The JI PBL Intereron Source
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Francés, R.
Right arrow Articles by Rothstein, T. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Francés, R.
Right arrow Articles by Rothstein, T. L.
The Journal of Immunology, 2005, 175: 27-31.
Copyright © 2005 by The American Association of Immunologists


CUTTING EDGE

Cutting Edge: B-1 Cells Are Deficient in Lck: Defective B Cell Receptor Signal Transduction in B-1 Cells Occurs in the Absence of Elevated Lck Expression1

Rubén Francés*, Joseph R. Tumang{ddagger} and Thomas L. Rothstein2,{ddagger},{dagger}

Departments of* Medicine and {dagger} Microbiology, Boston University School of Medicine, and{ddagger} Immunobiology Unit, Evans Memorial Department of Clinical Research, Boston University Medical Center, Boston, MA 02118


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Disclosures
 References
 
B-1 cells constitute a unique B cell subset that is primarily responsible for producing nonimmune Ig. This natural Ig acts as a principal line of defense against infection. A key feature of B-1 cells is the failure of BCR-triggered signal transduction. Recently, defective BCR signaling in B-1 cells has been attributed to elevated expression of the canonical T cell src kinase, Lck. In the present study, we re-examined Lck expression in normal B-1 cells. We found that B-1 cells expressed less Lck at both the protein and RNA levels than did B-2 cells. The same B-1 cells manifested defective BCR-mediated induction of IKK{beta} phosphorylation, I{kappa}B{alpha} degradation, and intracellular Ca2+ mobilization. Thus, the failure of BCR signaling in B-1 cells does not relate to subset-specific elevation of Lck.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Disclosures
 References
 
B-1 cells constitute a unique B cell subset that is primarily responsible for producing natural (nonimmune) Ig (reviewed in Refs. 1, 2, 3, 4). This natural Ig plays a critical and nonredundant role in host immune defense against infection (5, 6, 7, 8). B-1 cells are characterized by a number of unusual phenotypic, ontogenetic, and functional characteristics which have contributed to an ongoing controversy regarding their developmental origin. A key feature of B-1 cells is deficient BCR signaling. Whereas BCR cross-linking produces Ca2+ mobilization, NF-{kappa}B activation, and proliferation in conventional B (B-2) cells, none of these things takes place in anti-Ig-stimulated B-1 cells (9, 10, 11, 12, 13, 14). This indolence may result from prior BCR triggering, which has been proposed to play a role in B-1 cell development, and so could reflect Ag experience and may represent a form of tolerance (15, 16, 17, 18).

The mechanism underlying defective BCR signaling in B-1 cells remains uncertain. Because BCR-triggered Ca2+ mobilization is affected, but PMA-induced NF-{kappa}B activation is not (10), it has been suggested that BCR coupling to phospholipase C is impaired in B-1 cells, and direct measurements of BCR-induced phospholipase C activity suggest that this is so (11, 17). This in turn is thought to result from the inhibitory effect of CD5, particularly the tyrosine phosphorylated form of CD5, due to its association with SHP-1 phosphatase (12, 13, 19). Recently, the origin of phosphorylated CD5 and impaired BCR signaling has been reported to lie in an increased level of the canonical T cell src kinase Lck. Increased levels of Lck have been reported in human CLL cells, human B-1 cells, and murine peritoneal B-1 cells (but not murine splenic B-1 cells) (20, 21, 22). In the murine studies, peritoneal B-1 cells expressed much more Lck than did splenic B-2 cells (21, 22). In view of these reports, it is now well accepted that B-1 cells express an unusually high level of Lck in relation to B-2 cells. However, in earlier work examining multiple src kinases in unpurified peritoneal and splenic B cells, we did not observe increased Lck in the B-1 cell-rich peritoneal population (11). We have now re-examined the Lck content of B-1 cells using highly pure B cell populations and improved techniques for isolation and identification.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Disclosures
 References
 
Animals

Male BALB/cByJ and C57BL/6 mice at 8–14 wk of age were obtained from The Jackson Laboratory. Mice were cared for and handled in accordance with National Institutes of Health and institutional guidelines.

B cell purification and culture

Unseparated cells were obtained by peritoneal washout and splenic disruption and were purified in one of three ways: 1) Cells were stained with immunofluorescent Abs directed against B220 and CD5 and were subjected to FACS at 4°C using a Mo-Flo flow cytometer (DakoCytomation) to yield purified peritoneal B-1 (B220+CD5+) and splenic B-2 (B220+CD5) cells (sort-purified B-1 and B-2 cells) as previously described, including the use of an anti-CD8 "dump" channel for B cell purification (23). B-1 and B-2 cells were >97% pure (i.e., B220+CD5+ and B220+CD5, respectively). T cells (B220CD5+) were also isolated by cell sorting. For experiments in which CD5 was immunoprecipitated, B-1 cells were sort-purified using anti-B220 and anti-Mac-1 Abs. 2) Cells were depleted of T cells by treatment with anti-Thy 1.2 plus complement and of macrophages by two rounds of plate adherence to yield B-1 and B-2 cell-enriched populations (adherence/Thy1.2-purified B cells) as previously described (24). 3) Cells were depleted of macrophages by plate adherence, were depleted of non-B cells by biotinylated Thy 1.2-, CD4-, and CD8-specific Abs plus streptavidin magnetic beads, and, for peritoneal washouts, were positively selected for CD5 (magnetic bead-purified B cells) as described by Cambier and colleagues (22). All isolated B cell populations contained <0.5% T cells (B220CD3+). Sort-purified and magnetic bead-purified B-1 cells contained 0.71% ± 0.39 (mean ± SEM) macrophages (B220CD14+), and adherence/Thy1.2-purified B-1 cells contained 4.8% ± 1.3 macrophages. Sort-purified and magnetic bead-purified B-2 cells contained <0.5% macrophages and adherence/Thy1.2-purified B-2 cells contained 1.0% ± 0.27 macrophages. B cells were cultured in RPMI 1640 medium as previously described.

Protein expression

B cells were extracted with radioimmunoprecipitation assay (RIPA)3 buffer (25), after which proteins were separated by SDS-PAGE, transferred to polyvinylidene fluoride membranes, and immunoblotted as previously described (26). In some cases B cells were extracted with CHAPS buffer (27). CD5 was immunoprecipitated from RIPA buffer-extracted B cell lysates with Sepharose beads coupled to anti-CD5 Ab and immunoblotted as described above with a different CD5-specific Ab and with a phospho-CD5-specific Ab.

Gene expression

RNA was prepared from B cells using Ultraspec reagent (BiotecX) and was DNase treated. cDNA was prepared using AMV reverse transcriptase (Roche Applied Sciences) and normalized by PCR for {beta}2-microglobulin expression. Lck gene expression was then assessed by real-time PCR using a MX3000P quantitative PCR machine (Stratagene) with the following primers (forward/reverse): {beta}2-microglobulin (CCCGCCTCACATTGAAATCC/GCGTATGTATCAGTCTCAGTGG) and Lck (ACAATGAGTACACGGCCCG/TAAGGGATTCGACCGTGGG).

Intracellular Ca2+

Peritoneal or splenic cells were loaded with Indo-1AM (Molecular Probes) at 1 µM for 30 min at 37°C, then washed and stained at 4°C with B220- and CD5-specific fluorescent Abs. Cells were washed again and then resuspended at 2 x 106 cells/ml in dyeless RPMI 1640 with 5% FCS. Intracellular Ca2+ was evaluated by measuring fluorescence at 405 and 485 nm after excitation at 355 nm with a Mo-Flo flow cytometer (DakoCytomation). The various lymphocyte populations were evaluated through gating and data analysis performed using FlowJo software (Tree Star).

Reagents

Fluorescent-labeled anti-B220, anti-CD5, anti-Mac-1, anti-CD3, anti-CD14, and anti-CD8 Abs were obtained from BD Pharmingen. Two different monoclonal Lck-specific Abs were obtained from BD Biosciences (clone 28) and Santa Cruz Biotechnology (clone 3A5). Polyclonal Ab specific for the (Tyr505) phosphorylated form of Lck and anti-phospho-IKK{alpha}{beta} (Ser180/181, respectively) were obtained from Cell Signaling Technology. Anti-I{kappa}B{alpha} and two different monoclonal anti-CD5 Abs were obtained from Santa Cruz Biotechnology. Monoclonal anti-phosphotyrosine Ab was obtained from Cell Signaling Technology. Anti-{beta}-actin Ab was obtained from Sigma-Aldrich. F(ab')2 of anti-IgM were obtained from Jackson ImmunoResearch Laboratories.


    Results and Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Disclosures
 References
 
B-1 cells express less Lck than B-2 cells

We determined the Lck content of sort-purified BALB/c lymphocyte populations by Western blotting. Immunofluorescent staining and FACS were conducted at 4°C to avoid any room temperature or at 37°C manipulations during which protein expression might change. Isolated B-1, B-2, and T cells were then immediately extracted with RIPA buffer, after which proteins were size separated by SDS-PAGE and immunoblotted with a monoclonal Lck-specific Ab. As expected, T cells expressed substantial amounts of Lck; in direct contrast and B cells expressed very little (Fig. 1A). Among B cells, no Lck was detected in B-1 cell extracts, whereas B-2 cell extracts contained very small amounts. Although in most experiments 15 µg protein was analyzed, no Lck was detected in B-1 cell extracts even after scaling up to 35 µg protein (data not shown). Normalized to {beta}-actin as a control, B-2 cells expressed less than 1/20 the amount of Lck expressed by T cells, and B-1 cells expressed less than that. A similar population distribution was obtained when blots were probed with a phospho-Lck (pLck)-specific Ab: T cells expressed substantial amounts of pLck, whereas B cells expressed very little. Thus, sort-purified B-1 cells do not express any more Lck or pLck than sort-purified B-2 cells.



View larger version (32K):
[in this window]
[in a new window]
 
FIGURE 1. B-1 cells express less Lck than B-2 cells. A, B-1 cells were sort-purified from peritoneal washouts, and B-2 cells and T cells were sort-purified from splenocytes, of BALB/c and C57BL/6 mice following immunofluorescent staining with B220- and CD5-specific Abs at 4°C. Lymphocyte populations were extracted with RIPA buffer and protein (15 µg) separated by SDS-PAGE and then Western blotted with anti-Lck and anti-pLck Abs. Blots were stripped and reprobed for {beta}-actin to ensure equal loading. One of five comparable experiments is shown. B, B-1, B-2, and T cells were isolated as described above and separate aliquots were extracted with CHAPS or with RIPA buffer. Extracted protein was Western blotted as described in A. One of three comparable experiments is shown. C, B-1-enriched (B-1E) and B-2-enriched (B-2E) cell populations were isolated by plate adherence and anti-Thy 1.2 plus complement treatment. B-1, B-2, and T cells were also sort-purified. B cells were untreated or stimulated with anti-Ig (15 µg/ml) for 24 h, as indicated. Lymphocyte populations were extracted with RIPA buffer and Western blotted as described above. One of three comparable experiments is shown. D, B-1 and B-2 cells were purified by plate adherence plus negative depletion with Abs plus magnetic beads; B-1 cells were further purified by positive selection with anti-CD5 plus magnetic beads. B-1, B-2, and T cells were also sort-purified. Lymphocyte populations were extracted with RIPA buffer and protein (32 µg) was Western blotted for Lck. E, B-1, B-2, and T cells were sort-purified, after which RNA was extracted, cDNA was prepared, and Lck gene expression was determined by quantitative PCR and normalized to the expression of {beta}2-microglobulin. Mean normalized B cell values for Lck, expressed as a proportion of normalized T cells values, are shown for four experiments along with lines indicating SEM.

 
We obtained lymphocyte populations from C57BL/6 mice to rule out the possibility that strain differences in Lck expression might account for previous reports of elevated Lck in B-1 cells. Again, sort-purified B-1 cells failed to express detectable levels of Lck and pLck, in contrast to sort-purified T cells which expressed much of both (Fig. 1A). In particular, as before, B-1 cell extracts contained less Lck than did extracts obtained from B-2 cells. We separately extracted BALB/c lymphocyte populations with CHAPS to rule out the possibility that differences in solubilization conditions might account for our inability to detect Lck in B-1 cells. We obtained the same results with CHAPS extraction as we did with RIPA buffer, and again B-1 cells failed to express Lck and pLck (Fig. 1B). We further tested all of these samples, involving different mouse strains and extraction conditions, with a different monoclonal Lck-specific Ab and obtained the same results; again B-1 cells contained no detectable Lck, whereas B-2 cells contained low levels and T cells expressed abundant amounts (data not shown).

Previous reports indicating that B-1 cells express Lck used plate adherence to remove macrophages (20, 21, 22). Because this represented a potential explanation for the disparity in B-1 cell Lck expression between this report and others, we compared adherence/Thy 1.2-purified and sort-purified B cell populations from BALB/c mice, but found little difference in the results obtained. Adherence/Thy 1.2-purified B-1-enriched cells contained no detectable Lck or pLck just like sort-purified B-1 cells, whereas both adherence/Thy 1.2-purified B-2-enriched cells and sort-purified B-2 cells expressed small amounts of Lck (Fig. 1C). As an assay control, we verified in the same experiment that sort-purified T cells contained substantial amounts of Lck and pLck. We further purified B-1 and B-2 cells by plate adherence combined with negative and positive magnetic bead separation, as outlined in Materials and Methods (22), yet still found that B-1 cells expressed less Lck than B-2 cells (Fig. 1D). Inasmuch as CD5 phosphorylation has been reported to be induced by BCR triggering and to correlate with up-regulated Lck expression (22), we stimulated B-1 and B-2 cells with anti-Ig for 24 h to determine whether Lck or pLck levels respond to B cell activation (Fig. 1C). No increase in Lck, or pLck, was identified in either B cell population as a result of BCR engagement, consistent with the view that B-1 cells do not express or up-regulate Lck beyond the level contained in B-2 cells.

We further examined Lck gene expression of sort-purified BALB/c lymphocyte populations by quantitative PCR and normalized results to {beta}2-microglobulin. In these, as in other, experiments, all steps in lymphocyte purification were conducted at 4°C to avoid any room temperature or at 37°C manipulations during which gene expression might change. As expected, T cells expressed substantial amounts of Lck mRNA; in direct contrast, B-1 and B-2 cells expressed very little, with B-1 cells expressing less than the level expressed by B-2 cells (Fig. 1E). These results are consistent with the results obtained by Western blotting, which together indicate that B-1 cells fail to express increased amounts of Lck at both the mRNA and protein levels in relation to B-2 cells.

BCR signaling is defective in B-1 cells

We analyzed several events downstream of BCR engagement to determine whether B-1 cells that lack Lck also fail to signal after BCR triggering. In a previous report, we showed that BCR signaling for NF-{kappa}B activation is impaired in B-1 cells (10). In the present study, we sought to extend that work by examining IKK phosphorylation and I{kappa}B{alpha} degradation, two key steps in the signaling pathway from BCR to NF-{kappa}B. To do this, B-1 and B-2 cells were sort-purified and then stimulated with anti-Ig; at various times after stimulation, aliquots of B cells were extracted with RIPA buffer as described above. Western blotting showed a marked increase in IKK{beta} phosphorylation after anti-Ig stimulation of B-2 cells that was completely lacking in similarly treated B-1 cells (Fig. 2A). Along the same lines, Western blotting showed clear-cut I{kappa}B{alpha} degradation within 1 h of BCR triggering in B-2 cells that also did not occur in B-1 cells. Thus, BCR signaling is blocked at an early point in B-1 cells such that IKK{beta} phosphorylation and I{kappa}B{alpha} degradation do not occur.



View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 2. BCR signaling is defective in B-1 cells. A, B-1 and B-2 cells were sort-purified from BALB/c mice and were unstimulated or were stimulated with anti-Ig (15 µg/ml) for the times indicated. B cells were extracted with RIPA buffer and extracted protein (10 µg/ml) was separated by SDS-PAGE and then Western blotted with an Ab specific for the phosphorylated forms of IKK{alpha} and IKK{beta}. Blots were stripped and reprobed for {beta}-actin to verify equal loading. One of three comparable experiments is shown. B, Sort-purified B-1 and B-2 cells were either unstimulated, stimulated with anti-Ig for the times indicated, or incubated with medium for 60 min as a control (60c). B cells were extracted and extracted protein was size separated and Western blotted with an I{kappa}B{alpha}-specific Ab. Blots were stripped and reprobed for {beta}-actin to verify equal loading. One of four comparable experiments is shown. C, Peritoneal and splenic cells were immunofluorescently stained for B220 and CD5 and were loaded with the Ca2+-sensitive dye Indo-1AM. Cells were then stimulated with anti-Ig (15 µg/ml) and examined by flow cytometry, assessing emission wavelengths of 405 and 485 nm after excitation at 355 nm. One of two comparable experiments is shown.

 
We also examined BCR-induced intracellular Ca2+. Peritoneal and splenic cells were immunofluorescently stained and loaded with the Ca2+-sensitive dye Indo-1AM, after which BCR-triggered Ca2+ mobilization of selected B cell subsets was measured by flow cytometry. Basal Ca2+ levels were similar in B-1 and B-2 cells, as previously described in several, but not all, studies (12, 19, 22, 28). In keeping with published results (13, 14, 22), we found that both B-1 cells and B-2 cells experienced a rapid increase in intracellular Ca2+ following anti-Ig stimulation, but that the increase in B-1 cells was much less than the increase in B-2 cells. Thus, in B-1 cells, BCR signaling is impaired at a point before Ca2+ elevation. Taken together, the results on IKK{beta}, I{kappa}B{alpha}, and Ca2+ demonstrate that the same B-1 cells that lack Lck are deficient in BCR-triggered downstream signaling events.

As noted above, it has been suggested that the phosphorylated form of CD5 is responsible for blocked BCR signaling, and that high levels of Lck are responsible for constitutive CD5 phosphorylation, in naive B-1 cells (13, 22). Because B-1 cells express little, if any, Lck, it was of interest to determine whether B-1 cells contain phosphorylated CD5. We immunoprecipitated CD5 from sort-purified B-1, B-2, and T cells and, following separation of proteins by SDS-PAGE, Western blotted for CD5 (with a different monoclonal CD5-specific Ab). B-1 cells contained immunoprecipitable CD5, as expected, although this was much less than that of T cells; B-2 cells contained no detectable immunoprecipitable CD5 (Fig. 3). This pattern matches that obtained by directly Western blotting sort-purified lymphocyte extracts after SDS-PAGE. A substantial amount of the B-1 cell CD5 was recognized by a phosphotyrosine-specific Ab, whereas no phosphotyrosine was detected in the much more abundant CD5 precipitated from T cells. Thus, abundant Lck (and pLck) failed to produce constitutive CD5 phosphorylation in T cells, whereas phosphorylated CD5 was found in B-1 cells despite undetectable levels of Lck and pLck. This lack of correlation among Lck, pLck, and pCD5 strongly suggests that Lck is not responsible for constitutive phosphorylation of CD5 in B-1 cells.



View larger version (47K):
[in this window]
[in a new window]
 
FIGURE 3. B-1 cells express phosphorylated CD5. B-1 cells were sort-purified from peritoneal washouts, and B-2 cells were sort-purified from splenocytes, of BALB/c mice following immunofluorescent staining with B220- and Mac-1-specific Abs at 4°C. T cells were purified by negative selection with magnetic beads. Lymphocyte populations were extracted with RIPA buffer. A, Extracted protein (10 µg) was separated by SDS-PAGE and then Western blotted with anti-CD5 Ab. Blots were stripped and reprobed for {beta}-actin to ensure equal loading. One of three comparable experiments is shown. B, Extracted protein was immunoprecipitated with Sepharose beads coupled to anti-CD5 Ab and immunoprecipitates were size separated by SDS-PAGE and Western blotted with anti-phosphotyrosine (pCD5) and anti-CD5 Abs. One of two comparable experiments is shown.

 
Our results on defective BCR signaling in B-1 cells are consistent with previous studies from this and other laboratories (9, 10, 11, 12, 14, 17, 19, 22, 29). However, our finding that B-1 cells lack Lck contrasts with several recent reports (20, 21, 22), although it is consistent with earlier work in which increased expression of Lck was not detected in peritoneal as compared with splenic B cells by immune complex kinase assay (11). The reason for the different results obtained in these different studies remains unclear, although in this respect it should be noted that a relatively small degree of T cell contamination would significantly raise the level of Lck detected in isolated B-1 cells. Regardless of how the disparate results on B-1 cell Lck content were obtained, the rapid, rigorous, and temperature-controlled purification procedure used here, along with the use of two different Lck-specific Ab reagents for Western blotting supplemented with quantitative PCR to assess gene expression, strongly suggests that the relative absence of Lck in B-1 cells most accurately reflects the normal situation in vivo, as does our finding of relatively deficient Lck expression in B-1 cells purified in the manner described by Cambier and colleagues. However, previous work indicating that BCR signaling is restored in Lck-deficient B-1 cells raises the possibility that a threshold level of Lck is sufficient to modulate signal transduction, although it should be pointed out that Baldari and colleagues (20, 21) reported diminished, not enhanced, BCR-induced activation of Raf, MEK, and ERK in Lck-deficient B-1 cells, and that secondary, non-cell autonomous effects have not been ruled out in Lck-deficient mice (21, 22).

The finding that abnormal BCR signaling in B-1 cells is not related to aberrantly increased expression of Lck raises the question of just what might be responsible for the generally acknowledged signaling defect in this B cell population. Although we found that B-1 cells lack Lck, we also found that B-1 cells express phosphorylated CD5, and so the latter may, as reported by others (12, 13, 19), play a key role in blocking BCR signaling in B-1 cells, presumably after phosphorylation by another src kinase. Recently, however, Bondada and colleagues reported that BCR signaling is defective in peritoneal B-1b cells that lack CD5 (30), indicating that abnormal BCR signaling takes place in the absence of CD5 in this B-1 cell subset. Thus, CD5 may be responsible for abnormal BCR signaling in some, but not all, B-1 cells. Alternatively, CD5 phosphorylation may only be a sign of, rather than a motive force for, increased kinase activity or diminished phosphatase activity that is ultimately responsible for defective BCR signaling. Although it seems clear that CD5 phosphorylation in B-1 cells is not driven by unusually high levels of Lck, the kinase responsible remains unidentified.


    Acknowledgments
 
We thank Sean Gurdak for assistance with B cell purification.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by Public Health Service Grants AI29690 and AI60896 awarded by the National Institutes of Health. R.F. is the recipient of a fellowship from the Spanish Liver Society and Agencia Valenciana de Ciencia y Tecnologia, Generalitat Valenciana. Back

2 Address correspondence and reprint requests to Dr. Thomas L. Rothstein, Immunobiology Unit, Evans Biomedical Research Center, Room 437, Boston Medical Center, 650 Albany Street, Boston, MA 02118. E-mail address: tr{at}bumc.bu.edu Back

3 Abbreviations used in this paper: RIPA, radioimmunoprecipitation assay; pLck, phosphor-Lck. Back

Received for publication February 24, 2005. Accepted for publication April 19, 2005.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Disclosures
 References
 

  1. Herzenberg, L. A.. 2000. B-1 cells: the lineage question revisited. Immunol. Rev. 175: 9-22.[Medline]
  2. Hardy, R. R., K. Hayakawa. 2001. B cell development pathways. Annu. Rev. Immunol. 19: 595-621.[Medline]
  3. Berland, R., H. H. Wortis. 2002. Origins and functions of B-1 cells with notes on the role of CD5. Annu. Rev. Immunol. 20: 253-300.[Medline]
  4. Rothstein, T. L.. 2002. Cutting edge: two B-1 or not to be one. J. Immunol. 168: 4257-4261.[Abstract/Free Full Text]
  5. Briles, D. E., M. Nahm, K. Schroer, J. Davie, P. Baker, J. Kearney, R. Barletta. 1981. Antiphosphocholine antibodies found in normal mouse serum are protective against intravenous infection with type 3 streptococcus pneumoniae. J. Exp. Med. 153: 694-705.[Abstract/Free Full Text]
  6. Boes, M., A. P. Prodeus, T. Schmidt, M. C. Carroll, J. Chen. 1998. A critical role of natural immunoglobulin M in immediate defense against systemic bacterial infection. J. Exp. Med. 188: 2381-2386.[Abstract/Free Full Text]
  7. Ochsenbein, A. F., T. Fehr, C. Lutz, M. Suter, F. Brombacher, H. Hengartner, R. M. Zinkernagel. 1999. Control of early viral and bacterial distribution and disease by natural antibodies. Science 286: 2156-2159.[Abstract/Free Full Text]
  8. Baumgarth, N., O. C. Herman, G. C. Jager, L. E. Brown, L. A. Herzenberg, J. Chen. 2000. B-1 and B-2 cell-derived immunoglobulin M antibodies are nonredundant components of the protective response to influenza virus infection. J. Exp. Med. 192: 271-280.[Abstract/Free Full Text]
  9. Rothstein, T. L., D. L. Kolber. 1988. Anti-Ig antibody inhibits the phorbol ester-induced stimulation of peritoneal B cells. J. Immunol. 141: 4089-4093.[Abstract]
  10. Morris, D. L., T. L. Rothstein. 1993. Abnormal transcription factor induction through the surface immunoglobulin M receptor of B-1 lymphocytes. J. Exp. Med. 177: 857-861.[Abstract/Free Full Text]
  11. Morris, D. L., T. L. Rothstein. 1994. Decreased surface IgM receptor-mediated activation of phospholipase C{gamma}2 in B-1 lymphocytes. Int. Immunol. 6: 1011.[Abstract/Free Full Text]
  12. Sen, G., G. Bikah, C. Venkataraman, S. Bondada. 1999. Negative regulation of antigen receptor-mediated signaling by constitutive association of CD5 with the SHP-1 protein tyrosine phosphatase in B-1 B cells. Eur. J. Immunol. 29: 3319-3328.[Medline]
  13. Gary-Gouy, H., J. Harriague, A. Dalloul, E. Donnadieu, G. Bismuth. 2002. CD5-negative regulation of B cell receptor signaling pathways originates from tyrosine residue Y429 outside an immunoreceptor tyrosine-based inhibitory motif. J. Immunol. 168: 232-239.[Abstract/Free Full Text]
  14. Chumley, M. J., J. M. Dal Porto, J. C. Cambier. 2002. The unique antigen receptor signaling phenotype of B-1 cells is influenced by locale but induced by antigen. J. Immunol. 169: 1735-1745.[Abstract/Free Full Text]
  15. Arnold, L. W., C. A. Pennell, S. K. McCray, S. H. Clarke. 1994. Development of B-1 cells: segregation of phosphatidyl choline-specific B cells to the B-1 population occurs after immunoglobulin gene expression. J. Exp. Med. 179: 1585-1595.[Abstract/Free Full Text]
  16. Hippen, K. L., L. E. Tze, T. W. Behrens. 2000. CD5 maintains tolerance in anergic B cells. J. Exp. Med. 191: 883-890.[Abstract/Free Full Text]
  17. Wong, S. C., W. K. Chew, J. E. Tan, A. J. Melendez, F. Francis, K. P. Lam. 2002. Peritoneal CD5+ B-1 cells have signaling properties similar to tolerant B cells. J. Biol. Chem. 277: 30707-30715.[Abstract/Free Full Text]
  18. Casola, S., K. L. Otipoby, M. Alimzhanov, S. Humme, N. Uyttersprot, J. L. Kutok, M. C. Carroll, K. Rajewsky. 2004. B cell receptor signal strength determines B cell fate. Nat. Immunol. 5: 317-327.[Medline]
  19. Bikah, G., J. Carey, J. R. Ciallella, A. Tarakhovsky, S. Bondada. 1996. CD5-mediated negative regulation of antigen receptor-induced growth signals in B-1 B cells. Science 274: 1906-1909.[Abstract/Free Full Text]
  20. Majolini, M. B., M. M. D’Elios, P. Galieni, M. Boncristiano, F. Lauria, G. Del Prete, J. L. Telford, C. T. Baldari. 1998. Expression of the T-cell-specific tyrosine kinase Lck in normal B-1 cells and in chronic lymphocytic leukemia B cells. Blood 91: 3390-3396.[Abstract/Free Full Text]
  21. Ulivieri, C., S. Valensin, M. B. Majolini, R. J. Matthews, C. T. Baldari. 2003. Normal B-1 cell development but defective BCR signaling in Lck–/– mice. Eur. J. Immunol. 33: 441-445.[Medline]
  22. Dal Porto, J. M., K. Burke, J. C. Cambier. 2004. Regulation of BCR signal transduction in B-1 cells requires the expression of the Src family kinase Lck. Immunity 21: 443-453.[Medline]
  23. Tumang, J. R., W. D. Hastings, C. Bai, T. L. Rothstein. 2004. Peritoneal and splenic B-1 cells are separable by phenotypic, functional, and transcriptomic characteristics. Eur. J. Immunol. 34: 2158-2167.[Medline]
  24. Fischer, G. M., L. A. Solt, W. D. Hastings, K. Yang, R. M. Gerstein, B. S. Nikolajczyk, S. H. Clarke, T. L. Rothstein. 2001. Splenic and peritoneal B-1 cells are distinct populations as defined by transcriptional and proliferative features that separate peritoneal B-1 from splenic B-2 cells. Cell. Immunol. 213: 62-71.[Medline]
  25. Sassone-Corsi, P., W. W. Lamph, M. Kamps, I. M. Verma. 1988. fos-Associated cellular p39 is related to nuclear transcription factor AP-1. Cell 54: 553-560.[Medline]
  26. Schneider, T. J., D. Grillot, L. C. Foote, G. E. Nunez, T. L. Rothstein. 1997. Bcl-x protects primary B cells against Fas-mediated apoptosis. J. Immunol. 159: 4834-4839.[Abstract]
  27. McIntyre, B. W., E. L. Evans, J. L. Bednarczyk. 1989. Lymphocyte surface antigen L25 is a member of the integrin receptor superfamily. J. Biol. Chem. 264: 13745-13750.[Abstract/Free Full Text]
  28. Cohen, D. P., T. L. Rothstein. 1991. Elevated levels of protein kinase C activity and {alpha}-isoenzyme expression in murine peritoneal B cells. J. Immunol. 146: 2921-2927.[Abstract]
  29. Chumley, M. J., J. M. Dal Porto, S. Kawaguchi, J. C. Cambier, D. Nemazee, R. R. Hardy. 2000. A VH11V{kappa} 9 B cell antigen receptor drives generation of CD5+ B cells both in vivo and in vitro. J. Immunol. 164: 4586-4593.[Abstract/Free Full Text]
  30. Sen, G., H. J. Wu, G. Bikah, C. Venkataraman, D. A. Robertson, E. C. Snow, S. Bondada. 2002. Defective CD19-dependent signaling in B-1a and B-1b B lymphocyte subpopulations. Mol. Immunol. 39: 57-68.[Medline]



This article has been cited by other articles:


Home page
Infect. Immun.Home page
R. Basu, S. Bhaumik, A. K. Haldar, K. Naskar, T. De, S. K. Dana, P. Walden, and S. Roy
Hybrid Cell Vaccination Resolves Leishmania donovani Infection by Eliciting a Strong CD8+ Cytotoxic T-Lymphocyte Response with Concomitant Suppression of Interleukin-10 (IL-10) but Not IL-4 or IL-13
Infect. Immun., December 1, 2007; 75(12): 5956 - 5966.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
R. Frances, J. R. Tumang, and T. L. Rothstein
Extreme skewing of annexin II and S100A6 expression identified by proteomic analysis of peritoneal B-1 cells
Int. Immunol., January 1, 2007; 19(1): 59 - 65.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. A. Campos, M. Szczepanik, M. Lisbonne, A. Itakura, M. Leite-de-Moraes, and P. W. Askenase
Invariant NKT Cells Rapidly Activated via Immunization with Diverse Contact Antigens Collaborate In Vitro with B-1 Cells to Initiate Contact Sensitivity
J. Immunol., September 15, 2006; 177(6): 3686 - 3694.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
R. L Cassady-Cain and A. K Kaushik
Increased negative selection impairs neonatal B cell repertoire but does not directly lead to generation of disease-associated IgM auto-antibodies
Int. Immunol., May 1, 2006; 18(5): 661 - 669.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Francés, R.
Right arrow Articles by Rothstein, T. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Francés, R.
Right arrow Articles by Rothstein, T. L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS