|
|
||||||||
Institute of Immunology and Infection Research, University of Edinburgh, Edinburgh, United Kingdom
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
) and Th2 (IL-5) inflammatory cytokines are suppressed (3, 4), although IL-4 remains intact and IL-10 levels are generally increased (5, 6, 7). Indeed, not only do filariasis patients peripheral blood leukocytes express higher levels of constitutive IL-10, but neutralizing Abs against IL-10 and/or TGF-
restore the ability of these cells to mount filarial-specific proliferative responses in vitro (5, 7). These observations, along with description of regulatory T cell (Treg)4 populations that act through IL-10 and TGF-
(8, 9, 10, 11, 12, 13), have led to the hypothesis that filarial infections induce Treg populations that suppress effector T cell responses, and thus promote parasite survival (14, 15). Tregs were originally demonstrated to govern autoreactivity (8), but similar populations are now known to arise in response to exogenous Ags, including those presented by viral (16, 17, 18) and bacterial (19, 20, 21, 22) pathogens. Moreover, CD4+CD25+ T cells curtail immunity to Leishmania (23, 24) and malaria (25) parasites in mouse models. Although impairing resistance against the pathogen, Tregs may also provide beneficial protection against immunopathology (26, 27, 28, 29). There is also some suggestion that the pathogens themselves can manipulate the regulatory cells to immunosuppress the host and so potentiate their survival (16, 20).
Indications of Treg activity in human helminth infections are provided by the phenotype of T cell clones from onchocerciasis patients, which express regulatory cytokines (IL-10 and TGF-
) and CTLA-4 (30). In addition, CTLA-4 expressed on T cells from lymphatic filariasis patients can suppress IL-5 production, among other responses (31). More recently in Schistosoma mansoni infection, CD4+CD25+ T cells and IL-10 have been shown to inhibit both Th1 development (32) and egg-induced pathology (28). These studies suggest that Tregs are generated during helminth infections, but to date no experimental evidence has been provided to show that Tregs promote parasite survival by mediating the immune down-modulation seen during chronic infection (14, 15).
To address this hypothesis directly, we studied a unique model of filariasis, Litomosoides sigmodontis infection of permissive BALB/c mice (33). L. sigmodontis is a close relative of the Brugia and Wuchereria species, which are responsible for some 120 million cases of human lymphatic filariasis in the world today (34, 35). Intriguingly, resistant mouse strains (e.g., C57BL/6) are dependent on Th2 responses for resistance, yet susceptible mouse strains (e.g., BALB/c) also mount a highly skewed Th2 response (36). The lack of efficacy of the BALB/c Th2 response suggests that immunoregulatory factors, such as Treg populations, hamper its ability to protect against infection. Using L. sigmodontis, we provide the first experimental demonstration that Tregs are indeed responsible for susceptibility to a helminth parasite. Specifically, we demonstrate that infection results in increased expression of Foxp3 and the shutdown of CD4+ T cell immunity, and that intervention against Tregs using Abs against CD25 and glucocorticoid-induced TNF receptor family-related gene (GITR), but not against IL-10R, provides an immunological cure for filarial infection.
| Materials and Methods |
|---|
|
|
|---|
Female BALB/c mice were used at 68 wk of age and were maintained in individually ventilated cages. The L. sigmodontis life cycle was maintained in gerbils using the mite vector Ornithonyssus bacoti. Infective larvae (L3) were recovered from mites 13 days postfeeding by dissection in RPMI 1640 supplemented with 10% FBS (Invitrogen), and mice were infected s.c. on the upper back. Each mouse received a dose of 25 L3, chosen to give sufficient parasite recoveries to allow accurate numeration, but small enough to allow optimal survival and maturation of adult worms (37). Thoracic lavage with 10 ml of cold AIM V medium was used to recover parasites. L. sigmodontis whole worm Ag (LsAg) was prepared by collecting the PBS-soluble fraction of homogenized adult male and female worms.
Cell purifications and in vitro restimulations
The parathymic, posterior mediastinal, and paravertebral lymph nodes (thoracic lymph nodes (tLNs)) draining the thoracic cavity (TC) were dissociated and washed in AIM V medium before being resuspended in RPMI 1640 with 0.5% mouse serum (Caltag-Medsystems), 100 U/ml penicillin, 100 µg/ml streptomycin, and 2 mM L-glutamine. TC cells were isolated from lavage fluid. For CD4+ T cell purifications, TC cells were adhered to plastic for 2 h at 37°C and the nonadherent population was taken. CD4+ T cells were then isolated by CD4 MicroBead magnetic cell sorting (Miltenyi Biotech) per the manufacturers instructions, except that HBSS with 0.25% mouse serum was used as the separation medium and 15 µg of rat IgG/1 x 107 cells was used as a block. TC CD4+ T cell purities were 7890% depending on experiment, but did not vary within experiments. TC CD4+ T cell populations were free of contaminating F4/80+ alternatively activated macrophages. Irradiated (30 Gy) splenic APCs were added to 96-well round-bottom plates at 1 x 106 cells/well, together with 1 x 105 CD4+ T cells/well. Whole tLN cells were used at 5 x 105 cells/well. Cultures were stimulated with medium alone or 10 µg/ml LsAg. Supernatatants were sampled at 72 h for cytokine analysis, and 1 µCi/well of methyl-[3H]thymidine was added for 16 h to measure proliferation. CD4+CD25+ and CD4+CD25 T cell populations were isolated from the TC by negative selection for CD4 cells using anti-CD8 (53-6.72), anti-B220 (RAB632), anti-MHC class II (M5/114.15.2), anti-CD11b (M1/70), anti-Gr1 (RB6-8C5), and anti-F4/80 (A3-1), with anti-rat IgG Dynal Beads (Dynal). CD25 purification was then performed using anti-CD25phycoerythrin in combination with anti-phycoerythrin microbeads (Miltenyi Biotech). The CD4+CD25+ fraction was 75.9% CD4+ with 72.5% CD4+CD25+. The CD4+CD25 fraction was 78.8% CD4+ with 72.4% CD4+CD25. Anti-CD3 (145C2.11) was added to the cultures at 0.125 µg/ml, and 1 x 105 irradiated naive spleen cells were used as APCs.
Abs and reagents
Ab pairs used for cytokine ELISAs were: IL-4 (11B11/BVD6-24G2), IL-5 (TRFK5/TRFK4), IL-10 (JES52A5/SXC-1), and IFN-
(R4-6A2/XMG1.2). Recombinant murine IL-4, IFN-
, IL-10, and IL-5 (SigmaAldrich) were used as cytokine standards. Detection Abs were biotinylated and used with ExtrAvidin-alkaline phosphatase conjugate and Sigma FastTM p-nitrophenyl phosphate substrate. For flow cytometry, nonspecific binding was blocked with 4 µg of rat IgG/1 x 106 cells, and the following Abs were applied: PE-conjugated anti-CTLA-4 (UC10-4F10-11), APC-conjugated streptavidin, Cy-Chrome-conjugated anti-CD4 (RM4-5), biotinylated anti-CD25 (7D4), anti-GITR (DTA-1), and FITC-conjugated goat F(ab')2 anti-rat IgG (Caltag-Medsystems). All staining was compared against the relevant isotype controls to verify specificity. To measure intracellular CTLA-4, cells were permeabilized and stained with BD PharMingens Cytofix/Cytoperm kit. Flow cytometric acquisition and analysis was performed using a FACSCalibur running CellQuest Pro software. ELISA detection was performed using ExtrAvidin-alkaline phosphatase conjugate (Sigma-Aldrich) in conjunction with Sigma FastTM p-nitrophenyl phosphate tablet substrate (Sigma-Aldrich). Reagents were obtained from BD Biosciences or American Type Culture Collection unless otherwise stated.
TGF-
bioassay
TC TGF-
levels were measured in the first milliliter of thoracic lavage fluid using a bioassay as previously described (38). In brief, 1.6 x 105 mink lung epithelial cells, modified to express a luciferase reporter gene under the control of a TGF-
-responsive promoter, were added to 96-well flat-bottom white FluoroNunc plates (Nunc) in 50 µl of RPMI 1640 supplemented with 0.5% mouse serum, 2 mM L-glutamine, 100 U/ml penicillin, and 100 µg/ml streptomycin. The cells were allowed to adhere for 2 h, after which the medium was replaced with sample. The bioassay only measures the active form of TGF-
, thus samples were added directly to the plates to measure endogenously active TGF-
, and to measure total levels of TGF-
the samples were first heat activated for 5 min at 80°C. Recombinant human TGF-
1 (Roche Diagnostics) was used as a standard. The plates were incubated for 16 h at 37°C, 5% CO2, and the Bright-Glo Luciferase Assay System (Promega) was used to quantify luciferase expression on a LUMIstar (BMG Labtech) per the manufacturers instructions.
Real-time PCR
CD4+ T cells were purified from the tLN, brachial LN, and TC of individual L. sigmodontis-infected mice and from pooled (five per group) naive mice. Purified CD4+ T cells were resuspended in TRIzol (Invitrogen) and RNA extraction was performed per the manufacturers instructions. After treatment with DNase1 (Ambion), cDNA was synthesized using Moloney murine leukemia virus reverse transcriptase (Stratagene). Quantification of Foxp3 mRNA was performed by real-time PCR using the LightCycler (Roche Diagnostics). The Foxp3 forward and reverse primers were CCTGGCCTGCCACCTGGGATCAA (exon 3/4 junction) and TTCTCACAACCAGGCCACTTG (exon 5), respectively. PCR amplifications were performed in 10 µl, containing 1 µl of cDNA, 0.3 mM primers and 5 µl of Qiagen hotstart Sybergreen using the following conditions: 15-min hotstart at 95°C, 15-s denaturation at 95°C, 20-s annealing of primers at 54°C, and 15-s elongation at 72°C, for 4060 cycles. The fluorescent DNA binding dye was monitored after each cycle at 82°C. Foxp3 expression was normalized against
-actin; forward and reverse primer sequences were TGGAATCCTGTGGCATCCATGAA and TAAAACGCAGCTCAGTAACAGTC, respectively.
-Actin PCR was performed as above, except that LightCycler-DNA SYBR green I mix (Roche Molecular Biochemicals) was used without hotstart, and the DNA binding dye was monitored at 86°C. Eight serial dilutions of cDNA pooled from each sample were used to create a standard curve (in arbitrary units) against which
-actin and Foxp3 mRNA expression were normalized. Foxp3 mRNA levels were then expressed as a ratio to
-actin mRNA expression. Two cDNA templates were produced from each sample, and PCR was performed twice from each cDNA template. Results are displayed as one representative run from each experiment.
In vivo Ab treatment
In vivo treatments used anti-GITR (DTA-1), anti-mouse CD25 (PC61), or anti-mouse IL-10R (1B1.3a). Mice received 1 mg of anti-CD25 in PBS on day 27 of infection or 1 mg of anti-GITR on days 27 and 34 for single treatments. For combined anti-CD25/GITR treatment, mice received 1 mg of each Ab on day 27. Mice received 1 mg of anti-IL-10R on day 27, followed by three doses of 0.5 mg (1 mg in second experiment) every 3 days. An equivalent dose of rat IgG was used as a control.
Statistics
Statistical analysis was performed using Minitab version 14. When combining experimental data using ANOVA, it was first demonstrated that there were no significant interactions due to experimental differences.
| Results |
|---|
|
|
|---|
To investigate whether the immune regulation, evident in human filariasis, would be reproduced within a mouse model, susceptible BALB/c mice were infected with L. sigmondontis L3 larvae and their parasite-specific immune responses were followed for a 60-day period. Fig. 1A represents the course of L. sigmodontis development within this time period, in which parasites migrate through the lymphatic system to the TC. After
55 days, infection reaches patency, defined as the release of newborn microfilarial parasites into the bloodstream (39). To assay local immune responses to infection, we isolated the parathymic, posterior mediastinal, and paravertebral lymph nodes (tLNs) that drain the TC and challenged them in vitro with soluble adult whole worm homogenate (LsAg).
|
The type 2 cytokines IL-4 and IL-5 were produced by tLN cells in response to parasite Ag from an early point in infection (Fig. 1, C and D), whereas IFN-
was released later and at relatively low levels (<50 U/ml) in a largely Ag-nonspecific manner (Fig. 1E). This profile of a Th2-dominated response to filarial nematode infection is consistent with previous reports of L. sigmodontis infection in BALB/c mice (40).
The two cytokines most strongly implicated in down-regulation of immune responses are IL-10 and TGF-
(9, 11). Thoracic lymph node cells showed Ag-specific IL-10 production from day 10, rising to a peak on day 40 (Fig. 1F). A 3- to 6-fold elevation of TGF-
was detectable in the thoracic lavage fluid of infected mice from day 13 postinfection, remaining elevated throughout (Fig. 1G). The majority of the TGF-
was in the latent form. Ag-specific production of TGF-
by tLN cells was not evident (data not shown). Thus, both Th2 and regulatory cytokines contribute to the early immune response and remain at significant levels throughout infection.
T cell responses are down-regulated at the site of infection
The localized nature of L. sigmodontis adult infection in the TC offered the opportunity to study T cell responses within the population in direct contact with the parasites. Therefore, we purified TC CD4+ T cells, 40 and 60 days postinfection, with a mean recovery of 3.4 x 105 CD4+ T cells per mouse. Infections were phased so that T cell assays coincided, and there were no significant differences between day 40 and day 60 worm recoveries (data not shown). CD4+ T cells were restimulated in vitro with LsAg and Con A using irradiated spleen cells from naive mice as a source of APCs. As with tLN populations, patent infection was associated with a loss of Ag responsiveness by TC CD4+ T cells, with those recovered 60 days postinfection showing lower proliferation to both LsAg (Fig. 2A) and Con A (data not shown) than those taken at day 40. Moreover, by day 60, there was a substantial decrease in Ag-specific IL-4, IL-5, and IL-10 production (Fig. 2, BD).
|
To study whether CD4+ regulatory T cells are induced by filarial infection, we tested the expression of a set of markers (CD25, CTLA-4, and GITR), which in naive mice are constitutively expressed by Tregs. These markers are also found on recently activated CD4+ T cells, but their up-regulation in chronic infection would be indicative of Treg activity warranting further functional testing. Therefore, we isolated cells from the TC, lymph nodes, and spleens of mice infected with L. sigmodontis and analyzed the expression of CD25, GITR, and intracellular CTLA-4 among the CD4+ subset.
The phenotype of CD4+ T cells from the TC was analyzed from day 13 onward, after the arrival of parasites in this compartment. Profiles changed little at early time points, other than significantly raised CTLA-4 at day 13 and CD25 at day 20 (data not shown). As infection progressed, however, the percentage of TC CD4+ T cells expressing CTLA-4 and high levels of GITR (GITRhigh) increased dramatically until the dominant phenotype became CTLA-4+GITRhigh, with 6070% of the CD4+ T cells double positive for these markers by day 60 (Fig. 3A). A minority of cells coexpressing CTLA-4 and GITRhigh were CD25+, and these displayed significantly higher levels of CTLA-4 than did the CD4+CD25 cells (medians of 50.5 and 11.3, respectively; p < 0.05, Mann-Whitney), and also of GITR (medians of 114.5 and 34.1, respectively; p < 0.05, Mann-Whitney) (Fig. 3B). Data from individual mice (Fig. 3C) emphasize the consistent up-regulation of these markers by TC CD4+ T cells from day 40 onward. Thus, the hyporesponsive phenotype of the TC CD4+ T cell population was associated with their increased expression of markers associated with T cell regulation.
|
Filarial infection induces early expression of Foxp3
Expression of the Foxp3 gene has been shown to be critical for the development of particular populations of Tregs. These include natural CD4+CD25+ Tregs (41, 42, 43), with increasing evidence for a role in adaptive Treg populations (44, 45), although not all Treg populations express Foxp3 (46). To determine whether filarial infection expands or induces Foxp3-dependent Treg activity, the expression of Foxp3 mRNA by CD4+ T cells from the TC and draining lymph nodes of infected mice was measured. Expression was measured in whole purified CD4+ T cell populations, as CD25, CTLA-4, and GITR mark both Tregs and activated effector T cells, and even in the naive mouse, regulatory Foxp3-expressing T cells can be found in the CD25 fraction (13).
The expression of Foxp3 was found to be increased in CD4+ T cells isolated from the lymph nodes draining the initial s.c. infection site 12 days postinfection (Fig. 4A). At days 28 and 60 postinfection, the ratio of Foxp3 to
-actin in the tLN CD4+ T cell population was equivalent to that of the naive controls (Fig. 4, B and C). However, at these times, the total number of CD4+ T cells in the tLN had increased substantially (Fig. 4D), indicating that there is expansion of both Foxp3+ and Foxp3 populations maintaining the Foxp3:
-actin ratio at a steady state. Thus, the initial prominent increase in Foxp3 activity is balanced by expansion of effector cells (Foxp3), and once equilibrium is regained, both cell populations maintain homeostasis.
|
-actin ratio, when tested at days 12, 28, and 60 (data not shown). Expansion of the TC CD4+ T cell population does also occur (47), thus there appears to be proportional expansion of both Foxp3+ and Foxp3 cells. Notably, the dominance of hyporesponsive CD4+CTLA-4+GITR+ T cells at 60 days postinfection was not matched by an increase in the Foxp3:
-actin ratio, as would be expected if these cells represented a Treg population. Therefore, the CD4+CD25CTLA-4+GITR+ T cells at the site of infection are likely to represent a down-modulated effector cell population. Neutralizing Tregs results in increased parasite clearance
The hyporesponsive phenotype of the CD4+ T cell population, and the increases seen first in Foxp3 expression and subsequently in Treg-associated surface markers, indicate that infection stimulates Treg activity. To directly test whether Tregs are acting to suppress the hosts effector responses and so promote parasite survival, Abs against CD25 and GITR were used in vivo to intervene against regulatory control during an established infection. The anti-CD25 mAb PC61 has been shown to deplete Tregs expressing CD25, and in our hands the circulating CD4+CD25+ population was effectively removed for at least 7 days after treatment of naive mice (data not shown). The anti-GITR Ab is an agonistic Ab and has been shown to ablate regulatory activity of CD4+CD25+ T cells (13), to act as a costimulator toward activated CD4+ effector T cells (48, 49, 50, 51), and to render them resistant to suppression by Tregs (52).
Ab treatments were given 27 days postinfection (the time of final molt to adult worms) to allow sufficient time for the parasite to establish its regulatory mechanisms within the host. Autopsies were performed before (day 40) and after (day 60) development of patent microfilaremia. Treatments with anti-CD25 or anti-GITR alone had no effect on worm burdens when assessed 40 or 60 days postinfection. Combining the two treatments, however, did result in a significant reduction in mean worm load of 73% compared with the IgG-treated control mice when quantified 60 days postinfection (Fig. 5).
|
|
|
Given the efficacy of anti-CD25/GITR cotreatment from 27 days postinfection, CD4+CD25+ T cells were purified from the site of infection during this time period to test their ability to inhibit the L. sigmodontis-specific response of CD4+CD25 T cells. Fig. 8 demonstrates that TC CD4+CD25 cells showed stronger proliferative responses toward both LsAg and anti-CD3 stimulation than did CD4+CD25+ T cells. Production of the effector cytokine IL-5 showed a similar pattern to that of proliferation (data not shown). When mixed at a 1:1 ratio, the CD4+CD25+ cells did not inhibit proliferation of the CD4+CD25 cells (Fig. 8). In the same assay, and under the same conditions, naive CD4+CD25+ cells were able to inhibit the responses of naive CD4+CD25 cells to anti-CD3 stimulation (data not shown). Th2 cells are known to be more resistant to in vitro suppression by CD4+CD25+ Tregs (57), as they can expand in the absence of IL-2 through responsiveness to Th2 growth factors such as IL-4, IL-7, and IL-9 (57, 58). Thus, although the majority of TC proliferating cells are of the CD4+CD25 phenotype, their proliferation is not suppressed by the CD4+CD25+ fraction, either because the CD4+CD25 cells are not IL-2 dependent or because the CD4+CD25+ cells do not exert classical in vitro Treg suppressive ability at this stage of the infection.
|
Increased production of IL-10 occurs in chronic human filarial infections and has been associated with filarial immunosuppression (5, 7). IL-10 is therefore a potential mediator of CD25+GITR+ cell activity; however, IL-10 production declined as immunosuppression became established (Figs. 1F and 2D) and rose after negation of Treg activity (Fig. 7C). To determine whether IL-10 played a role in the observed T cell hyporesponsiveness, CD4+ T cells were isolated from the TC 60 days postinfection and were restimulated with LsAg in the presence of a neutralizing anti-IL-10R Ab. The doses of anti-IL-10R chosen, 0.1 and 0.01 µg/ml, were based on those that gave maximal increases in IFN-
production during in vitro culture of tLN cells from 60-day infected mice (data not shown). Fig. 9A demonstrates that neutralizing the IL-10R did not restore the proliferative capability of the TC CD4+ T cells, although it did increase their production of IFN-
(Fig. 9B). Therefore, IL-10 does not appear to mediate the hyporesponsive phenotype of the TC CD4+ T cell population.
|
production (Fig. 9D) without rescuing production of IL-4, IL-10, or IL-5 (data not shown). Thus, we conclude that IL-10 does not play a major role in controlling parasite recoveries. | Discussion |
|---|
|
|
|---|
We now present the first experimental evidence that Tregs permit the establishment of a helminth infection. The initial infection of BALB/c mice by L. sigmodontis larvae resulted in an increase in expression of Foxp3, a gene critically associated with the development of Tregs (41, 42, 43), indicating that infection induces an early expansion of Treg activity. Once infection had become fully patent (defined as fully developed adult worms and blood microfilaremia), BALB/c mice showed a loss of parasite-specific immune responses, concordant with the filarial-induced suppression seen in humans. Functional hyporesponsiveness was associated with significant increases in expression of the Treg-associated markers CD25, CTLA-4, and GITR, which was most marked in the TC population in contact with parasites. Two subsets could be differentiated by CD25 expression once infection had reached patency. The majority of TC CD4+ T cells coexpressed CTLA-4 and GITR but were CD25 negative. In contrast, the CD25+ population had the highest levels of CTLA-4 and GITR.
To experimentally test the hypothesis that Tregs are responsible for filarial-induced suppression and worm survival, we treated infected BALB/c mice with anti-CD25 and anti-GITR. We demonstrated that if depletion of CD25+ cells is combined with the use of an agonistic anti-GITR Ab, BALB/c mice with established infections are induced to kill their adult worms. Thus, we can conclude that a population of CD25+ Tregs dampens protective immunity to filarial parasites and that ligation of GITR is also necessary for protection to be effective.
The requirement for cotreatment with anti-GITR and CD25 suggests that neither treatment alone is sufficient to fully neutralize regulation. A similar requirement for combined treatments has been observed during infection with murine leukemia virus (61), and combined anti-CD25 and anti-CTLA-4 treatments are more effective at breaking self-tolerance than either Ab alone (62). One explanation is that both Abs act synergistically on a single regulatory population. Alternatively, as anti-GITR treatment can act as a costimulatory molecule for effector T cells (49, 50, 51) and can make effector cells more resistant to suppression by Tregs (52), a second possibility is that the anti-GITR Ab is acting on a nonregulatory effector T cell. In agreement with this, during the adult stage of infection, the expression of Foxp3 mRNA in the TC did not correlate with that of GITR or CTLA-4. This suggests that the majority of CD4+GITRhighCTLA-4+ T cells are effector cells and that their hyporesponsive phenotype seen at patency is not due to increased Foxp3-dependent Treg activity. The CD4+CD25GITRhighCTLA-4+ cells therefore might represent an effector cell population that has been "conditioned" toward a down-modulated or hyporesponsive phenotype over the course of infection, and GITR ligation may be delivering an activation, or anti-regulatory, signal to effector T cells (48, 49, 50, 51, 63). Thus, the success of combined Ab treatment may be due to two separate actions on distinct target populations: the anti-CD25 Ab, which depletes the Treg population, and anti-GITR, which reactivates down-modulated anti-parasite effector cells, allowing them to reach their potential in eradicating infection.
In opposition to the costimulatory effects of GITR, signals through CTLA-4 are well documented to inhibit T cell responses (64). Expression of CTLA-4 is required for the hyporesponsive phenotype of CD4+ T cells induced by oral tolerance (65) and plays a critical role in limiting Th2 responses (66). In relation to Th2-inducing parasites, CTLA-4 blockade during Nippostrongylus brasiliensis infection resulted in enhanced parasite-specific immunity, stronger Th2 cytokine production, and diminished parasite numbers (67). CTLA-4 expressed on CD4+CD25 T cells during infection therefore might mediate their hyporesponsive phenotype, and its up-regulation may be a mechanism by which effector T cell response is turned off. Thus, during patent L. sigmodontis infection, the responsiveness of the CD4+CD25 T cell population may reflect a balance between inhibitory signals through CTLA-4 and costimulatory signals through GITR. Interestingly, anti-CD25/GITR treatment caused a greater reduction in CTLA-4 expression than GITR expression, potentially rendering the CD4+CD25 population more responsive to costimulatory than inhibitory signals.
The killing of adult L. sigmodontis worms induced by combined anti-CD25/GITR treatment was associated with a general enhancement of parasite-specific immunity. Of particular note was the increase in IL-5, a key cytokine in the development of immunity to L. sigmodontis larval stages, both in vaccination models and in primary infections (54, 55, 56, 68). IL-5 is also strongly involved in the lethal response to adult L. sigmodontis worms after the establishment of patent infections (55, 68). The increased production of IL-5 is therefore a likely candidate for orchestrating the clearance of adult worms after Ab treatments. In relation to the human infection, IL-5 is one of the cytokines characteristically suppressed in individuals with chronic filarial infection (3, 4), and thus it is likely that the down-regulation of IL-5 during infection is an important dictate of parasite survival.
Although IL-10 is implicated in mediating proliferative suppression in filariasis patient-derived T cells in vitro (69), our data do not demonstrate a regulatory role on the Th2 response. After an early peak, IL-10 production declined during L. sigmondontis infection and was actually increased upon successful treatment of infection; moreover, Ab-mediated neutralization of IL-10R in vitro did not restore T cell responsiveness and in vivo failed to restore protective immunity or to change the intensity of the Th2 response. In resistant mouse strains, IL-10 deficiency alone failed to influence resistance or susceptibility, although a regulatory role for IL-10 did come to light in the absence of IL-4, indicating a role in regulating non-Th2 components (70). IL-10, therefore, might still play a role in regulating L. sigmodontis infection, possibly acting in conjunction with other cytokines such as TGF-
(71), but our study demonstrates that it is not the key or sole mechanism for CD4+CD25+ Treg action.
This outcome contrasts with the prominent role of Treg-derived IL-10 in infection models where Th1 immune responses are protective (72). A prime example is Leishmania major infection, in which IL-10 is the pivotal down-regulatory mediator produced by CD4+CD25+ T cells and acts to inhibit the protective Th1 response (23, 73). It is important to note, however, that IL-10 generally exerts a more profound suppression of Th1 than Th2 responses (32). In infections with Th2-inducing helminth parasites, IL-10 is in fact required to promote Th2 responses, such that IL-10/ mice fail to mount protective Th2 responses toward Trichuris muris and develop chronic infections (74). In the immune response to S. mansoni infection, which contains both Th1 and Th2 components, IL-10 production by CD4+CD25+ Tregs is linked to the inhibition of Th1 immunity and subsequent augmentation of Th2 (28, 32). Similarly, differential effects of IL-10 on Th1 and Th2 responses have been noted during infection with Trichinella spiralis, where IL-10 deficiency has been found to inhibit Th2-mediated killing of the adult worms, while simultaneously promoting the Th1-mediated killing of muscle larvae (75). We conclude that although IL-10 does dampen Th1 immunity during L. sigmodontis infection, it does not play a key role in promoting parasite survival in the largely Th2-dependent context of immunity to L. sigmodontis.
A fascinating issue for future study is how nematodes induce Treg activity. One possibility is that long-lived parasites actively induce Tregs, for example by signaling through particular TLRs to induce the production of regulatory cytokines (76) or by secretion of TGF-
homologues (38). If the parasites themselves are driving Treg activity, then a central question will be the lineage of the activated Treg population: do parasites recruit pre-existing "natural" Tregs or do they induce development of Treg from Th0 precursors? Tregs responding to L. major and certain viral infections do appear to be recruited from the pre-existing populations (17, 23), whereas Bordetella pertussis infection induces naive Th0 precursor cells to become Tr1 cells (20). The expression of Foxp3 mRNA, a marker for natural Tregs, was increased during the early stages of L. sigmodontis infection, suggesting that a natural pre-existing Treg population is expanded in the presence of the parasite. However, Foxp3+ regulatory T cells can develop from naive precursors under the influence of TGF-
(44, 45), and as L. sigmodontis provoked TGF-
production throughout infection, it is also possible that a new population of Tregs was actively induced by this route.
If the Tregs involved are of "natural" origins, a second question of equal importance is whether the Treg populations are specific for parasite Ags or if they act in a nonspecific manner to prevent overly exuberant immune responses. Helminth-induced Tregs are capable of Ag-nonspecific suppression, as CD4+CD25+ T cells isolated from mice infected with Heligmosoides polygyrus are able to inhibit inflammation in a murine model of allergy.5 Equally, the presence of a patent L. sigmodontis infection down-modulates inflammation invoked during allergic airway infiltration (M. S. Wilson, M. D. Taylor, and R. M. Maizels, unpublished observations), demonstrating that whether or not Tregs are parasite-specific, they can act in an Ag-nonspecific manner. Definition of their Ag specificity will be important to allow therapeutic interventions to be targeted solely against the Tregs involved in infection, rather than indiscriminately against whole Treg populations, where treatment could also potentially disrupt self-tolerance.
In conclusion, we offer a wider perspective for the role of Tregs in chronic helminth infections, which afflict >1 billion people worldwide. Although it is not surprising that the response to infection should engender a regulatory component, our data argue that Tregs are essential to continued parasite survival. These findings provide a conceptual framework to understand helminth parasitism, in which host regulatory pathways are recruited or exploited by the pathogens to aid their own survival. This understanding, in turn, will suggest therapeutic pathways to boost host immunity (either naturally or in the context of vaccination) to ensure that effector mechanisms gain precedence over the inappropriately invoked down-regulation.
| Disclosures |
|---|
|
|
|---|
| Acknowledgments |
|---|
| Footnotes |
|---|
1 This work was supported by the Medical Research Council (G9901118), the European Commission (ICA4-CT-1999-10002), and the Wellcome Trust (059423). ![]()
2 Current address: School of Life Sciences, Napier University, 10 Colinton Road, Edinburgh EH10 5DT, U.K. ![]()
3 Address correspondence and reprint requests to Dr. Rick M. Maizels, Institute of Immunology and Infection Research, Ashworth Laboratories, West Mains Road, University of Edinburgh, Edinburgh EH9 3JT, U.K. E-mail address: rick.maizels{at}ed.ac.uk ![]()
4 Abbreviations used in this paper: Treg, regulatory T cell; GITR, glucocorticoid-induced TNF receptor family-related gene; LsAg, L. sigmodontis whole worm Ag; tLN, thoracic lymph node; TC, thoracic cavity. ![]()
5 M. S. Wilson, M. D. Taylor, A. Balic, C. A. M. Finney, J. R. Lamb, and R. M. Maizels. Suppression of allergic airway inflammation by helminth-induced regulatory T cells. Submitted for publication. ![]()
Received for publication August 17, 2004. Accepted for publication January 20, 2005.
| References |
|---|
|
|
|---|
responses in human lymphatic filariasis as a function of clinical status and age. J. Infect. Dis. 175:1276.[Medline]
: the missing link in CD4+CD25+ regulatory T cell-mediated immunosuppression. Cytokine Growth Factor Rev. 14:85.[Medline]
, expressed in microfilarial and adult stages of Brugia malayi. Infect. Immun. 68:6402.
induces a regulatory phenotype in CD4+CD25 T cells through Foxp3 induction and down-regulation of Smad7. J. Immunol. 172:5149.
induction of transcription factor Foxp3. J. Exp. Med. 198:1875.
but not by a Th1 to Th2 shift. Int. Immunol. 12:623.
-interferon and interleukin-5 in the control of murine filariasis. Infect. Immun. 71:6978.
regulates proinflammatory cytokine production and determines the outcome of lethal and nonlethal Plasmodium yoelii infections. J. Immunol. 171:5430.This article has been cited by other articles:
![]() |
K. N. Couper, P. A. Lanthier, G. Perona-Wright, L. W. Kummer, W. Chen, S. T. Smiley, M. Mohrs, and L. L. Johnson Anti-CD25 Antibody-Mediated Depletion of Effector T Cell Populations Enhances Susceptibility of Mice to Acute but Not Chronic Toxoplasma gondii Infection J. Immunol., April 1, 2009; 182(7): 3985 - 3994. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. J. Mylonas, M. G. Nair, L. Prieto-Lafuente, D. Paape, and J. E. Allen Alternatively Activated Macrophages Elicited by Helminth Infection Can Be Reprogrammed to Enable Microbial Killing J. Immunol., March 1, 2009; 182(5): 3084 - 3094. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. D'Elia, J. M. Behnke, J. E. Bradley, and K. J. Else Regulatory T Cells: A Role in the Control of Helminth-Driven Intestinal Pathology and Worm Survival J. Immunol., February 15, 2009; 182(4): 2340 - 2348. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. J. McSorley, Y. M. Harcus, J. Murray, M. D. Taylor, and R. M. Maizels Expansion of Foxp3+ Regulatory T Cells in Mice Infected with the Filarial Parasite Brugia malayi J. Immunol., November 1, 2008; 181(9): 6456 - 6466. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Rausch, J. Huehn, D. Kirchhoff, J. Rzepecka, C. Schnoeller, S. Pillai, C. Loddenkemper, A. Scheffold, A. Hamann, R. Lucius, et al. Functional Analysis of Effector and Regulatory T Cells in a Parasitic Nematode Infection Infect. Immun., May 1, 2008; 76(5): 1908 - 1919. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. T. Audicana and M. W. Kennedy Anisakis simplex: from Obscure Infectious Worm to Inducer of Immune Hypersensitivity Clin. Microbiol. Rev., April 1, 2008; 21(2): 360 - 379. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. P. Hubner, B. Pasche, S. Kalaydjiev, P. T. Soboslay, A. Lengeling, H. Schulz-Key, E. Mitre, and W. H. Hoffmann Microfilariae of the Filarial Nematode Litomosoides sigmodontis Exacerbate the Course of Lipopolysaccharide-Induced Sepsis in Mice Infect. Immun., April 1, 2008; 76(4): 1668 - 1677. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Dittrich, A. Erbacher, S. Specht, F. Diesner, M. Krokowski, A. Avagyan, P. Stock, B. Ahrens, W. H. Hoffmann, A. Hoerauf, et al. Helminth Infection with Litomosoides sigmodontis Induces Regulatory T Cells and Inhibits Allergic Sensitization, Airway Inflammation, and Hyperreactivity in a Murine Asthma Model J. Immunol., February 1, 2008; 180(3): 1792 - 1799. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. H. Nguyen, S. Shashidhar, D. S. Chang, L. Ho, N. Kambham, M. Bachmann, J. M. Brown, and R. S. Negrin The impact of regulatory T cells on T-cell immunity following hematopoietic cell transplantation Blood, January 15, 2008; 111(2): 945 - 953. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D. Taylor, A. Harris, S. A. Babayan, O. Bain, A. Culshaw, J. E. Allen, and R. M. Maizels CTLA-4 and CD4+CD25+ Regulatory T Cells Inhibit Protective Immunity to Filarial Parasites In Vivo J. Immunol., October 1, 2007; 179(7): 4626 - 4634. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Guilliams, G. Oldenhove, W. Noel, M. Herin, L. Brys, P. Loi, V. Flamand, M. Moser, P. De Baetselier, and A. Beschin African Trypanosomiasis: Naturally Occurring Regulatory T Cells Favor Trypanotolerance by Limiting Pathology Associated with Sustained Type 1 Inflammation J. Immunol., September 1, 2007; 179(5): 2748 - 2757. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Burke, L. M. Ganley-Leal, A. Khatri, and L. M. Wetzler Neisseria meningitidis PorB, a TLR2 Ligand, Induces an Antigen-Specific Eosinophil Recall Response: Potential Adjuvant for Helminth Vaccines? J. Immunol., September 1, 2007; 179(5): 3222 - 3230. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. N. Couper, D. G. Blount, J. B. de Souza, I. Suffia, Y. Belkaid, and E. M. Riley Incomplete Depletion and Rapid Regeneration of Foxp3+ Regulatory T Cells Following Anti-CD25 Treatment in Malaria-Infected Mice J. Immunol., April 1, 2007; 178(7): 4136 - 4146. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. P. Beiting, L. F. Gagliardo, M. Hesse, S. K. Bliss, D. Meskill, and J. A. Appleton Coordinated Control of Immunity to Muscle Stage Trichinella spiralis by IL-10, Regulatory T Cells, and TGF-beta J. Immunol., January 15, 2007; 178(2): 1039 - 1047. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. K. NFON, B. L. MAKEPEACE, L. M. NJONGMETA, V. N. TANYA, and A. J. TREES LACK OF RESISTANCE AFTER RE-EXPOSURE OF CATTLE CURED OF ONCHOCERCA OCHENGI INFECTION WITH OXYTETRACYCLINE Am J Trop Med Hyg, January 1, 2007; 76(1): 67 - 72. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Turner, R. S. Langley, K. L. Johnston, G. Egerton, S. Wanji, and M. J. Taylor Wolbachia Endosymbiotic Bacteria of Brugia malayi Mediate Macrophage Tolerance to TLR- and CD40-Specific Stimuli in a MyD88/TLR2-Dependent Manner J. Immunol., July 15, 2006; 177(2): 1240 - 1249. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Wei, I. Kryczek, and W. Zou Regulatory T-cell compartmentalization and trafficking Blood, July 15, 2006; 108(2): 426 - 431. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D. Taylor, A. Harris, M. G. Nair, R. M. Maizels, and J. E. Allen F4/80+ Alternatively Activated Macrophages Control CD4+ T Cell Hyporesponsiveness at Sites Peripheral to Filarial Infection. J. Immunol., June 1, 2006; 176(11): 6918 - 6927. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Taylor, M. Mohrs, and E. J. Pearce Regulatory T Cell Responses Develop in Parallel to Th Responses and Control the Magnitude and Phenotype of the Th Effector Populatio J. Immunol., May 15, 2006; 176(10): 5839 - 5847. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Baumgart, F. Tompkins, J. Leng, and M. Hesse Naturally Occurring CD4+Foxp3+ Regulatory T Cells Are an Essential, IL-10-Independent Part of the Immunoregulatory Network in Schistosoma mansoni Egg-Induced Inflammation J. Immunol., May 1, 2006; 176(9): 5374 - 5387. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Babu, C. P. Blauvelt, V. Kumaraswami, and T. B. Nutman Regulatory networks induced by live parasites impair both Th1 and th2 pathways in patent lymphatic filariasis: implications for parasite persistence. J. Immunol., March 1, 2006; 176(5): 3248 - 3256. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. S. Wilson, M. D. Taylor, A. Balic, C. A.M. Finney, J. R. Lamb, and R. M. Maizels Suppression of allergic airway inflammation by helminth-induced regulatory T cells J. Exp. Med., November 7, 2005; 202(9): 1199 - 1212. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Agostini, E. Cenci, E. Pericolini, G. Nocentini, G. Bistoni, A. Vecchiarelli, and C. Riccardi The Glucocorticoid-Induced Tumor Necrosis Factor Receptor-Related Gene Modulates the Response to Candida albicans Infection Infect. Immun., November 1, 2005; 73(11): 7502 - 7508. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |