to one infectious EB per cell. To infect murine macrophages, culture medium (1–2 ml) containing the required amounts of chlamydial EBs corresponding to 1 or 5 MOI were added. UV-inactivated EBs prepared by exposing purified EBs to UV light in a laminar flow hood for 3 h (12), and confirmed free of infectious organisms, were applied to wells containing macrophages in an identical fashion. Cells were spun at 1800 x g for 60 min at 37°C. Media were replaced after centrifugation to remove nonadherent chlamydial EBs, and macrophages were incubated at 37°C in a 5% CO2 incubator for various time periods. Macrophage supernatants collected at 24 h were frozen at –80°C and analyzed later for cytokines/chemokines by ELISA. To determine the level of infection, cells on coverslips were fixed with methanol for at least 10 min at 24 h postinfection (p.i.) and stained for chlamydial inclusions using the Pathfinder FITC-conjugated murine anti-chlamydial mAb according to the manufacturer’s instructions (Bio-Rad). Inclusions were viewed using an Olympus fluorescent microscope (Olympus). Infection with a MOI of 1 and 5 MoPn in macrophages results in infection of 20–30% and >80% of the cells, respectively, whereas infection of murine fibroblasts with a MOI of 0.25 results in infection of 20–30% of the cells.

RNA extraction and real-time PCR

RNA was prepared using the RNeasy kit (Qiagen). Total RNA (500 ng) was DNase treated in buffer containing 1x PCR buffer (Applied Biosystems), 3 mM MgCl2, 0.5 mM dNTP, 1 µM oligo(dT), 1 µM random hexamer, 10 U of Rnasin, and 1 U of RNase-free DNaseI (Promega) in a total volume of 20 µl, at 37°C for 15 min. DNase was inactivated at 65°C for 10 min, and reverse transcription (RT) was conducted by adding 100 U of Superscipt RT II (Invitrogen Life Technologies) to the above reaction. RT reactions without Superscript II (–RT) were used as negative controls. Reactions were conducted as per the manufacturer’s instructions (Invitrogen Life Technologies). The reaction mixture was diluted to 200 µl after RT, and 2.5 µl of cDNA mixture was used for quantitative PCR. PCR primers for {beta}-actin, TNF-{alpha}, IFN-{alpha}, IFN-{beta}, IFN-{gamma}, and IP-10 were generated using Beacon Designer software (Bio-Rad) (Table I). Quantitative PCR was conducted using the IQ-SYBR mix (Bio-Rad) in a Bio-Rad iCycler. Reaction volumes were limited to 12.5 µl containing 2.5 µl of cDNA mix, with 50 nM of sense and antisense primers. After an initial denaturation step at 95°C for 3 min, 40 cycles of two-step PCR with 10 s of denaturation at 95°C and 1 min of annealing/extension at 60°C was used for all reactions. A melt curve was performed for all reactions to check for product integrity and primer-dimer formation. Standard curves were generated for each gene of interest using dilutions of purified PCR products at known concentrations. All PCR primers had efficiencies of >95%. PCRs using primers for {beta}-actin mRNA were conducted to provide a normalization reference. The concentrations for all genes were normalized to {beta}-actin levels in each sample, and the data are presented as normalized cDNA in picograms or femtograms.


View this table:
[in this window]
[in a new window]
 
Table I. Primers used for quantitative RT-PCR in macrophages

 
For lung fibroblasts, RNA preparation and RT from uninfected and infected fibroblasts were conducted as described above. Quantitative PCR was performed with 1/50 of the cDNA preparation in the Mx3000P (Stratagene) in 25-µl final volumes with the Brilliant QPCR Master Mix (Stratagene). cDNA was amplified using 300 nM of each specific sense and antisense primers. We also used 100 nM of the fluorogenic oligonucleotides specific for the gene segments in which a reporter fluorescent dye on 5' (FAM) and a quencher dye on 3' (TAMRA) were attached. For {beta}-actin, the primers used were as follows: sense primer, AGAGGGAAATCGTGCGTGAC; antisense primer, CAATAGTGATGACCTGGCCGT; probe, CACTGCCGCATCCTCTTCCTCCC. For IP-10, the primers used were as follows: sense primer, GCCGTCATTTTCTGCCTCAT; antisense primer, GCTTCCCTATGGCCCTCATT; probe, TCTCGCAAGGACGGTCCGCTG. Quantitative PCR was conducted at 95°C for 10 min, followed by 40 cycles at 95°C for 15 s, 60°C for 1 min, and 72°C for 30 s. The expression levels of IP-10 cDNA were compared with {beta}-actin and normalized to uninfected WT fibroblast responses by the comparative cycle threshold method, as described by the manufacturer (Stratagene).

Subcellular fractionation and Western blots

Macrophages harvested at 3 or 8 h p.i. were processed to isolate nuclear fractions as described previously, with some modifications (42). Briefly, 300 µl of cold buffer A (10 mM HEPES (pH 7.9), 10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM DTT, and 0.5 mM PMSF) were added to the macrophages, and the plates were left on ice for 15 min, followed by the addition of 20 µl of 10% Nonidet P-40. The cell lysates were transferred to a microfuge tube, vortexed for 20–30 s, and spun at 3000 rpm for 5 min at 4°C to spin down the nuclei. The cytoplasmic fraction was saved, and the nuclear pellet was washed once with buffer A containing 1% Nonidet P-40. Nuclei were lysed in 100 µl of buffer B (20 mM HEPES (pH 7.9), 400 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, and 1 mM PMSF) and rocked at 4°C for 1 h. The lysate was cleared by centrifugation at 14,000 rpm for 10 min. Protein concentration of the nuclear extracts was determined using the Bradford dye method (Bio-Rad), and 10 µg of protein were separated on a 9% SDS-PAGE. Gels were processed for Western blotting as described previously (43). The immunoblots were stained with Abs to IRF3 or actin, followed by HRP-coupled anti-rabbit or anti-mouse secondary Abs (US Biologicals). Blots were developed using the ECL chemiluminescent system (Amersham Biosciences).

Statistics

Statistical comparisons between the murine strains for level of infection and cytokine production over the course of infection were made by a two-factor (days and murine strain) ANOVA with post hoc Tukey’s test as a multiple comparison procedure. The Wilcoxon rank sum test was used to compare the duration of infection in the respective strains over time. Quantitative PCR data are provided as mean values of triplicate samples with SD, from a representative experiment. One-way ANOVA was used to analyze differences in cDNA/protein levels among various in vitro groups. SigmaStat software was used for statistical analyses (SPSS Science).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
IP-10 is produced independent of TLR2 and TLR4 but partly dependent on MyD88 during in vivo infection of mice with MoPn

IP-10 is a predominant chemokine induced in the upper reproductive tract in female mice during infection with MoPn (20). We have shown previously that TLR2 plays a predominant role in inflammatory cytokine (TNF-{alpha}, IL-6) production in cells infected with C. trachomatis (12). However, TLR4 is the major mediator of bacterial LPS-mediated IP-10 responses, and this induction normally occurs independently of MyD88 (44, 45). To begin identifying the specific TLR responsible for IP-10 expression during chlamydial infection in vivo, IP-10 levels in genital tract secretions from MoPn-infected WT, TLR2–/–, TLR4–/–, and MyD88–/– mice, and corresponding control female mice, were analyzed by ELISA. The overall IP-10 response in infected TLR2–/– mice was not significantly different from WT mice when compared by two-way ANOVA (Fig. 1A). Likewise, the levels of IP-10 detected in secretions from TLR4–/– mice paralleled those of the control group (Fig. 1B). In contrast, levels of IP-10 detected in secretions of the MyD88–/– group were significantly lower than in the WT control group (p < 0.001, two-way ANOVA), although their IP-10 response was not abolished (Fig. 1C). Significant decreases on days 2–20 were revealed by Tukey’s test (data not shown). These findings suggest induction of IP-10 after chlamydial infection in vivo may be independent of TLR2 and TLR4 but partly dependent on MyD88. Furthermore, the levels of IP-10 in the infected MyD88–/– mice correlated with their ability to clear MoPn infection at a reduced rate compared with WT controls (Fig. 1D). These results are in contrast to the results from TLR2–/– and TLR4–/– mice, which we have recently shown to clear infection at the same rate as their respective control groups (12).



View larger version (27K):
[in this window]
[in a new window]
 
FIGURE 1. IP-10 protein levels in genital secretions from MoPn-infected WT and TLR2-, TLR4-, and MyD88-deficient mice. Genital infection of WT and knockout mice with MoPn were conducted as described in Materials and Methods. A–C, Genital secretions obtained from different time points were analyzed for IP-10 protein by ELISA. Two-way ANOVA was performed for comparing the groups over time (p < 0.001 for WT vs MyD88). D, IFU enumerations from genital swabs from control vs MyD88–/– mice. Each group represents averages of data collected from five mice, with SEs indicated. The number of animals in each group that tested positive at each time point is indicated.

 
IP-10 and IFN-{beta} are induced in murine macrophages during MoPn infection in vitro

The levels of IP-10 seen in vivo are likely a net result of IP-10 secreted by several cell types after primary and secondary events during multiple rounds of infection. The exact cell type producing IP-10 or responding to IP-10 in vivo is not known. However, the surprising lack of role for TLR4 in IP-10 induction during in vivo infection led us to investigate the phenomenon using primary cells derived from the knockout mice. Murine macrophages express high levels of all TLRs, except TLR3 (46), and support MoPn infection, making them suitable for studying cytokine/chemokine responses to chlamydial infection. When macrophages were infected in vitro, IP-10 mRNA was induced very early during infection (by 3 h) and remained elevated through 24 h (Fig. 2A), whereas no induction was observed with UV-inactivated bacteria. The mRNA data were corroborated by IP-10 protein levels in the infected culture supernatants, as determined by ELISA (data not shown).



View larger version (33K):
[in this window]
[in a new window]
 
FIGURE 2. IP-10 and IFN-{beta} are induced during in vitro chlamydial infection of macrophages. Gel analysis of RT-PCR products (with or without the reverse transcriptase) after 30 cycles of PCR shows IP-10 and IFN induction in mouse peritoneal macrophages at the indicated time points after infection (A) and IFN expression in BMDMs at 6 h p.i. (B). Actin serves as a loading control.

 
Previous reports have shown that IP-10 expression is regulated by type I and type II IFNs (16). Before studying IFN-mediated IP-10 induction, we first determined whether chlamydial infection of macrophages results in induction of IFNs. IFN-{beta} was the primary IFN induced, and its induction starts as early as 3 h p.i. and increases through 24 h (Fig. 2A). Low levels of IFN-{alpha} message were detected at 24 h p.i. with 5 MOI, whereas no IFN-{gamma} message was detected during the time course studied (Fig. 2A). These findings with respect to IFN-{alpha} and IFN-{gamma} are in contrast to a previous report showing IFN-{alpha} and IFN-{gamma} production by mouse BMDMs infected in vitro with C. pneumoniae (47). Therefore, we determined whether IFN-{alpha} induction occurs in MoPn-infected BMDMs. As observed with murine peritoneal macrophages, IFN-{beta} was the major type I IFN made by BMDMs after MoPn infection (Fig. 2B). However, significant amounts of IFN-{alpha} mRNA and low but detectable levels of IFN-{gamma} mRNA were also made (Fig. 2B), consistent with previous results obtained with C. pneumoniae (47). Notably, UV-inactivated bacteria failed to induce any IFN response from either peritoneal macrophages or BMDMs, indicating that infectious bacteria are necessary for this response.

Unlike other human oculogenital serovars of C. trachomatis, the mouse C. trachomatis (MoPn) strain can grow well in macrophages (reviewed in Ref. 48). Therefore, to rule out the possibility that IP-10 and IFN-{beta} induction during MoPn infection is unique to macrophages, we determined whether IFN-{beta} induction occurs in cell types other than macrophages. Murine embryonic fibroblasts (MEFs) and lung fibroblasts derived from WT mice were infected with MoPn and assayed for IFN-{beta} mRNA. IFN-{beta} induction was observed in response to MoPn infection in both types of primary fibroblasts; however, the levels were several fold lower than those found in infected macrophages (data not shown). These studies also confirm that chlamydial infection results in IP-10 and IFN-{beta} induction.

IP-10 induction is dependent on IFN-{beta} during MoPn infection of murine macrophages

Because IP-10 induction has been shown to be largely dependent on type I and type II IFNs (17), we determined whether IP-10 induction is dependent on IFN-{beta} after chlamydial infection. Peritoneal macrophages derived from IFN-{alpha}/{beta} receptor–/– mice (A129) and corresponding WT controls (129Sv/Ev) were infected with MoPn. Cells were harvested at the indicated time points for quantitative RT-PCR, and supernatants were collected for protein analysis. Compared with macrophages derived from the WT mice, the IP-10 mRNA (Fig. 3A) and protein levels (B) were nearly abolished in IFN-{alpha}{beta} receptor knockout mice, suggesting a direct role of type I IFN in IP-10 induction.



View larger version (27K):
[in this window]
[in a new window]
 
FIGURE 3. IP-10 induction during chlamydial infection in macrophages is dependent on IFN-{beta}. Macrophages derived from A129 mice (IFN-{alpha}/{beta}R–/– mice) and its corresponding WT controls (129Sv/Ev) were infected with MoPn. At different time intervals, cells were harvested and analyzed for IP-10 mRNA (A), and the supernatant was collected at 24 h to assay for IP-10 protein (B). Macrophages were infected with the MoPn strain, and variable concentrations of IFN-{beta} Ab were added to the cell culture. Eighteen hours after infection, cells were harvested and analyzed for IP-10 mRNA by quantitative RT-PCR (C), and the supernatants were analyzed for IP-10 protein by ELISA (D). A representative of three experiments is shown. Each sample was performed in triplicate, and the SDs are shown.

 
To also confirm the role of IFN-{beta} in induction of the IP-10 response during chlamydial infection, macrophages from WT mice were infected with 1 MOI of MoPn in the presence of increasing concentrations of neutralizing anti-IFN-{beta} Ab. With increasing concentration of Ab, dose-dependent decreases in IP-10 mRNA (Fig. 3C) and protein (D) were observed. These results indicate IFN-{beta} mediates IP-10 induction during chlamydial infection of macrophages.

IP-10 induction during MoPn infection of macrophages is independent of TLR2 and TLR4 but partly dependent on MyD88

TLR4, but not TLR2, has been shown to play a major role in bacterial LPS-induced IP-10, and this induction is independent of the downstream adaptor molecule MyD88 (25). To investigate the role of TLR2 and TLR4 in chlamydial-induced induction of IP-10, we compared IP-10 mRNA levels in WT, TLR2–/–, and TLR4–/– macrophages after MoPn infection (Fig. 4A). In WT and TLR2–/– macrophages, IP-10 induction was detected as early as 3 h p.i. and progressively increased over time through 24 h (Fig. 4A). MoPn-infected TLR4–/– macrophages showed induction of IP-10 at levels similar to those seen with WT macrophages (Fig. 4A). At 8 h p.i, increased levels of the IP-10 message were observed in TLR2–/– macrophages compared with WT macrophages at 5 MOI (p = 0.033 for WT vs TLR2–/– by one-way ANOVA). Results with infection at a MOI of 1 were similar (data not shown). However, by 24 h, no significant differences were observed between WT, TLR2–/–, and TLR4–/– macrophages in IP-10 mRNA levels. Under similar conditions, E. coli LPS, a TLR4 ligand, was unable to turn on IP-10 mRNA in TLR4–/– macrophages (Fig. 4A), as expected. Protein levels for IP-10 determined in supernatants paralleled the mRNA response at 24 h (data not shown). These findings indicate chlamydial-induced IP-10 is not dependent on TLR2 and TLR4.



View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 4. Induction of IP-10 mRNA is TLR4 independent and partially dependent on MyD88 in MoPn-infected macrophages. A, Macrophages derived from TLR2–/– and TLR4–/– mice and their corresponding control mice were infected with the MoPn strain, and cells were harvested and analyzed for IP-10 mRNA. UV-inactivated bacteria (UV-in) were infected the same way as live EB. E. coli LPS (ligand for TLR4) and commercially available PGN (ligand for TLR2) were used as positive control. Cells treated with medium, LPS, PGN, and UV-inactivated MoPn were harvested at 3 h, and the infected cells were harvested at the indicated time points. B indicates a similar experiment with MyD88–/– macrophages. A representative experiment of four experiments is shown. Each sample was performed in triplicate, and the SDs are shown.

 
Because MyD88 is the downstream adaptor molecule for most TLRs (49), the role of MyD88 in IP-10 induction during MoPn infection was determined using MyD88–/– macrophages. MyD88–/– and WT macrophages were infected with MoPn, and their IP-10 responses were compared. A reduction in IP-10 transcripts (~33% with 1 MOI (data not shown) and ~75% with 5 MOI) was observed at the 24 h time point in MyD88–/– macrophages compared with WT (Fig. 4B). The decrease in IP-10 levels in MyD88–/– macrophages was statistically significant at both 1 and 5 MOI and at all three time points tested (p < 0.001, p = 0.002, and p = 0.002, at 3, 8, and 24 h, respectively, with 5 MOI by one-way ANOVA). The levels of IP-10 protein detected in supernatants revealed an even greater effect of MyD88 deficiency on IP-10 production (p < 0.001; data not shown). However, expression of IP-10 mRNA and protein was not abolished in MyD88–/– macrophages after infection, suggesting that some of its induction (~25% of WT) may be mediated through a MyD88-independent pathway. To verify that the MyD88-independent pathway is intact in MyD88–/– macrophages, E. coli LPS was used as a control. The IP-10 mRNA levels detected from MyD88–/– macrophages treated with E. coli LPS for 3 h were similar to WT macrophages, confirming that the TLR4-mediated, MyD88-independent pathway was unaffected in these cells (Fig. 4B). Thus, chlamydial-induced IP-10 production is largely but not completely dependent on MyD88.

To verify that the TLR and MyD88 dependence of IP-10 production was not limited to macrophages, the expression of the IP-10 gene was also measured in primary lung fibroblasts isolated from TLR2–/–, TLR4–/–, and MyD88–/– mice. Infection of the fibroblasts with MoPn led to a large increase in transcription of the IP-10 gene (Fig. 5A). Lower levels of transcription were found consistently in TLR2 fibroblasts compared with WT fibroblasts (Fig. 5A). This finding is in agreement with the decrease in production of IP-10 mRNA and protein in TLR2 macrophages. A smaller difference was observed between WT and TLR4 fibroblasts infected with Chlamydia (Fig. 5B). Dramatically lower levels of IP-10 gene transcription were observed in infected MyD88–/– fibroblasts (Fig. 5C).



View larger version (15K):
[in this window]
[in a new window]
 
FIGURE 5. The IP-10 gene is transcribed during chlamydial infection of lung fibroblasts. Lung fibroblasts isolated from TLR2–/–, TLR4–/–, and MyD88–/– mice were infected with the MoPn strain for 24 h, and cells were analyzed for IP-10 mRNA by real-time PCR. A, TLR2–/– fibroblasts were infected at a MOI of 0.25. B, TLR4–/– fibroblasts were infected at a MOI of 0.25. C, MyD88–/– fibroblasts were infected at a MOI of 0.5. A representative experiment of at least three separate experiments is shown for each phenotype.

 
These results from MoPn-infected macrophages and fibroblasts suggest that chlamydial-induced IP-10 gene transcription is mostly independent of TLR4 but dependent on MyD88, regardless of the cell type used for infection. Furthermore, these results suggest stimulation of both MyD88-dependent and MyD88-independent pathways of IP-10 induction. This induction may be mediated by different chlamydial PAMP and multiple host PRRs. We have reported previously that MoPn-induced production of TNF-{alpha} by macrophages is largely dependent on TLR2 (12) (Fig. 6A). In contrast to IP-10 induction, TNF-{alpha} induction during chlamydial infection is completely MyD88 dependent (Fig. 6). Thus, at least two stimulatory pathways are induced in macrophages during MoPn infection: one that is completely MyD88 dependent, that stimulates cytokines such as TNF-{alpha} and IL-6 (data not shown), and another that is partially dependent on MyD88, that stimulates chemokines such as IP-10.



View larger version (24K):
[in this window]
[in a new window]
 
FIGURE 6. Induction of TNF-{alpha} mRNA is completely MyD88 dependent in MoPn-infected macrophages. A, Macrophages derived from TLR2–/– and TLR4–/– mice and their corresponding control mice were infected with the MoPn strain, and cells were harvested and analyzed for TNF-{alpha} mRNA. UV-inactivated bacteria (UV-in) were infected the same way as live EB. E. coli LPS (ligand for TLR4) and commercially available PGN (ligand for TLR2) were used as positive controls. Cells treated with medium, LPS, PGN, and UV-inactivated MoPn were harvested at 3 h, and the infected cells were harvested at the indicated time points. B indicates similar experiments with MyD88–/– macrophages. A representative experiment of four experiments is shown. Each sample was performed in triplicate, and the SDs are shown.

 
It is important to note that the differences in cytokine and chemokine levels discussed above were not due to differences in the level of in vitro chlamydial infection of macrophages. No significant differences were observed in chlamydial inclusions between WT, TLR2–/–, TLR4–/–, and MyD88–/– macrophages (Fig. 7A). To determine whether the chlamydial inclusion developed normally in the knockout macrophages, the EBs recovered from the macrophages were used to infect a McCoy cell monolayer, and IFU were enumerated. No significant differences (by one-way ANOVA) were observed in the recovered IFU from WT, TLR2–/–, or MyD88–/– macrophages, whereas a 2- to 4-fold reduction was observed in EBs from TLR4–/– macrophages in three independent experiments (Fig. 7B) (p = 0.007, one-way ANOVA). The difference in TLR4–/– vs WT macrophages could be due to the inhibitory role of TLR4 on phagosome-lysosome fusion (50). However, this difference does not influence IP-10 levels in TLR4–/– macrophages (Fig. 6A).



View larger version (59K):
[in this window]
[in a new window]
 
FIGURE 7. No differences in chlamydial inclusion formation in WT, TLR2–/–, TLR4–/–, and MyD88–/– macrophages and recovered chlamydiae in WT, TLR2–/–, and MyD88–/– macrophages. Macrophages (1 x 106) derived from WT and knockout mice were infected with 1 x 106 EBs. One set of cells on coverslips were stained using chlamydial LPS mAbs (A), and a parallel set was harvested to recover infectious EBs, 24 h p.i. B, The recovered EBs were titrated on McCoy cell monolayers and enumerated for IFU. All macrophage infections were performed in triplicate, and a representative of three independent experiments is shown.

 
IFN-{beta} induction during chlamydial infection of macrophages is independent of TLR2 and TLR4 but mostly dependent on MyD88

It is well documented that IFN-{beta} transcription is induced by TLR3 stimulation by viral dsRNA or TLR4 cross-linking by LPS (29), whereas TLR2 has not been implicated in this pathway (25). We have shown that induction of chlamydial-induced IP-10 mRNA was dependent on IFN-{beta} (Fig. 3). Analysis of IFN-{beta} levels in infected TLR2–/– and TLR4–/– macrophages showed that the differences in IFN-{beta} mRNA levels in infected WT, TLR4–/–, and TLR2–/– macrophages were not significant (Fig. 8A). Thus, chlamydial-induced IFN-{beta} occurred independent of TLR2 or TLR4. However, analysis of IFN-{beta} mRNA in MoPn-infected MyD88–/– macrophages showed a significant reduction at all time points (3 h, p = 0.002; 8 and 24 h, p < 0.001; one-way ANOVA) compared with WT macrophages. A 70–80% inhibition of IFN-{beta} mRNA transcription was observed in MyD88–/– macrophages compared with WT macrophages at an infection of 5 MOI (Fig. 8B), whereas a 30–40% inhibition was observed with a MOI of 1 (data not shown). The E. coli LPS-mediated IFN-{beta} response was significantly elevated in MyD88–/– macrophages compared with WT macrophages, most likely because of an increased use of the Toll/IL-1R domain-containing adaptor inducing INF-{beta}-mediated pathway in the absence of MyD88, a phenomenon observed previously for LPS-stimulated cells (31). Assays for detecting IFN-{beta} protein levels were not successful possibly due to low sensitivity of the Abs used. These data indicate that TLR2 and TLR4 do not contribute to chlamydial-induced IFN-{beta} in macrophages, but a MyD88-dependent stimulatory pathway is involved. However, it must be noted that although IFN-{beta} mRNA levels are reduced in MyD88–/– macrophages compared with WT macrophages, significant induction of IFN-{beta} mRNA still occurs in the absence of MyD88, in response to infection (Fig. 8B). This suggests chlamydiae stimulate other, as yet uncharacterized, MyD88-independent pathways. Nonetheless, chlamydial-induced induction of IFN-{beta} is largely dependent on MyD88.



View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 8. Induction of IFN-{beta} mRNA is TLR4 independent and partially dependent on MyD88 in MoPn-infected macrophages. A, Macrophages derived from TLR2–/– and TLR4–/– mice and their corresponding control mice were infected with the MoPn strain, and cells were harvested and analyzed for IFN-{beta} mRNA. UV-inactivated bacteria (UV-in) were infected the same way as live EB. E. coli LPS was used as the positive control. B indicates a similar experiment with MyD88–/– macrophages. A representative experiment from four experiments is shown. Each sample was performed in triplicate, and the SDs are shown.

 
MyD88-dependent IFN pathways and the role for endosomal maturation in IFN-{beta} synthesis during chlamydial infection

Data from the above studies indicate a prominent role for MyD88 in MoPn-induced IFN-{beta} in macrophages, suggesting involvement of intracellular PRRs. Intracellular TLRs such as TLR7, TLR8, and TLR9 have been shown to induce IFN-{beta} in a MyD88-dependent manner (27, 28). TLR7, TLR8, and TLR9 form a subgroup within the TLR family due to their exclusive intracellular localization and recognition of PAMP in endosomal/lysosomal compartments (51, 52). Activation of these receptors depends on acidification and maturation of endosomes. Furthermore, during their activation, MyD88 is targeted to vesicular structures with lysosomal characteristics (52).

Based on these reports, we postulated that disruption of endosomal maturation would influence intracellular TLR-dependent IFN-{beta} induction during chlamydial infection. To address the role of intracellular TLRs in chlamydial-induced IFN-{beta}, MoPn-infected macrophages were treated with varying concentrations of bafilomycin A1 during infection. Bafilomycin A1, an acidification inhibitor, is traditionally used to block endosomal maturation (53). A dose-dependent reduction in the induction of IFN-{beta} mRNA and IP-10 protein (Fig. 9, A and B) was observed in bafilomycin-treated cells. As seen in previous experiments, UV-inactivated MoPn failed to induce any response regardless of bafilomycin treatment.



View larger version (14K):
[in this window]
[in a new window]
 
FIGURE 9. Role of endosomal maturation in IFN-{beta} induction during MoPn infection. Mouse macrophages were infected with the MoPn strain (MOI of 1). Immediately after infection, the cells were treated with bafilomycin A at the indicated concentrations. Cells were harvested at 18 h for RNA and analyzed for IFN-{beta} mRNA (A) and TNF-{alpha} mRNA (B). C, The supernatants were analyzed for IP-10 protein. A representative of three experiments is shown. Each sample was performed in triplicate, and the SDs are shown.

 
In contrast to IFN-{beta} and IP-10 levels, bafilomycin treatment of MoPn-infected cells did not have a negative effect on induction of TNF-{alpha}. In fact, TNF-{alpha} mRNA levels were increased at higher doses of bafilomycin (Fig. 9C). Thus, bafilomycin treatment did not cause a global inhibition of chlamydial-induced stimulatory pathways but was specific for the IFN-{beta} pathway. Bafilomycin treatment also did not affect chlamydial inclusion formation or recovery of infectious EBs in a significant manner (data not shown). Thus, the differences observed in induction of IFN-{beta} and IP-10 is not due to differences in the rate of infection. These results imply a role for intracellular PRRs that recognize chlamydial PAMP in endosomes to induce IFN-{beta} synthesis.

Role of IRF3 and TBK in chlamydial-induced IFN-{beta} induction

IRF3 is a necessary transcription factor for inducible IFN-{beta} (reviewed in Ref. 54). An important step preceding the induction of IFN-{beta} transcription is the phosphorylation of the transcription factor IRF3 by the kinases TBK and IKK{epsilon} (55, 56). TLR3 and TLR4, after binding their respective ligands, activate IRF3 by these kinases. As a result, IRF3 gets phosphorylated and transported to the nucleus to induce IFN-{beta} gene expression (57). By a complex mechanism that involves MyD88, the receptors TLR7, TLR8, and TLR9 can also activate these kinases to phosphorylate IRF3 (58). To begin elucidating the molecular mechanism of chlamydial-induced IFN-{beta} gene expression, nuclear translocation of IRF3 was investigated using MoPn-infected macrophages.

Nuclear extracts were prepared from control and infected macrophages at 3 and 8 h p.i., and IRF3 translocation was analyzed by Western blot (Fig. 10A). IRF3 nuclear translocation was observed as early as 3 h and increased at 8 h p.i. (Fig. 10A). The blots were stripped and reprobed for actin protein that served as a loading control and showed equivalent protein amounts in all lanes (Fig. 10A). These results demonstrate that IRF3 translocates to the nucleus during chlamydial infection and suggests its role in induction of IFN-{beta}.



View larger version (21K):
[in this window]
[in a new window]
 
FIGURE 10. Requirement of IRF3 translocation and TBK for IFN-{beta} induction during MoPn infection. WT macrophages were infected with the MoPn strain, and the cells were harvested at 3 and 8 h p.i. and processed for nuclear extract preparation. A, Nuclear lysates (10 µg) were subjected to SDS-PAGE and Western blot and probed using IRF3 Ab and actin Ab (loading control). B, WT MEFs and TBK–/– MEFs were infected with bacteria, and the cells were harvested at different time points for analysis for IFN-{beta} and IP-10 mRNA by quantitative RT-PCR.

 
As described previously, MyD88-dependent and independent signaling pathways that lead to IFN-{beta} induction converge in phosphorylation of IRF3. Two kinases that can function interchangeably have been implicated in phosphorylation of IRF3: TBK (55) and IKK{epsilon} (56). TBK is expressed in all cells, whereas IKK{epsilon} is present only in immune cells (56). To confirm the role of IRF3 phosphorylation in chlamydial-induced IFN-{beta}, TBK–/– MEFs were used. TBK–/– MEFs were infected with MoPn, and their IFN-{beta} expression was compared with WT MEFs. IFN-{beta} and IP-10 expression was completely abolished in MoPn-infected TBK–/– MEFs compared with WT MEFs, suggesting a complete dependence on the TBK-mediated pathway (Fig. 10B). It must be noted that in fibroblasts, only TBK plays a major role in IRF3 phosphorylation, whereas in macrophages, both TBK and IKK{epsilon} play a role interchangeably (56), and the above experiments do not take into account the role of IKK{epsilon}. However, these results demonstrate collectively that IRF3 phosphorylation and nuclear translocation play an important role in regulating induction of IFN-{beta} and, in turn, IP-10 during chlamydial infection. Together, our results demonstrate that chlamydial-induced IFN-{beta} results from activation of a MyD88-dependent pathway that functions through TBK-mediated IRF3 phosphorylation.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Primary chlamydial genital infection is mostly resolved by T cells that are recruited to the site of infection in response to T cell chemokines, such as IP-10. Induction of the chemokines in turn results from interaction of host TLRs with chlamydial PAMP. In this study, we show that C. trachomatis (MoPn) infection, in vivo and in vitro, induces IP-10 and IFN-{beta} independently of TLR2 and TLR4. Furthermore, we demonstrate a prominent role for the downstream adaptor molecule MyD88 in induction of IP-10 and IFN-{beta} during infection. This is the first report of an intracellular bacterium inducing IFN-{beta} in a TLR4-independent and MyD88-dependent manner. In addition, we have found that the intracellular mechanisms inducing IFN-{beta} production during chlamydial infection involve TBK-mediated IRF3 nuclear translocation, mediated possibly by a PRR that requires endosomal maturation.

During our studies of in vivo genital infection of TLR2–/– and TLR4–/– mice with MoPn, we observed that IP-10 levels in the genital tract secretions are independent of TLR4. This was surprising, because IP-10 responses during infections with Gram-negative bacteria are normally mediated through TLR4 stimulation by bacterial LPS. Recent studies have demonstrated the importance of IP-10 in generation of effective innate and adaptive immune responses to genital infection of mice with MoPn (59, 60, 61). Our study demonstrates that, in agreement with the lower levels of IP-10 in genital secretions of MyD88–/– mice during MoPn infection, the MyD88–/– mice clear infection at a slower rate than control mice. This is in contrast to our previous results obtained with TLR2–/– and TLR4–/– mice, which clear infection at the same rate as the control groups (12). However, the exact cell type(s) producing IP-10 or responding to IP-10 in vivo is not known. Moreover, the levels of IP-10 in vivo could result from both type I and type II IFN levels, and the specific contribution of type I IFNs has yet to be established using type I IFNs knockout mice.

Analysis of IFN-{beta} induction during chlamydial infection in vitro provides a direct means for studying the TLR intracellular signaling pathways in response to infection at a cellular level. Although more work will be needed to correlate the findings of the in vitro experiments with the in vivo results, we have observed that in vitro responses such as TNF-{alpha} and IL-6 production in response to chlamydial infection using TLR2–/– and TLR4–/– macrophages and fibroblasts appear to parallel the in vivo responses (12). Other in vitro studies demonstrating a role for TLRs in cytokine/chemokine expression in chlamydial infection using C. pneumoniae showed a similar correlation with in vivo results (62).

Nonetheless, significant variations in responses to different chlamydial strains have been reported. Two independent groups (62, 63) have shown a predominant role for TLR2 in C. pneumoniae-induced activation of DCs and macrophages using strains CM-1 and TW-183, respectively, whereas the findings from another group using the AR39 strain of C. pneumoniae have suggested a predominant role for TLR4 (64). Recently, Rothfuchs et al. (47) have shown, using BMDMs infected with a clinical isolate of C. pneumoniae (Kajaani 6), a reduction in IFN-{alpha} and IFN-{gamma} mRNA accumulation in TLR4–/– macrophages and no change in the levels of TNF-{alpha} in MyD88–/– macrophages. Our results using the MoPn strain of C. trachomatis are in contrast to these findings. These differences could be due to innate differences between the structural components of C. pneumoniae and C. trachomatis, or to the use of BMDMs in previous studies vs the peritoneal macrophages used in this study. To address the difference in cell type used, we infected BMDMs from MyD88–/– and WT mice with C. trachomatis. The results for TNF-{alpha} and IFN-{beta} induction in infected WT vs MyD88 BMDMs were similar to those obtained for peritoneal macrophages (data not shown), suggesting that the differences between the C. pneumoniae and C. trachomatis results may be attributed to inherent differences in the pathogens and not the cell types used for analysis.

The specific role of TLR4 in IFN-{beta} induction is well established (25). As a result, E. coli LPS-stimulated MyD88–/– cells remain fully able to promote IFN-inducible genes such as IP-10, GARG-16, or IRG-1. Likewise, Yersinia enterocolitica, Bacillus anthracis, or the sip B mutant of Salmonella typhimurium mediate type I IFN induction through stimulation of TLR4 (65, 66). But we have observed that C. trachomatis-induced IFN-{beta} and the IFN response gene IP-10 are stimulated independently of TLR4. Furthermore, ~70–80% of the IFN-{beta} induced during chlamydial infection is MyD88 dependent (Fig. 8B). The intracellular TLRs (TLR7, TLR8, and TLR9) are the only TLRs known to induce type I IFNs in a MyD88-dependent manner (28, 51), suggesting a role for these TLRs in chlamydial-induced type I IFNs. The intracellular TLRs require endosomal maturation to function (51). We therefore explored the possibility that they may be involved in chlamydial-induced type I IFN, using inhibitors of endosomal maturation, and found that they may in fact play a role. However, we cannot rule out a role for other PRRs in macrophages and fibroblasts, which may function in a MyD88-dependent manner and require endosomal maturation, because TLR7 and TLR9 are expressed at high levels only in plasmocytoid DCs (67, 68). Moreover, although most of the IFN-{beta} induction during MoPn infection was MyD88 dependent, a complete inhibition of IFN-{beta} induction in MyD88–/– macrophages was not observed, suggesting some stimulation through chlamydial-mediated MyD88-independent pathways for IFN-{beta} induction. Besides TLR4, MyD88-independent induction of IFN-{beta} may be stimulated by a number of other candidate receptors. One of them is TLR3, a viral dsRNA-recognizing TLR known to activate the IFN-{beta} pathway, the role of which has not been studied during chlamydial infection. In addition to the surface and endosomal TLRs, the nucleotide-binding oligomerization domain family proteins (69) or the RNA helicase RIG-1 (70) that are present in the cytoplasm of macrophages could also function in a MyD88-independent manner to induce IFN-{beta}, although these PRRs are not expected to be sensitive to inhibitors of endosomal maturation. Therefore, we speculate that the fraction of MyD88-independent, IFN-{beta} induction observed during chlamydial infection could be mediated by any of these unexplored receptors.

IFN-{beta} has been traditionally considered an antiviral cytokine (24), and the intracellular mechanisms regulating its expression have been studied extensively in response to viral infection. Induction of the IFN-{beta} gene by bacteria has attracted attention only recently, because of the pleiotropic functions of type I IFNs in immunity (71). We present evidence that chlamydial-induced IFN-{beta} is mediated by TBK-dependent nuclear translocation of IRF3 (Fig. 9). Recently, Stockinger et al. (72) and O’Connell et al. (73) have shown the requirement for IRF3 and TBK in type I IFN induction during infection of macrophages by another intracellular pathogen, Listeria monocytogenes. In this respect, intracellular bacterial infection begins to resemble viral infection. However, in contrast to our observations with Chlamydia, up-regulation of type I IFN in macrophages by Listeria was not only TLR4 independent but also MyD88 independent (72). One possibility for these differences could be the intracellular location of Chlamydia in inclusions compared with Listeria, which resides in the cytosol. Therefore, depending on their intracellular location, the bacteria may use different pathways to activate IRF3. Besides IRF3, another key transcription factor that plays a role in type I IFN induction is IRF7 (74). Two groups (58, 75) have recently shown that IRF7 interacts with MyD88 to form a complex that also involves IRAK4 and TRAF6 (components of NF-{kappa}B activation). Together they provide the foundation for intracellular TLR-mediated IFN induction. This would suggest that in MoPn-infected MyD88–/– macrophages, nuclear IRF7 levels could be reduced significantly. Future studies will therefore need to investigate the levels of nuclear IRF3 and IRF7 in WT and MyD88–/– macrophages to determine the relative role of IRF3 and IRF7 in chlamydial-induced IFN-{beta} induction.

The physiological function of type I IFNs as a link between innate and adaptive immunity is well established. However, the physiological role of type I IFNs during chlamydial infection in vivo has not been investigated. The signaling pathways that lead to IFN-{beta} induction could be of major importance in determining the course of infection or pathology in vivo. Unexpectedly, the pathways of IFN-{beta} induction during chlamydial infection turn out to be more complex than the expected LPS-TLR4-mediated response. In summary, our findings indicate that IFN-{beta} and subsequent IP-10 induction during MoPn infection occurs through two pathways. The major pathway requires MyD88-dependent activation, whereas a minor pathway involves MyD88- independent activation; both function through IRF3 phosphorylation. Determining the specific PRR(s) that contributes to the induction of IFN-{beta} during chlamydial infection is the next critical step in understanding the ensuing cytokine/chemokine response.


    Acknowledgments
 
We thank Dr. Wen-Chen Yeh (University Health Network, Toronto, Ontario, Canada) for providing TBK–/– MEFs. Technical help by Jim Sikes and Anne Bowlin on ELISA, animal husbandry, and Chlamydia stocks is gratefully acknowledged. We also thank Dr. Shanmugam Nagarajan for critical reading of this manuscript.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by the Horace C. Cabe and the Bates-Wheeler Foundations, the Arkansas Children’s Hospital Research Institute, a Pilot grant award from the University of Arkansas for Medical Sciences, the Medical Research Endowment, University of Arkansas for Medical Sciences award to U.M.N., and Public Health Service Grant AI054624 from the National Institutes of Health to T.D. Back

2 Address correspondence and reprint requests to Dr. Uma M. Nagarajan, Department of Microbiology and Immunology, 4301 West Markham Street, BM506, University of Arkansas for Medical Science, Little Rock, AR 72205. E-mail address: nagarajanuma{at}uams.edu Back

3 Abbreviations used in this paper: PAMP, pathogen-associated molecular pattern; IP-10, IFN-{gamma}-inducible protein 10; EB, elementary body; MoPn, mouse pneumonitis agent of Chlamydia trachomatis; MOI, multiplicity of infection; PGN, peptidoglycan; p.i., postinfection; PRR, pattern recognition receptor; IRF3, IFN response factor-3; TBK, TANK-binding kinase; WT, wild type; DC, dendritic cell; IFU, inclusion-forming unit; BMDM, bone marrow-derived macrophage; RT, reverse transcription; MEF, murine embryonic fibroblast. Back

Received for publication January 12, 2005. Accepted for publication April 19, 2005.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Gerbase, A. C., J. T. Rowley, T. E. Mertens. 1998. Global epidemiology of sexually transmitted diseases. Lancet 351:(Suppl. 3): 2-4.
  2. Swenson, C. E., J. Schachter. 1984. Infertility as a consequence of chlamydial infection of the upper genital tract in female mice. Sex. Transm. Dis. 11: 64-67.[Medline]
  3. Cain, T. K., R. G. Rank. 1995. Local Th1-like responses are induced by intravaginal infection of mice with the mouse pneumonitis biovar of Chlamydia trachomatis. Infect. Immun. 63: 1784-1789.[Abstract]
  4. Ramsey, K. H., R. G. Rank. 1991. Resolution of chlamydial genital infection with antigen-specific T-lymphocyte lines. Infect. Immun. 59: 925-931.[Abstract/Free Full Text]
  5. Rank, R. G., K. H. Ramsey, E. A. Pack, D. M. Williams. 1992. Effect of {gamma} interferon on resolution of murine chlamydial genital infection. Infect. Immun. 60: 4427-4429.[Abstract/Free Full Text]
  6. Perry, L. L., K. Feilzer, H. D. Caldwell. 1997. Immunity to Chlamydia trachomatis is mediated by T helper 1 cells through IFN-{gamma}-dependent and -independent pathways. J. Immunol. 158: 3344-3352.[Abstract]
  7. Cotter, T. W., K. H. Ramsey, G. S. Miranpuri, C. E. Poulsen, G. I. Byrne. 1997. Dissemination of Chlamydia trachomatis chronic genital tract infection in {gamma} interferon gene knockout mice. Infect. Immun. 65: 2145-2152.[Abstract]
  8. Takeda, K., T. Kaisho, S. Akira. 2003. Toll-like receptors. Annu. Rev. Immunol. 21: 335-376.[Medline]
  9. Spitzer, J. H., A. Visintin, A. Mazzoni, M. N. Kennedy, D. M. Segal. 2002. Toll-like receptor 1 inhibits Toll-like receptor 4 signaling in endothelial cells. Eur. J. Immunol. 32: 1182-1187.[Medline]
  10. Shiraki, R., N. Inoue, S. Kawasaki, A. Takei, M. Kadotani, Y. Ohnishi, J. Ejiri, S. Kobayashi, K. Hirata, S. Kawashima, M. Yokoyama. 2004. Expression of Toll-like receptors on human platelets. Thromb. Res. 113: 379-385.[Medline]
  11. Barton, G. M., R. Medzhitov. 2003. Toll-like receptor signaling pathways. Science 300: 1524-1525.[Abstract/Free Full Text]
  12. Darville, T., J. M. O’Neill, C. W. Andrews, Jr, U. M. Nagarajan, L. Stahl, D. M. Ojcius. 2003. Toll-like receptor-2, but not Toll-like receptor-4, is essential for development of oviduct pathology in chlamydial genital tract infection. J. Immunol. 171: 6187-6197.[Abstract/Free Full Text]
  13. Su, H., H. D. Caldwell. 1995. CD4+ T cells play a significant role in adoptive immunity to Chlamydia trachomatis infection of the mouse genital tract. Infect. Immun. 63: 3302-3308.[Abstract]
  14. Morrison, R. P., K. Feilzer, D. B. Tumas. 1995. Gene knockout mice establish a primary protective role for major histocompatibility complex class II-restricted responses in Chlamydia trachomatis genital tract infection. Infect. Immun. 63: 4661-4668.[Abstract]
  15. Dufour, J. H., M. Dziejman, M. T. Liu, J. H. Leung, T. E. Lane, A. D. Luster. 2002. IFN-{gamma}-inducible protein 10 (IP-10; CXCL10)-deficient mice reveal a role for IP-10 in effector T cell generation and trafficking. J. Immunol. 168: 3195-3204.[Abstract/Free Full Text]
  16. Gomez-Chiarri, M., T. A. Hamilton, J. Egido, S. N. Emancipator. 1993. Expression of IP-10, a lipopolysaccharide- and interferon-{gamma}-inducible protein, in murine mesangial cells in culture. Am. J. Pathol. 142: 433-439.[Abstract]
  17. Ohmori, Y., T. A. Hamilton. 1993. Cooperative interaction between interferon (IFN) stimulus response element and {kappa}B sequence motifs controls IFN{gamma}- and lipopolysaccharide-stimulated transcription from the murine IP-10 promoter. J. Biol. Chem. 268: 6677-6688.[Abstract/Free Full Text]
  18. Nagai, T., O. Devergne, T. F. Mueller, D. L. Perkins, J. M. van Seventer, G. A. van Seventer. 2003. Timing of IFN-{beta} exposure during human dendritic cell maturation and naive Th cell stimulation has contrasting effects on Th1 subset generation: a role for IFN-{beta}-mediated regulation of IL-12 family cytokines and IL-18 in naive Th cell differentiation. J. Immunol. 171: 5233-5243.[Abstract/Free Full Text]
  19. Punturieri, A., R. S. Alviani, T. Polak, P. Copper, J. Sonstein, J. L. Curtis. 2004. Specific engagement of TLR4 or TLR3 does not lead to IFN-{beta}-mediated innate signal amplification and STAT1 phosphorylation in resident murine alveolar macrophages. J. Immunol. 173: 1033-1042.[Abstract/Free Full Text]
  20. Maxion, H. K., K. A. Kelly. 2002. Chemokine expression patterns differ within anatomically distinct regions of the genital tract during Chlamydia trachomatis infection. Infect. Immun. 70: 1538-1546.[Abstract/Free Full Text]
  21. Shaw, J. H., V. R. Grund, L. Durling, H. D. Caldwell. 2001. Expression of genes encoding Th1 cell-activating cytokines and lymphoid homing chemokines by Chlamydia-pulsed dendritic cells correlates with protective immunizing efficacy. Infect. Immun. 69: 4667-4672.[Abstract/Free Full Text]
  22. Johnson, R. M.. 2004. Murine oviduct epithelial cell cytokine responses to Chlamydia muridarum infection include interleukin-12-p70 secretion. Infect. Immun. 72: 3951-3960.[Abstract/Free Full Text]
  23. Devitt, A., P. A. Lund, A. G. Morris, J. H. Pearce. 1996. Induction of {alpha}/{beta} interferon and dependent nitric oxide synthesis during Chlamydia trachomatis infection of McCoy cells in the absence of exogenous cytokine. Infect. Immun. 64: 3951-3956.[Abstract]
  24. Hertzog, P. J., L. A. O’Neill, J. A. Hamilton. 2003. The interferon in TLR signaling: more than just antiviral. Trends Immunol. 24: 534-539.[Medline]
  25. Toshchakov, V., B. W. Jones, P. Y. Perera, K. Thomas, M. J. Cody, S. Zhang, B. R. Williams, J. Major, T. A. Hamilton, M. J. Fenton, S. N. Vogel. 2002. TLR4, but not TLR2, mediates IFN-{beta}-induced STAT1{alpha}/{beta}-dependent gene expression in macrophages. Nat. Immunol. 3: 392-398.[Medline]
  26. Tabeta, K., P. Georgel, E. Janssen, X. Du, K. Hoebe, K. Crozat, S. Mudd, L. Shamel, S. Sovath, J. Goode, et al 2004. Toll-like receptors 9 and 3 as essential components of innate immune defense against mouse cytomegalovirus infection. Proc. Natl. Acad. Sci. USA 101: 3516-3521.[Abstract/Free Full Text]
  27. Diebold, S. S., T. Kaisho, H. Hemmi, S. Akira, C. Reis e Sousa. 2004. Innate antiviral responses by means of TLR7-mediated recognition of single-stranded RNA. Science 303: 1529-1531.[Abstract/Free Full Text]
  28. Hemmi, H., T. Kaisho, K. Takeda, S. Akira. 2003. The roles of Toll-like receptor 9, MyD88, and DNA-dependent protein kinase catalytic subunit in the effects of two distinct CpG DNAs on dendritic cell subsets. J. Immunol. 170: 3059-3064.[Abstract/Free Full Text]
  29. Hoebe, K., B. Beutler. 2004. LPS, dsRNA and the interferon bridge to adaptive immune responses: Trif, Tram, and other TIR adaptor proteins. J Endotoxin Res. 10: 130-136.
  30. Perry, A. K., E. K. Chow, J. B. Goodnough, W. C. Yeh, G. Cheng. 2004. Differential requirement for TANK-binding kinase-1 in type I interferon responses to toll-like receptor activation and viral infection. J. Exp. Med. 199: 1651-1658.[Abstract/Free Full Text]
  31. Kawai, T., O. Takeuchi, T. Fujita, J. Inoue, P. F. Muhlradt, S. Sato, K. Hoshino, S. Akira. 2001. Lipopolysaccharide stimulates the MyD88-independent pathway and results in activation of IFN-regulatory factor 3 and the expression of a subset of lipopolysaccharide-inducible genes. J. Immunol. 167: 5887-5894.[Abstract/Free Full Text]
  32. Travassos, L. H., S. E. Girardin, D. J. Philpott, D. Blanot, M. A. Nahori, C. Werts, I. G. Boneca. 2004. Toll-like receptor 2-dependent bacterial sensing does not occur via peptidoglycan recognition. EMBO Rep. 5: 1000-1006.[Medline]
  33. Takeuchi, O., K. Hoshino, T. Kawai, H. Sanjo, H. Takada, T. Ogawa, K. Takeda, S. Akira. 1999. Differential roles of TLR2 and TLR4 in recognition of Gram-negative and Gram-positive bacterial cell wall components. Immunity 11: 443-451.[Medline]
  34. Adachi, O., T. Kawai, K. Takeda, M. Matsumoto, H. Tsutsui, M. Sakagami, K. Nakanishi, S. Akira. 1998. Targeted disruption of the MyD88 gene results in loss of IL-1- and IL-18-mediated function. Immunity 9: 143-150.[Medline]
  35. Kawai, T., O. Adachi, T. Ogawa, K. Takeda, S. Akira. 1999. Unresponsiveness of MyD88-deficient mice to endotoxin. Immunity 11: 115-122.[Medline]
  36. Fremond, C. M., V. Yeremeev, D. M. Nicolle, M. Jacobs, V. F. Quesniaux, B. Ryffel. 2004. Fatal Mycobacterium tuberculosis infection despite adaptive immune response in the absence of MyD88. J. Clin. Invest. 114: 1790-1799.[Medline]
  37. Bonnard, M., C. Mirtsos, S. Suzuki, K. Graham, J. Huang, M. Ng, A. Itie, A. Wakeham, A. Shahinian, W. J. Henzel, et al 2000. Deficiency of T2K leads to apoptotic liver degeneration and impaired NF-{kappa}B-dependent gene transcription. EMBO J. 19: 4976-4985.[Medline]
  38. Everett, K. D., R. M. Bush, A. A. Andersen. 1999. Emended description of the order Chlamydiales, proposal of Parachlamydiaceae fam. nov. and Simkaniaceae fam. nov., each containing one monotypic genus, revised taxonomy of the family Chlamydiaceae, including a new genus and five new species, and standards for the identification of organisms. Int. J. Syst. Bacteriol. 49: 415-440.[Abstract/Free Full Text]
  39. Kambayashi, T., R. P. Wallin, H. G. Ljunggren. 2001. CAMP-elevating agents suppress dendritic cell function. J. Leukocyte Biol. 70: 903-910.[Abstract/Free Full Text]
  40. Ramsey, K. H., G. S. Miranpuri, C. E. Poulsen, N. B. Marthakis, L. M. Braune, G. I. Byrne. 1998. Inducible nitric oxide synthase does not affect resolution of murine chlamydial genital tract infections or eradication of chlamydiae in primary murine cell culture. Infect. Immun. 66: 835-838.[Abstract/Free Full Text]
  41. Caldwell, H. D., J. Kromhout, J. Schachter. 1981. Purification and partial characterization of the major outer membrane protein of Chlamydia trachomatis. Infect. Immun. 31: 1161-1176.[Abstract/Free Full Text]
  42. Nagarajan, U. M., A. B. Long, M. T. Harreman, A. H. Corbett, J. M. Boss. 2004. A hierarchy of nuclear localization signals governs the import of the regulatory factor X complex subunits and MHC class II expression. J. Immunol. 173: 410-419.[Abstract/Free Full Text]
  43. Morris, A. C., W. E. Spangler, J. M. Boss. 2000. Methylation of class II trans-activator promoter IV: a novel mechanism of MHC class II gene control. J. Immunol. 164: 4143-4149.[Abstract/Free Full Text]
  44. Hoshino, K., O. Takeuchi, T. Kawai, H. Sanjo, T. Ogawa, Y. Takeda, K. Takeda, S. Akira. 1999. Cutting edge: Toll-like receptor 4 (TLR4)-deficient mice are hyporesponsive to lipopolysaccharide: evidence for TLR4 as the Lps gene product. J. Immunol. 162: 3749-3752.[Abstract/Free Full Text]
  45. Hoebe, K., X. Du, P. Georgel, E. Janssen, K. Tabeta, S. O. Kim, J. Goode, P. Lin, N. Mann, S. Mudd, et al 2003. Identification of Lps2 as a key transducer of MyD88-independent TIR signalling. Nature 424: 743-748.[Medline]
  46. Muzio, M., D. Bosisio, N. Polentarutti, G. D’Amico, A. Stoppacciaro, R. Mancinelli, C. van’t Veer, G. Penton-Rol, L. P. Ruco, P. Allavena, A. Mantovani. 2000. Differential expression and regulation of toll-like receptors (TLR) in human leukocytes: selective expression of TLR3 in dendritic cells. J. Immunol. 164: 5998-6004.[Abstract/Free Full Text]
  47. Rothfuchs, A. G., C. Trumstedt, H. Wigzell, M. E. Rottenberg. 2004. Intracellular bacterial infection-induced IFN-{gamma} is critically but not solely dependent on Toll-like receptor 4-myeloid differentiation factor 88-IFN-{alpha} {beta}-STAT1 signaling. J. Immunol. 172: 6345-6353.[Abstract/Free Full Text]
  48. La Verda, D., G. I. Byrne. 1994. Interactions between macrophages and chlamydiae. Immunol. Ser. 60: 381-399.[Medline]
  49. Takeuchi, O., S. Akira. 2002. MyD88 as a bottle neck in Toll/IL-1 signaling. Curr. Top. Microbiol. Immunol. 270: 155-167.[Medline]
  50. Shiratsuchi, A., I. Watanabe, O. Takeuchi, S. Akira, Y. Nakanishi. 2004. Inhibitory effect of Toll-like receptor 4 on fusion between phagosomes and endosomes/lysosomes in macrophages. J. Immunol. 172: 2039-2047.[Abstract/Free Full Text]
  51. Heil, F., P. Ahmad-Nejad, H. Hemmi, H. Hochrein, F. Ampenberger, T. Gellert, H. Dietrich, G. Lipford, K. Takeda, S. Akira, et al 2003. The Toll-like receptor 7 (TLR7)-specific stimulus loxoribine uncovers a strong relationship within the TLR7, 8 and 9 subfamily. Eur. J. Immunol. 33: 2987-2997.[Medline]
  52. Latz, E., A. Schoenemeyer, A. Visintin, K. A. Fitzgerald, B. G. Monks, C. F. Knetter, E. Lien, N. J. Nilsen, T. Espevik, D. T. Golenbock. 2004. TLR9 signals after translocating from the ER to CpG DNA in the lysosome. Nat. Immunol. 5: 190-198.[Medline]
  53. Yoshimori, T., A. Yamamoto, Y. Moriyama, M. Futai, Y. Tashiro. 1991. Bafilomycin A1, a specific inhibitor of vacuolar-type H+-ATPase, inhibits acidification and protein degradation in lysosomes of cultured cells. J. Biol. Chem. 266: 17707-17712.[Abstract/Free Full Text]
  54. Barnes, B., B. Lubyova, P. M. Pitha. 2002. On the role of IRF in host defense. J. Interferon Cytokine Res. 22: 59-71.[Medline]
  55. McWhirter, S. M., K. A. Fitzgerald, J. Rosains, D. C. Rowe, D. T. Golenbock, T. Maniatis. 2004. IFN-regulatory factor 3-dependent gene expression is defective in Tbk1-deficient mouse embryonic fibroblasts. Proc. Natl. Acad. Sci. USA 101: 233-238.[Abstract/Free Full Text]
  56. Fitzgerald, K. A., S. M. McWhirter, K. L. Faia, D. C. Rowe, E. Latz, D. T. Golenbock, A. J. Coyle, S. M. Liao, T. Maniatis. 2003. IKK{epsilon} and TBK1 are essential components of the IRF3 signaling pathway. Nat. Immunol. 4: 491-496.[Medline]
  57. Doyle, S., S. Vaidya, R. O’Connell, H. Dadgostar, P. Dempsey, T. Wu, G. Rao, R. Sun, M. Haberland, R. Modlin, G. Cheng. 2002. IRF3 mediates a TLR3/TLR4-specific antiviral gene program. Immunity 17: 251-263.[Medline]
  58. Honda, K., H. Yanai, T. Mizutani, H. Negishi, N. Shimada, N. Suzuki, Y. Ohba, A. Takaoka, W. C. Yeh, T. Taniguchi. 2004. Role of a transductional-transcriptional processor complex involving MyD88 and IRF-7 in Toll-like receptor signaling. Proc. Natl. Acad. Sci. USA 101: 15416-15421.[Abstract/Free Full Text]
  59. Maxion, H. K., W. Liu, M. H. Chang, K. A. Kelly. 2004. The infecting dose of Chlamydia muridarum modulates the innate immune response and ascending infection. Infect. Immun. 72: 6330-6340.[Abstract/Free Full Text]
  60. Belay, T., F. O. Eko, G. A. Ananaba, S. Bowers, T. Moore, D. Lyn, J. U. Igietseme. 2002. Chemokine and chemokine receptor dynamics during genital chlamydial infection. Infect. Immun. 70: 844-850.[Abstract/Free Full Text]
  61. Maxion, H. K., K. A. Kelly. 2004. Mounting of adaptive and innate immunity against Chlamydia trachomatis is CXCR3-dependent. J. Oak, Jr, ed. Proceedings of 5th Meeting of the European Society of Chlamydial Research 155 University of Szeged, Szeged, Hungary. .
  62. Prebeck, S., C. Kirschning, S. Durr, C. da Costa, B. Donath, K. Brand, V. Redecke, H. Wagner, T. Miethke. 2001. Predominant role of toll-like receptor 2 versus 4 in Chlamydia pneumoniae-induced activation of dendritic cells. J. Immunol. 167: 3316-3323.[Abstract/Free Full Text]
  63. Netea, M. G., B. J. Kullberg, J. M. Galama, A. F. Stalenhoef, C. A. Dinarello, J. W. Van der Meer. 2002. Non-LPS components of Chlamydia pneumoniae stimulate cytokine production through Toll-like receptor 2-dependent pathways. Eur. J. Immunol. 32: 1188-1195.[Medline]
  64. Sasu, S., D. LaVerda, N. Qureshi, D. T. Golenbock, D. Beasley. 2001. Chlamydia pneumoniae and chlamydial heat shock protein 60 stimulate proliferation of human vascular smooth muscle cells via toll-like receptor 4 and p44/p42 mitogen-activated protein kinase activation. Circ. Res. 89: 244-250.[Abstract/Free Full Text]
  65. Haase, R., C. J. Kirschning, A. Sing, P. Schrottner, K. Fukase, S. Kusumoto, H. Wagner, J. Heesemann, K. Ruckdeschel. 2003. A dominant role of Toll-like receptor 4 in the signaling of apoptosis in bacteria-faced macrophages. J. Immunol. 171: 4294-4303.[Abstract/Free Full Text]
  66. Hsu, L. C., J. M. Park, K. Zhang, J. L. Luo, S. Maeda, R. J. Kaufman, L. Eckmann, D. G. Guiney, M. Karin. 2004. The protein kinase PKR is required for macrophage apoptosis after activation of Toll-like receptor 4. Nature 428: 341-345.[Medline]
  67. Kadowaki, N., S. Ho, S. Antonenko, R. W. Malefyt, R. A. Kastelein, F. Bazan, Y. J. Liu. 2001. Subsets of human dendritic cell precursors express different toll-like receptors and respond to different microbial antigens. J. Exp. Med. 194: 863-869.[Abstract/Free Full Text]
  68. Krug, A., A. Towarowski, S. Britsch, S. Rothenfusser, V. Hornung, R. Bals, T. Giese, H. Engelmann, S. Endres, A. M. Krieg, G. Hartmann. 2001. Toll-like receptor expression reveals CpG DNA as a unique microbial stimulus for plasmacytoid dendritic cells which synergizes with CD40 ligand to induce high amounts of IL-12. Eur. J. Immunol. 31: 3026-3037.[Medline]
  69. O’Riordan, M., C. H. Yi, R. Gonzales, K. D. Lee, D. A. Portnoy. 2002. Innate recognition of bacteria by a macrophage cytosolic surveillance pathway. Proc. Natl. Acad. Sci. USA 99: 13861-13866.[Abstract/Free Full Text]
  70. Yoneyama, M., M. Kikuchi, T. Natsukawa, N. Shinobu, T. Imaizumi, M. Miyagishi, K. Taira, S. Akira, T. Fujita. 2004. The RNA helicase RIG-I has an essential function in double-stranded RNA-induced innate antiviral responses. Nat. Immunol. 5: 730-737.[Medline]
  71. Santini, S. M., T. Di Pucchio, C. Lapenta, S. Parlato, M. Logozzi, F. Belardelli. 2002. The natural alliance between type I interferon and dendritic cells and its role in linking innate and adaptive immunity. J. Interferon Cytokine Res. 22: 1071-1080.[Medline]
  72. Stockinger, S., B. Reutterer, B. Schaljo, C. Schellack, S. Brunner, T. Materna, M. Yamamoto, S. Akira, T. Taniguchi, P. J. Murray, et al 2004. IFN regulatory factor 3-dependent induction of type I IFNs by intracellular bacteria is mediated by a TLR- and Nod2-independent mechanism. J. Immunol. 173: 7416-7425.[Abstract/Free Full Text]
  73. O’Connell, R. M., S. A. Vaidya, A. K. Perry, S. K. Saha, P. W. Dempsey, G. Cheng. 2005. Immune activation of type I IFNs by Listeria monocytogenes occurs independently of TLR4, TLR2, and receptor interacting protein 2 but involves TANK-binding kinase 1. J. Immunol. 174: 1602-1607.[Abstract/Free Full Text]
  74. Yang, H., C. H. Lin, G. Ma, M. O. Baffi, M. G. Wathelet. 2003. Interferon regulatory factor-7 synergizes with other transcription factors through multiple interactions with p300/CBP coactivators. J. Biol. Chem. 278: 15495-15504.[Abstract/Free Full Text]
  75. Kawai, T., S. Sato, K. J. Ishii, C. Coban, H. Hemmi, M. Yamamoto, K. Terai, M. Matsuda, J. Inoue, S. Uematsu, O. Takeuchi, S. Akira. 2004. Interferon-{alpha} induction through Toll-like receptors involves a direct interaction of IRF7 with MyD88 and TRAF6. Nat. Immunol. 5: 1061-1068.[Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
S.-H. Lee, J. S. Kim, H.-K. Jun, H.-R. Lee, D. Lee, and B.-K. Choi
The Major Outer Membrane Protein of a Periodontopathogen Induces IFN-{beta} and IFN-Stimulated Genes in Monocytes via Lipid Raft and TANK-Binding Kinase 1/IFN Regulatory Factor-3
J. Immunol., May 1, 2009; 182(9): 5823 - 5835.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
D. Prantner and U. M. Nagarajan
Role for the Chlamydial Type III Secretion Apparatus in Host Cytokine Expression
Infect. Immun., January 1, 2009; 77(1): 76 - 84.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Chen, R. Sorrentino, K. Shimada, Y. Bulut, T. M. Doherty, T. R. Crother, and M. Arditi
Chlamydia pneumoniae-Induced Foam Cell Formation Requires MyD88-Dependent and -Independent Signaling and Is Reciprocally Modulated by Liver X Receptor Activation
J. Immunol., November 15, 2008; 181(10): 7186 - 7193.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
U. M. Nagarajan, D. Prantner, J. D. Sikes, C. W. Andrews Jr., A. M. Goodwin, S. Nagarajan, and T. Darville
Type I Interferon Signaling Exacerbates Chlamydia muridarum Genital Infection in a Murine Model
Infect. Immun., October 1, 2008; 76(10): 4642 - 4648.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. Yang, P. Stark, K. Janik, H. Wigzell, and M. E. Rottenberg
SOCS-1 Protects against Chlamydia pneumoniae-Induced Lethal Inflammation but Hampers Effective Bacterial Clearance
J. Immunol., March 15, 2008; 180(6): 4040 - 4049.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
W. Cheng, P. Shivshankar, Y. Zhong, D. Chen, Z. Li, and G. Zhong
Intracellular Interleukin-1{alpha} Mediates Interleukin-8 Production Induced by Chlamydia trachomatis Infection via a Mechanism Independent of Type I Interleukin-1 Receptor
Infect. Immun., March 1, 2008; 76(3): 942 - 951.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
C. Trumstedt, E. Eriksson, A. M. Lundberg, T.-b. Yang, Z.-q. Yan, H. Wigzell, and M. E. Rottenberg
Role of IRAK4 and IRF3 in the control of intracellular infection with Chlamydia pneumoniae
J. Leukoc. Biol., June 1, 2007; 81(6): 1591 - 1598.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
W. A. Derbigny, S.-C. Hong, M. S. Kerr, M. Temkit, and R. M. Johnson
Chlamydia muridarum Infection Elicits a Beta Interferon Response in Murine Oviduct Epithelial Cells Dependent on Interferon Regulatory Factor 3 and TRIF
Infect. Immun., March 1, 2007; 75(3): 1280 - 1290.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G. Mancuso, A. Midiri, C. Biondo, C. Beninati, S. Zummo, R. Galbo, F. Tomasello, M. Gambuzza, G. Macri, A. Ruggeri, et al.
Type I IFN Signaling Is Crucial for Host Resistance against Different Species of Pathogenic Bacteria
J. Immunol., March 1, 2007; 178(5): 3126 - 3133.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G. Raghuraman, Y. Geng, and C.-R. Wang
IFN-beta-Mediated Up-Regulation of CD1d in Bacteria-Infected APCs
J. Immunol., December 1, 2006; 177(11): 7841 - 7848.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
L. Plant, H. Wan, and A.-B. Jonsson
MyD88-Dependent Signaling Affects the Development of Meningococcal Sepsis by Nonlipooligosaccharide Ligands.
Infect. Immun., June 1, 2006; 74(6): 3538 - 3546.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. M. O'Connell, I. A. Ionova, A. J. Quayle, A. Visintin, and R. R. Ingalls
Localization of TLR2 and MyD88 to Chlamydia trachomatis Inclusions: EVIDENCE FOR SIGNALING BY INTRACELLULAR TLR2 DURING INFECTION WITH AN OBLIGATE INTRACELLULAR PATHOGEN
J. Biol. Chem., January 20, 2006; 281(3): 1652 - 1659.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nagarajan, U. M.
Right arrow Articles by Darville, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nagarajan, U. M.
Right arrow Articles by Darville, T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS