The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Taylor, M. D.
Right arrow Articles by Maizels, R. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Taylor, M. D.
Right arrow Articles by Maizels, R. M.
Right arrowPubmed/NCBI databases
*Substance via MeSH
The Journal of Immunology, 2005, 174: 4924-4933.
Copyright © 2005 by The American Association of Immunologists

Removal of Regulatory T Cell Activity Reverses Hyporesponsiveness and Leads to Filarial Parasite Clearance In Vivo1

Matthew D. Taylor, Laetitia LeGoff, Anjanette Harris, Eva Malone2, Judith E. Allen and Rick M. Maizels3

Institute of Immunology and Infection Research, University of Edinburgh, Edinburgh, United Kingdom


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Human filarial parasites cause chronic infection associated with long-term down-regulation of the host’s immune response. We show here that CD4+ T cell regulation is the main determinant of parasite survival. In a laboratory model of infection, using Litomosoides sigmodontis in BALB/c mice, parasites establish for >60 days in the thoracic cavity. During infection, CD4+ T cells at this site express increasing levels of CD25, CTLA-4, and glucocorticoid-induced TNF receptor family-related gene (GITR), and by day 60, up to 70% are CTLA-4+GITRhigh, with a lesser fraction coexpressing CD25. Upon Ag stimulation, CD4+CTLA-4+GITRhigh cells are hyporesponsive for proliferation and cytokine production. To test the hypothesis that regulatory T cell activity maintains hyporesponsiveness and prolongs infection, we treated mice with Abs to CD25 and GITR. Combined Ab treatment was able to overcome an established infection, resulting in a 73% reduction in parasite numbers (p < 0.01). Parasite killing was accompanied by increased Ag-specific immune responses and markedly reduced levels of CTLA-4 expression. The action of the CD25+GITR+ cells was IL-10 independent as in vivo neutralization of IL-10R did not restore the ability of the immune system to kill parasites. These data suggest that regulatory T cells act, in an IL-10-independent manner, to suppress host immunity to filariasis.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Filarial nematodes exert profound down-regulatory effects on the immune systems of their hosts. In seminal work over 20 years ago, the loss of Ag-specific T cell proliferative responses in infected humans was reported (1, 2). Substantial work has since confirmed that immune depression is not confined to a single arm of immunity: production of both Th1 (IFN-{gamma}) and Th2 (IL-5) inflammatory cytokines are suppressed (3, 4), although IL-4 remains intact and IL-10 levels are generally increased (5, 6, 7). Indeed, not only do filariasis patients’ peripheral blood leukocytes express higher levels of constitutive IL-10, but neutralizing Abs against IL-10 and/or TGF-{beta} restore the ability of these cells to mount filarial-specific proliferative responses in vitro (5, 7). These observations, along with description of regulatory T cell (Treg)4 populations that act through IL-10 and TGF-{beta} (8, 9, 10, 11, 12, 13), have led to the hypothesis that filarial infections induce Treg populations that suppress effector T cell responses, and thus promote parasite survival (14, 15).

Tregs were originally demonstrated to govern autoreactivity (8), but similar populations are now known to arise in response to exogenous Ags, including those presented by viral (16, 17, 18) and bacterial (19, 20, 21, 22) pathogens. Moreover, CD4+CD25+ T cells curtail immunity to Leishmania (23, 24) and malaria (25) parasites in mouse models. Although impairing resistance against the pathogen, Tregs may also provide beneficial protection against immunopathology (26, 27, 28, 29). There is also some suggestion that the pathogens themselves can manipulate the regulatory cells to immunosuppress the host and so potentiate their survival (16, 20).

Indications of Treg activity in human helminth infections are provided by the phenotype of T cell clones from onchocerciasis patients, which express regulatory cytokines (IL-10 and TGF-{beta}) and CTLA-4 (30). In addition, CTLA-4 expressed on T cells from lymphatic filariasis patients can suppress IL-5 production, among other responses (31). More recently in Schistosoma mansoni infection, CD4+CD25+ T cells and IL-10 have been shown to inhibit both Th1 development (32) and egg-induced pathology (28). These studies suggest that Tregs are generated during helminth infections, but to date no experimental evidence has been provided to show that Tregs promote parasite survival by mediating the immune down-modulation seen during chronic infection (14, 15).

To address this hypothesis directly, we studied a unique model of filariasis, Litomosoides sigmodontis infection of permissive BALB/c mice (33). L. sigmodontis is a close relative of the Brugia and Wuchereria species, which are responsible for some 120 million cases of human lymphatic filariasis in the world today (34, 35). Intriguingly, resistant mouse strains (e.g., C57BL/6) are dependent on Th2 responses for resistance, yet susceptible mouse strains (e.g., BALB/c) also mount a highly skewed Th2 response (36). The lack of efficacy of the BALB/c Th2 response suggests that immunoregulatory factors, such as Treg populations, hamper its ability to protect against infection. Using L. sigmodontis, we provide the first experimental demonstration that Tregs are indeed responsible for susceptibility to a helminth parasite. Specifically, we demonstrate that infection results in increased expression of Foxp3 and the shutdown of CD4+ T cell immunity, and that intervention against Tregs using Abs against CD25 and glucocorticoid-induced TNF receptor family-related gene (GITR), but not against IL-10R, provides an immunological cure for filarial infection.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Mice and parasites

Female BALB/c mice were used at 6–8 wk of age and were maintained in individually ventilated cages. The L. sigmodontis life cycle was maintained in gerbils using the mite vector Ornithonyssus bacoti. Infective larvae (L3) were recovered from mites 13 days postfeeding by dissection in RPMI 1640 supplemented with 10% FBS (Invitrogen), and mice were infected s.c. on the upper back. Each mouse received a dose of 25 L3, chosen to give sufficient parasite recoveries to allow accurate numeration, but small enough to allow optimal survival and maturation of adult worms (37). Thoracic lavage with 10 ml of cold AIM V medium was used to recover parasites. L. sigmodontis whole worm Ag (LsAg) was prepared by collecting the PBS-soluble fraction of homogenized adult male and female worms.

Cell purifications and in vitro restimulations

The parathymic, posterior mediastinal, and paravertebral lymph nodes (thoracic lymph nodes (tLNs)) draining the thoracic cavity (TC) were dissociated and washed in AIM V medium before being resuspended in RPMI 1640 with 0.5% mouse serum (Caltag-Medsystems), 100 U/ml penicillin, 100 µg/ml streptomycin, and 2 mM L-glutamine. TC cells were isolated from lavage fluid. For CD4+ T cell purifications, TC cells were adhered to plastic for 2 h at 37°C and the nonadherent population was taken. CD4+ T cells were then isolated by CD4 MicroBead magnetic cell sorting (Miltenyi Biotech) per the manufacturer’s instructions, except that HBSS with 0.25% mouse serum was used as the separation medium and 15 µg of rat IgG/1 x 107 cells was used as a block. TC CD4+ T cell purities were 78–90% depending on experiment, but did not vary within experiments. TC CD4+ T cell populations were free of contaminating F4/80+ alternatively activated macrophages. Irradiated (30 Gy) splenic APCs were added to 96-well round-bottom plates at 1 x 106 cells/well, together with 1 x 105 CD4+ T cells/well. Whole tLN cells were used at 5 x 105 cells/well. Cultures were stimulated with medium alone or 10 µg/ml LsAg. Supernatatants were sampled at 72 h for cytokine analysis, and 1 µCi/well of methyl-[3H]thymidine was added for 16 h to measure proliferation. CD4+CD25+ and CD4+CD25 T cell populations were isolated from the TC by negative selection for CD4 cells using anti-CD8 (53-6.72), anti-B220 (RAB632), anti-MHC class II (M5/114.15.2), anti-CD11b (M1/70), anti-Gr1 (RB6-8C5), and anti-F4/80 (A3-1), with anti-rat IgG Dynal Beads (Dynal). CD25 purification was then performed using anti-CD25phycoerythrin in combination with anti-phycoerythrin microbeads (Miltenyi Biotech). The CD4+CD25+ fraction was 75.9% CD4+ with 72.5% CD4+CD25+. The CD4+CD25 fraction was 78.8% CD4+ with 72.4% CD4+CD25. Anti-CD3 (145C2.11) was added to the cultures at 0.125 µg/ml, and 1 x 105 irradiated naive spleen cells were used as APCs.

Abs and reagents

Ab pairs used for cytokine ELISAs were: IL-4 (11B11/BVD6-24G2), IL-5 (TRFK5/TRFK4), IL-10 (JES5–2A5/SXC-1), and IFN-{gamma} (R4-6A2/XMG1.2). Recombinant murine IL-4, IFN-{gamma}, IL-10, and IL-5 (SigmaAldrich) were used as cytokine standards. Detection Abs were biotinylated and used with ExtrAvidin-alkaline phosphatase conjugate and Sigma FastTM p-nitrophenyl phosphate substrate. For flow cytometry, nonspecific binding was blocked with 4 µg of rat IgG/1 x 106 cells, and the following Abs were applied: PE-conjugated anti-CTLA-4 (UC10-4F10-11), APC-conjugated streptavidin, Cy-Chrome-conjugated anti-CD4 (RM4-5), biotinylated anti-CD25 (7D4), anti-GITR (DTA-1), and FITC-conjugated goat F(ab')2 anti-rat IgG (Caltag-Medsystems). All staining was compared against the relevant isotype controls to verify specificity. To measure intracellular CTLA-4, cells were permeabilized and stained with BD PharMingen’s Cytofix/Cytoperm kit. Flow cytometric acquisition and analysis was performed using a FACSCalibur running CellQuest Pro software. ELISA detection was performed using ExtrAvidin-alkaline phosphatase conjugate (Sigma-Aldrich) in conjunction with Sigma FastTM p-nitrophenyl phosphate tablet substrate (Sigma-Aldrich). Reagents were obtained from BD Biosciences or American Type Culture Collection unless otherwise stated.

TGF-{beta} bioassay

TC TGF-{beta} levels were measured in the first milliliter of thoracic lavage fluid using a bioassay as previously described (38). In brief, 1.6 x 105 mink lung epithelial cells, modified to express a luciferase reporter gene under the control of a TGF-{beta}-responsive promoter, were added to 96-well flat-bottom white FluoroNunc plates (Nunc) in 50 µl of RPMI 1640 supplemented with 0.5% mouse serum, 2 mM L-glutamine, 100 U/ml penicillin, and 100 µg/ml streptomycin. The cells were allowed to adhere for 2 h, after which the medium was replaced with sample. The bioassay only measures the active form of TGF-{beta}, thus samples were added directly to the plates to measure endogenously active TGF-{beta}, and to measure total levels of TGF-{beta} the samples were first heat activated for 5 min at 80°C. Recombinant human TGF-{beta}1 (Roche Diagnostics) was used as a standard. The plates were incubated for 16 h at 37°C, 5% CO2, and the Bright-Glo Luciferase Assay System (Promega) was used to quantify luciferase expression on a LUMIstar (BMG Labtech) per the manufacturer’s instructions.

Real-time PCR

CD4+ T cells were purified from the tLN, brachial LN, and TC of individual L. sigmodontis-infected mice and from pooled (five per group) naive mice. Purified CD4+ T cells were resuspended in TRIzol (Invitrogen) and RNA extraction was performed per the manufacturer’s instructions. After treatment with DNase1 (Ambion), cDNA was synthesized using Moloney murine leukemia virus reverse transcriptase (Stratagene). Quantification of Foxp3 mRNA was performed by real-time PCR using the LightCycler (Roche Diagnostics). The Foxp3 forward and reverse primers were CCTGGCCTGCCACCTGGGATCAA (exon 3/4 junction) and TTCTCACAACCAGGCCACTTG (exon 5), respectively. PCR amplifications were performed in 10 µl, containing 1 µl of cDNA, 0.3 mM primers and 5 µl of Qiagen hotstart Sybergreen using the following conditions: 15-min hotstart at 95°C, 15-s denaturation at 95°C, 20-s annealing of primers at 54°C, and 15-s elongation at 72°C, for 40–60 cycles. The fluorescent DNA binding dye was monitored after each cycle at 82°C. Foxp3 expression was normalized against {beta}-actin; forward and reverse primer sequences were TGGAATCCTGTGGCATCCATGAA and TAAAACGCAGCTCAGTAACAGTC, respectively. {beta}-Actin PCR was performed as above, except that LightCycler-DNA SYBR green I mix (Roche Molecular Biochemicals) was used without hotstart, and the DNA binding dye was monitored at 86°C. Eight serial dilutions of cDNA pooled from each sample were used to create a standard curve (in arbitrary units) against which {beta}-actin and Foxp3 mRNA expression were normalized. Foxp3 mRNA levels were then expressed as a ratio to {beta}-actin mRNA expression. Two cDNA templates were produced from each sample, and PCR was performed twice from each cDNA template. Results are displayed as one representative run from each experiment.

In vivo Ab treatment

In vivo treatments used anti-GITR (DTA-1), anti-mouse CD25 (PC61), or anti-mouse IL-10R (1B1.3a). Mice received 1 mg of anti-CD25 in PBS on day 27 of infection or 1 mg of anti-GITR on days 27 and 34 for single treatments. For combined anti-CD25/GITR treatment, mice received 1 mg of each Ab on day 27. Mice received 1 mg of anti-IL-10R on day 27, followed by three doses of 0.5 mg (1 mg in second experiment) every 3 days. An equivalent dose of rat IgG was used as a control.

Statistics

Statistical analysis was performed using Minitab version 14. When combining experimental data using ANOVA, it was first demonstrated that there were no significant interactions due to experimental differences.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
L. sigmodontis infection in mice recapitulates the loss of T cell proliferative responses in human filariasis

To investigate whether the immune regulation, evident in human filariasis, would be reproduced within a mouse model, susceptible BALB/c mice were infected with L. sigmondontis L3 larvae and their parasite-specific immune responses were followed for a 60-day period. Fig. 1A represents the course of L. sigmodontis development within this time period, in which parasites migrate through the lymphatic system to the TC. After ~55 days, infection reaches patency, defined as the release of newborn microfilarial parasites into the bloodstream (39). To assay local immune responses to infection, we isolated the parathymic, posterior mediastinal, and paravertebral lymph nodes (tLNs) that drain the TC and challenged them in vitro with soluble adult whole worm homogenate (LsAg).



View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 1. Time course of cellular immune responses to L. sigmodontis infection in susceptible BALB/c mice. A, Timeline showing the development of L. sigmodontis in BALB/c mice. Approximate times of molts between larval stages are indicated. BF, Ag-specific immune responses. Thoracic lymph node cells were sampled on days 10 (triangles), 20 (inverted triangles), 40 (squares), and 60 (circles) postinfection and from naive mice (day 0, diamonds) and were restimulated with LsAg (filled symbols) or medium alone (open symbols). Bars represent mean values. Lymph nodes from naive animals were pooled (day 0) within experiments, with each symbol representing one experiment; at all other time points symbols represent individual mice. Data for day 10 are representative of three experiments; for each of days 20–60 data are combined from two experiments. *, p < 0.05 (Mann-Whitney). B, Ag-specific proliferation. C, IL-4 release in culture supernatants. D, IL-5 release in culture supernatants. E, IFN-{gamma} release in culture supernatants. F, IL-10 release in culture supernatants. G, Total levels of TGF-{beta} were measured, by bioassay reactive to all isoforms, in the thoracic lavage fluid of mice infected with L. sigmodontis or of naive controls. Each point represents one mouse, and results represent at least two experiments for each time point. Bars represent mean values.

 
Ag-specific proliferative responses were mounted by tLN cells from day 10 onward (Fig. 1B), reaching a peak 40 days postinfection, when the worms were adults but still immature. By day 60, once infection was fully patent, Ag-specific proliferative responses were significantly impaired (mean reduction 68%) compared with those 40 days postinfection, despite the continued survival of an equivalent number of adult parasites. The filarial-specific hyporesponsiveness observed during chronic human infection, therefore, appears to be paralleled by the loss of proliferative reactivity to Ag during murine infection with L. sigmodontis.

The type 2 cytokines IL-4 and IL-5 were produced by tLN cells in response to parasite Ag from an early point in infection (Fig. 1, C and D), whereas IFN-{gamma} was released later and at relatively low levels (<50 U/ml) in a largely Ag-nonspecific manner (Fig. 1E). This profile of a Th2-dominated response to filarial nematode infection is consistent with previous reports of L. sigmodontis infection in BALB/c mice (40).

The two cytokines most strongly implicated in down-regulation of immune responses are IL-10 and TGF-{beta} (9, 11). Thoracic lymph node cells showed Ag-specific IL-10 production from day 10, rising to a peak on day 40 (Fig. 1F). A 3- to 6-fold elevation of TGF-{beta} was detectable in the thoracic lavage fluid of infected mice from day 13 postinfection, remaining elevated throughout (Fig. 1G). The majority of the TGF-{beta} was in the latent form. Ag-specific production of TGF-{beta} by tLN cells was not evident (data not shown). Thus, both Th2 and regulatory cytokines contribute to the early immune response and remain at significant levels throughout infection.

T cell responses are down-regulated at the site of infection

The localized nature of L. sigmodontis adult infection in the TC offered the opportunity to study T cell responses within the population in direct contact with the parasites. Therefore, we purified TC CD4+ T cells, 40 and 60 days postinfection, with a mean recovery of 3.4 x 105 CD4+ T cells per mouse. Infections were phased so that T cell assays coincided, and there were no significant differences between day 40 and day 60 worm recoveries (data not shown). CD4+ T cells were restimulated in vitro with LsAg and Con A using irradiated spleen cells from naive mice as a source of APCs. As with tLN populations, patent infection was associated with a loss of Ag responsiveness by TC CD4+ T cells, with those recovered 60 days postinfection showing lower proliferation to both LsAg (Fig. 2A) and Con A (data not shown) than those taken at day 40. Moreover, by day 60, there was a substantial decrease in Ag-specific IL-4, IL-5, and IL-10 production (Fig. 2, BD).



View larger version (17K):
[in this window]
[in a new window]
 
FIGURE 2. Decline of parasite-specific CD4+ T cell responses at site of infection. CD4+ T cells were purified from the TC 40 and 60 days postinfection and were cultured in vitro with medium alone (open bars) or LsAg (filled bars) with irradiated naive spleen cells. To directly compare Ag responsiveness, infections were phased to coincide at day 40 and 60 time points. Due to numbers of TC CD4+ T cells, cells were pooled from at least 10 mice. Results are representative of two experiments. A, Proliferation (error bars represent the SD of triplicate cultures). B, IL-4 release. C, IL-5 release. D, IL-10 release.

 
Filarial infection up-regulates the expression of regulatory/activation markers

To study whether CD4+ regulatory T cells are induced by filarial infection, we tested the expression of a set of markers (CD25, CTLA-4, and GITR), which in naive mice are constitutively expressed by Tregs. These markers are also found on recently activated CD4+ T cells, but their up-regulation in chronic infection would be indicative of Treg activity warranting further functional testing. Therefore, we isolated cells from the TC, lymph nodes, and spleens of mice infected with L. sigmodontis and analyzed the expression of CD25, GITR, and intracellular CTLA-4 among the CD4+ subset.

The phenotype of CD4+ T cells from the TC was analyzed from day 13 onward, after the arrival of parasites in this compartment. Profiles changed little at early time points, other than significantly raised CTLA-4 at day 13 and CD25 at day 20 (data not shown). As infection progressed, however, the percentage of TC CD4+ T cells expressing CTLA-4 and high levels of GITR (GITRhigh) increased dramatically until the dominant phenotype became CTLA-4+GITRhigh, with 60–70% of the CD4+ T cells double positive for these markers by day 60 (Fig. 3A). A minority of cells coexpressing CTLA-4 and GITRhigh were CD25+, and these displayed significantly higher levels of CTLA-4 than did the CD4+CD25 cells (medians of 50.5 and 11.3, respectively; p < 0.05, Mann-Whitney), and also of GITR (medians of 114.5 and 34.1, respectively; p < 0.05, Mann-Whitney) (Fig. 3B). Data from individual mice (Fig. 3C) emphasize the consistent up-regulation of these markers by TC CD4+ T cells from day 40 onward. Thus, the hyporesponsive phenotype of the TC CD4+ T cell population was associated with their increased expression of markers associated with T cell regulation.



View larger version (39K):
[in this window]
[in a new window]
 
FIGURE 3. Treg-associated marker expression by CD4+ T cells from infected mice. A, Expression of CD25, GITR, and intracellular CTLA-4 by TC CD4+ T cells during L. sigmodontis infection. Data are from individual mice and are representative of two experiments. The naive, day 40 and day 60 samples shown, were analyzed on the same day. The percentage of double-positive cells is indicated for each plot. B, Expression levels of GITR and intracellular CTLA-4 by TC CD4+CD25 (open histograms) and CD4+CD25+ cells (filled histograms) from naive and 60-day-infected BALB/c mice. Data are from individual mice, representative of five experiments. C, Percentages of TC CD4+ T cells expressing CD25, GITRhigh, and intracellular CTLA-4 in naive and 40- or 60-day-infected mice. Bars represent mean values. The figures shown are representative of five experiments. **, p < 0.01 between experimental groups (Kruskall-Wallis).

 
During the later stages of infection, CTLA-4 and GITRhigh expression by CD4+ T cells also rose at distal sites. In the tLN, CTLA-4 expression was significantly higher than in naive controls (mean increase, 43% of CD4+ T cells at day 40 and 30% at day 60; n = 5 and p < 0.05 in each case, Mann-Whitney). GITRhigh expression also significantly increased at day 60 (36% above naive controls; n = 5 and p < 0.05). Similar changes were detected in splenic CD4+ T cell populations at day 60 of infection (increases of 17% for CTLA-4, 33% for GITRhigh; n = 5 and p < 0.05 in each case, Mann-Whitney). Interestingly, CD25 expression did not rise in the lymph nodes or spleen at any time point. Thus, at the time of most profound down-modulation of responsiveness, the dominant phenotype in the TC (CD25GITRhighCTLA-4+) became more frequent in sites peripheral to the locus of infection.

Filarial infection induces early expression of Foxp3

Expression of the Foxp3 gene has been shown to be critical for the development of particular populations of Tregs. These include natural CD4+CD25+ Tregs (41, 42, 43), with increasing evidence for a role in adaptive Treg populations (44, 45), although not all Treg populations express Foxp3 (46). To determine whether filarial infection expands or induces Foxp3-dependent Treg activity, the expression of Foxp3 mRNA by CD4+ T cells from the TC and draining lymph nodes of infected mice was measured. Expression was measured in whole purified CD4+ T cell populations, as CD25, CTLA-4, and GITR mark both Tregs and activated effector T cells, and even in the naive mouse, regulatory Foxp3-expressing T cells can be found in the CD25 fraction (13).

The expression of Foxp3 was found to be increased in CD4+ T cells isolated from the lymph nodes draining the initial s.c. infection site 12 days postinfection (Fig. 4A). At days 28 and 60 postinfection, the ratio of Foxp3 to {beta}-actin in the tLN CD4+ T cell population was equivalent to that of the naive controls (Fig. 4, B and C). However, at these times, the total number of CD4+ T cells in the tLN had increased substantially (Fig. 4D), indicating that there is expansion of both Foxp3+ and Foxp3 populations maintaining the Foxp3:{beta}-actin ratio at a steady state. Thus, the initial prominent increase in Foxp3 activity is balanced by expansion of effector cells (Foxp3), and once equilibrium is regained, both cell populations maintain homeostasis.



View larger version (14K):
[in this window]
[in a new window]
 
FIGURE 4. Filarial infection induces an early increase in Foxp3 mRNA expression. CD4+ T cells were purified from the brachial lymph node of naive (open symbols) and infected mice (closed symbols) 12 days postinfection (A) and from the tLN on days 28 (B) and 60 (C) postinfection. On day 28, CD4+CD25+ ({blacksquare}) and CD4+CD25 ({square}) cells isolated from naive spleens were included as positive and negative controls, respectively. The relative expression of Foxp3 mRNA was assessed as a ratio to {beta}-actin mRNA using quantitative PCR. Bars represent median values. Results are representative of two independent experiments. *, p < 0.02 (Mann-Whitney). D, Total number of CD4+ T cells within the tLN of naive (open symbols) and infected (closed symbols) mice. *, p < 0.01 between infected group and respective naive controls.

 
Unlike the tLN CD4+ T cell population, CD4+ T cells from the site of infection did not show any increases in the Foxp3:{beta}-actin ratio, when tested at days 12, 28, and 60 (data not shown). Expansion of the TC CD4+ T cell population does also occur (47), thus there appears to be proportional expansion of both Foxp3+ and Foxp3 cells. Notably, the dominance of hyporesponsive CD4+CTLA-4+GITR+ T cells at 60 days postinfection was not matched by an increase in the Foxp3:{beta}-actin ratio, as would be expected if these cells represented a Treg population. Therefore, the CD4+CD25CTLA-4+GITR+ T cells at the site of infection are likely to represent a down-modulated effector cell population.

Neutralizing Tregs results in increased parasite clearance

The hyporesponsive phenotype of the CD4+ T cell population, and the increases seen first in Foxp3 expression and subsequently in Treg-associated surface markers, indicate that infection stimulates Treg activity. To directly test whether Tregs are acting to suppress the host’s effector responses and so promote parasite survival, Abs against CD25 and GITR were used in vivo to intervene against regulatory control during an established infection. The anti-CD25 mAb PC61 has been shown to deplete Tregs expressing CD25, and in our hands the circulating CD4+CD25+ population was effectively removed for at least 7 days after treatment of naive mice (data not shown). The anti-GITR Ab is an agonistic Ab and has been shown to ablate regulatory activity of CD4+CD25+ T cells (13), to act as a costimulator toward activated CD4+ effector T cells (48, 49, 50, 51), and to render them resistant to suppression by Tregs (52).

Ab treatments were given 27 days postinfection (the time of final molt to adult worms) to allow sufficient time for the parasite to establish its regulatory mechanisms within the host. Autopsies were performed before (day 40) and after (day 60) development of patent microfilaremia. Treatments with anti-CD25 or anti-GITR alone had no effect on worm burdens when assessed 40 or 60 days postinfection. Combining the two treatments, however, did result in a significant reduction in mean worm load of 73% compared with the IgG-treated control mice when quantified 60 days postinfection (Fig. 5).



View larger version (18K):
[in this window]
[in a new window]
 
FIGURE 5. In vivo anti-CD25 and anti-GITR treatment of an established infection results in increased killing of parasites. Sixty-day worm burdens of infected mice treated with rat IgG, anti-CD25 alone, anti-GITR alone, or combined treatment with anti-CD25 and anti-GITR. Closed and open symbols represent results from two experiments. Bars represent mean values. **, Significant difference between the IgG group and the anti-CD25/GITR cotreated group. In experiment 1 (filled symbols), p < 0.01 (Mann-Whitney); in experiment 2 (open symbols), p < 0.02.

 
The hypothesis that the anti-CD25/GITR treatment regime had broken a regulatory network was given credence by analysis of cell surface profiles and cytokine responses 60 days postinfection. At the site of infection, anti-CD25/GITR cotreatment resulted in a substantial depletion of CD4+CD25+ T cells (Fig. 6A). Notably, whereas expression of the costimulatory molecule GITR was only marginally affected (Fig. 6B), a marked decrease in the expression of the coinhibitory molecule CTLA-4 on CD4+ T cells was observed (Fig. 6C). This demonstrated the long-term effect of Ab treatment on the CD4+ T cell population. Although CD25 is also expressed by B cells, CD8+ T cells, F4-80+ macrophages, and dendritic cells during L. sigmodontis infection (our unpublished observations), B cells and CD8+ T cells are unlikely to be responsible for regulation, as their depletion or absence does not reverse susceptibility (53, 54). We have also shown that dendritic cells isolated from the tLN of infected mice do not show suppressive activity in vitro (our unpublished observations). Infection does recruit suppressive F4/80+ macrophages; however, this population was unaltered as a result of anti-CD25/GITR treatment (our unpublished observations). Thus, non-CD4+ T cells do not appear to play a dominant regulatory role during L. sigmodontis infection.



View larger version (11K):
[in this window]
[in a new window]
 
FIGURE 6. Anti-CD25 and anti-GITR treatment decreases expression of regulatory markers on CD4+ T cells. CD25 (A), GITRhigh (B), and CTLA-4 (C) expression in TC CD4+ T cells from naive mice and L. sigmodontis-infected IgG-treated or anti-CD25/GITR cotreated mice 60 days postinfection. Bars represent mean values. Figure shows one representative experiment. *, p < 0.05 between the IgG and anti-CD25/GITR cotreated groups. Analysis was performed using data from two experiments using a general linear model of ANOVA.

 
Alongside the decrease in regulatory markers, we observed significantly increased in vitro Ag-specific responses by tLN cells isolated from anti-CD25/GITR cotreated mice, including higher levels of Ag-specific cytokines (Fig. 7) and proliferation (data not shown). Of particular interest was the increase in IL-5 production (Fig. 7B), as IL-5 is characteristically suppressed during chronic human filariasis (3, 4) and plays an important role in immunity toward L. sigmodontis (55, 56). Killing of L. sigmodontis by IL-5 has been linked to the encapsulation of worms by immune cells (54, 55), and encapsulated worms were present in the cotreated group (data not shown). The number of encapsulated worms was low, however, suggesting that the majority of worms had already been cleared by the immune system. Also of note was the increase in IL-10 production after neutralization of Tregs (Fig. 6C), implying that IL-10 is not the dominant suppressive mechanism. Costimulation of CD4+ T cells by anti-GITR Ab has been noted to increase IL-10 expression elsewhere (50), and during L. sigmodontis infection it may be representative of an enhanced Th2 response rather than regulation. These experiments represent the first "immunological cure" of a filarial infection in which Abs to immune cell surface markers can reverse unresponsiveness and provoke parasite killing.



View larger version (9K):
[in this window]
[in a new window]
 
FIGURE 7. Anti-CD25 and anti-GITR treatment enhances immune responsiveness. IL-4 (A), IL-5 (B), and IL-10 (C) production by tLN cells from IgG control mice (squares) and anti-GITR/anti-CD25 cotreated mice (circles) restimulated with medium alone (open symbols) or LsAg (filled symbols). Bars represent mean values. Figures show one representative experiment. *, p < 0.05. Analysis was performed using data from two experiments using a general linear model of ANOVA.

 
CD4+CD25+ T cells from the site of infection show poor responsiveness to Ag in vitro but do not suppress the proliferation of Th2 effector cells

Given the efficacy of anti-CD25/GITR cotreatment from 27 days postinfection, CD4+CD25+ T cells were purified from the site of infection during this time period to test their ability to inhibit the L. sigmodontis-specific response of CD4+CD25 T cells. Fig. 8 demonstrates that TC CD4+CD25 cells showed stronger proliferative responses toward both LsAg and anti-CD3 stimulation than did CD4+CD25+ T cells. Production of the effector cytokine IL-5 showed a similar pattern to that of proliferation (data not shown). When mixed at a 1:1 ratio, the CD4+CD25+ cells did not inhibit proliferation of the CD4+CD25 cells (Fig. 8). In the same assay, and under the same conditions, naive CD4+CD25+ cells were able to inhibit the responses of naive CD4+CD25 cells to anti-CD3 stimulation (data not shown). Th2 cells are known to be more resistant to in vitro suppression by CD4+CD25+ Tregs (57), as they can expand in the absence of IL-2 through responsiveness to Th2 growth factors such as IL-4, IL-7, and IL-9 (57, 58). Thus, although the majority of TC proliferating cells are of the CD4+CD25 phenotype, their proliferation is not suppressed by the CD4+CD25+ fraction, either because the CD4+CD25 cells are not IL-2 dependent or because the CD4+CD25+ cells do not exert classical in vitro Treg suppressive ability at this stage of the infection.



View larger version (9K):
[in this window]
[in a new window]
 
FIGURE 8. In vitro responses of TC CD4+CD25+ and CD4+CD25 T cells. CD4+CD25+ and CD4+CD25 T cells were purified from the TC of infected mice 28 days postinfection. They were restimulated in vitro with LsAg (A) and anti-CD3 (B) as separate populations or mixed in a 1:1 ratio using the indicated cell numbers, and their proliferative responses were measured. Error bars represent SD of triplicate cultures. Results are representative of two independent experiments.

 
IL-10 controls parasite-specific Th1 responses but does not play a primary role in filarial survival

Increased production of IL-10 occurs in chronic human filarial infections and has been associated with filarial immunosuppression (5, 7). IL-10 is therefore a potential mediator of CD25+GITR+ cell activity; however, IL-10 production declined as immunosuppression became established (Figs. 1F and 2D) and rose after negation of Treg activity (Fig. 7C). To determine whether IL-10 played a role in the observed T cell hyporesponsiveness, CD4+ T cells were isolated from the TC 60 days postinfection and were restimulated with LsAg in the presence of a neutralizing anti-IL-10R Ab. The doses of anti-IL-10R chosen, 0.1 and 0.01 µg/ml, were based on those that gave maximal increases in IFN-{gamma} production during in vitro culture of tLN cells from 60-day infected mice (data not shown). Fig. 9A demonstrates that neutralizing the IL-10R did not restore the proliferative capability of the TC CD4+ T cells, although it did increase their production of IFN-{gamma} (Fig. 9B). Therefore, IL-10 does not appear to mediate the hyporesponsive phenotype of the TC CD4+ T cell population.



View larger version (18K):
[in this window]
[in a new window]
 
FIGURE 9. IL-10 does not play a major role in filarial survival. A, CD4+ T cells were isolated from the TC of L. sigmodontis-infected mice 60 days postinfection, and their proliferative responses were measured after in vitro restimulation with medium alone (open bars) and LsAg (filled bars) in the presence of varying doses of anti-IL-10R. B, CD4+ T cells were isolated from the TC of L. sigmodontis-infected mice 60 days postinfection, and their production of IFN-{gamma} was measured after in vitro restimulation with medium alone (open bars) and LsAg (filled bars) in the presence of varying doses of anti-IL-10R. C, Worm recovery from L. sigmodontis-infected mice given 1 mg of anti-IL-10R (filled symbols) or rat IgG (open symbols) on days 27, 30, 33, and 36. In two independent experiments, worm burdens were assessed on day 40 (squares) or day 60 (circles). Bars represent mean values. Groups are not significantly different. D, Production of IFN-{gamma} by tLN cells isolated from anti-IL-10R or IgG treated mice 40 days (squares) or 60 days (circles) postinfection and restimulated in vitro with medium (open symbols) or LsAg (filled symbols). Bars represent mean values. *, p < 0.05 (Mann-Whitney).

 
To test the role of IL-10 in the long-term survival of L. sigmodontis in vivo, mice were treated with four doses of anti-IL-10R Ab from the time of the final molt into adult worms (between days 27 and 36 postinfection). In two independent experiments, mice were autopsied on day 40 or 60. Neutralizing the IL-10R failed to alter worm burdens when assessed at either time point (Fig. 9C). Treatment did, however, significantly increase both background and Ag-specific IFN-{gamma} production (Fig. 9D) without rescuing production of IL-4, IL-10, or IL-5 (data not shown). Thus, we conclude that IL-10 does not play a major role in controlling parasite recoveries.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Human filarial parasites can survive for decades within normally immunocompetent hosts, with long-term survival being linked to suppression of the host protective immune response. Evidence for Treg activity in human helminth infections has been provided by T cell clones from onchocerciasis patients with a regulatory profile (30, 59) and the finding from lymphatic filariasis patients that CTLA-4+ expressed on T cells suppresses IL-5 production (31). In mouse models, CD4+CD25+ T cells are active during S. mansoni infection, influencing Th subset development and the evolution of pathology (28, 32). These studies indicate that Tregs are generated during helminth infections and have led to the hypothesis that their activity down-modulates immune responsiveness during chronic infection, promoting parasite survival (14, 15, 60).

We now present the first experimental evidence that Tregs permit the establishment of a helminth infection. The initial infection of BALB/c mice by L. sigmodontis larvae resulted in an increase in expression of Foxp3, a gene critically associated with the development of Tregs (41, 42, 43), indicating that infection induces an early expansion of Treg activity. Once infection had become fully patent (defined as fully developed adult worms and blood microfilaremia), BALB/c mice showed a loss of parasite-specific immune responses, concordant with the filarial-induced suppression seen in humans. Functional hyporesponsiveness was associated with significant increases in expression of the Treg-associated markers CD25, CTLA-4, and GITR, which was most marked in the TC population in contact with parasites. Two subsets could be differentiated by CD25 expression once infection had reached patency. The majority of TC CD4+ T cells coexpressed CTLA-4 and GITR but were CD25 negative. In contrast, the CD25+ population had the highest levels of CTLA-4 and GITR.

To experimentally test the hypothesis that Tregs are responsible for filarial-induced suppression and worm survival, we treated infected BALB/c mice with anti-CD25 and anti-GITR. We demonstrated that if depletion of CD25+ cells is combined with the use of an agonistic anti-GITR Ab, BALB/c mice with established infections are induced to kill their adult worms. Thus, we can conclude that a population of CD25+ Tregs dampens protective immunity to filarial parasites and that ligation of GITR is also necessary for protection to be effective.

The requirement for cotreatment with anti-GITR and CD25 suggests that neither treatment alone is sufficient to fully neutralize regulation. A similar requirement for combined treatments has been observed during infection with murine leukemia virus (61), and combined anti-CD25 and anti-CTLA-4 treatments are more effective at breaking self-tolerance than either Ab alone (62). One explanation is that both Abs act synergistically on a single regulatory population. Alternatively, as anti-GITR treatment can act as a costimulatory molecule for effector T cells (49, 50, 51) and can make effector cells more resistant to suppression by Tregs (52), a second possibility is that the anti-GITR Ab is acting on a nonregulatory effector T cell. In agreement with this, during the adult stage of infection, the expression of Foxp3 mRNA in the TC did not correlate with that of GITR or CTLA-4. This suggests that the majority of CD4+GITRhighCTLA-4+ T cells are effector cells and that their hyporesponsive phenotype seen at patency is not due to increased Foxp3-dependent Treg activity. The CD4+CD25GITRhighCTLA-4+ cells therefore might represent an effector cell population that has been "conditioned" toward a down-modulated or hyporesponsive phenotype over the course of infection, and GITR ligation may be delivering an activation, or anti-regulatory, signal to effector T cells (48, 49, 50, 51, 63). Thus, the success of combined Ab treatment may be due to two separate actions on distinct target populations: the anti-CD25 Ab, which depletes the Treg population, and anti-GITR, which reactivates down-modulated anti-parasite effector cells, allowing them to reach their potential in eradicating infection.

In opposition to the costimulatory effects of GITR, signals through CTLA-4 are well documented to inhibit T cell responses (64). Expression of CTLA-4 is required for the hyporesponsive phenotype of CD4+ T cells induced by oral tolerance (65) and plays a critical role in limiting Th2 responses (66). In relation to Th2-inducing parasites, CTLA-4 blockade during Nippostrongylus brasiliensis infection resulted in enhanced parasite-specific immunity, stronger Th2 cytokine production, and diminished parasite numbers (67). CTLA-4 expressed on CD4+CD25 T cells during infection therefore might mediate their hyporesponsive phenotype, and its up-regulation may be a mechanism by which effector T cell response is turned off. Thus, during patent L. sigmodontis infection, the responsiveness of the CD4+CD25 T cell population may reflect a balance between inhibitory signals through CTLA-4 and costimulatory signals through GITR. Interestingly, anti-CD25/GITR treatment caused a greater reduction in CTLA-4 expression than GITR expression, potentially rendering the CD4+CD25 population more responsive to costimulatory than inhibitory signals.

The killing of adult L. sigmodontis worms induced by combined anti-CD25/GITR treatment was associated with a general enhancement of parasite-specific immunity. Of particular note was the increase in IL-5, a key cytokine in the development of immunity to L. sigmodontis larval stages, both in vaccination models and in primary infections (54, 55, 56, 68). IL-5 is also strongly involved in the lethal response to adult L. sigmodontis worms after the establishment of patent infections (55, 68). The increased production of IL-5 is therefore a likely candidate for orchestrating the clearance of adult worms after Ab treatments. In relation to the human infection, IL-5 is one of the cytokines characteristically suppressed in individuals with chronic filarial infection (3, 4), and thus it is likely that the down-regulation of IL-5 during infection is an important dictate of parasite survival.

Although IL-10 is implicated in mediating proliferative suppression in filariasis patient-derived T cells in vitro (69), our data do not demonstrate a regulatory role on the Th2 response. After an early peak, IL-10 production declined during L. sigmondontis infection and was actually increased upon successful treatment of infection; moreover, Ab-mediated neutralization of IL-10R in vitro did not restore T cell responsiveness and in vivo failed to restore protective immunity or to change the intensity of the Th2 response. In resistant mouse strains, IL-10 deficiency alone failed to influence resistance or susceptibility, although a regulatory role for IL-10 did come to light in the absence of IL-4, indicating a role in regulating non-Th2 components (70). IL-10, therefore, might still play a role in regulating L. sigmodontis infection, possibly acting in conjunction with other cytokines such as TGF-{beta} (71), but our study demonstrates that it is not the key or sole mechanism for CD4+CD25+ Treg action.

This outcome contrasts with the prominent role of Treg-derived IL-10 in infection models where Th1 immune responses are protective (72). A prime example is Leishmania major infection, in which IL-10 is the pivotal down-regulatory mediator produced by CD4+CD25+ T cells and acts to inhibit the protective Th1 response (23, 73). It is important to note, however, that IL-10 generally exerts a more profound suppression of Th1 than Th2 responses (32). In infections with Th2-inducing helminth parasites, IL-10 is in fact required to promote Th2 responses, such that IL-10–/– mice fail to mount protective Th2 responses toward Trichuris muris and develop chronic infections (74). In the immune response to S. mansoni infection, which contains both Th1 and Th2 components, IL-10 production by CD4+CD25+ Tregs is linked to the inhibition of Th1 immunity and subsequent augmentation of Th2 (28, 32). Similarly, differential effects of IL-10 on Th1 and Th2 responses have been noted during infection with Trichinella spiralis, where IL-10 deficiency has been found to inhibit Th2-mediated killing of the adult worms, while simultaneously promoting the Th1-mediated killing of muscle larvae (75). We conclude that although IL-10 does dampen Th1 immunity during L. sigmodontis infection, it does not play a key role in promoting parasite survival in the largely Th2-dependent context of immunity to L. sigmodontis.

A fascinating issue for future study is how nematodes induce Treg activity. One possibility is that long-lived parasites actively induce Tregs, for example by signaling through particular TLRs to induce the production of regulatory cytokines (76) or by secretion of TGF-{beta} homologues (38). If the parasites themselves are driving Treg activity, then a central question will be the lineage of the activated Treg population: do parasites recruit pre-existing "natural" Tregs or do they induce development of Treg from Th0 precursors? Tregs responding to L. major and certain viral infections do appear to be recruited from the pre-existing populations (17, 23), whereas Bordetella pertussis infection induces naive Th0 precursor cells to become Tr1 cells (20). The expression of Foxp3 mRNA, a marker for natural Tregs, was increased during the early stages of L. sigmodontis infection, suggesting that a natural pre-existing Treg population is expanded in the presence of the parasite. However, Foxp3+ regulatory T cells can develop from naive precursors under the influence of TGF-{beta} (44, 45), and as L. sigmodontis provoked TGF-{beta} production throughout infection, it is also possible that a new population of Tregs was actively induced by this route.

If the Tregs involved are of "natural" origins, a second question of equal importance is whether the Treg populations are specific for parasite Ags or if they act in a nonspecific manner to prevent overly exuberant immune responses. Helminth-induced Tregs are capable of Ag-nonspecific suppression, as CD4+CD25+ T cells isolated from mice infected with Heligmosoides polygyrus are able to inhibit inflammation in a murine model of allergy.5 Equally, the presence of a patent L. sigmodontis infection down-modulates inflammation invoked during allergic airway infiltration (M. S. Wilson, M. D. Taylor, and R. M. Maizels, unpublished observations), demonstrating that whether or not Tregs are parasite-specific, they can act in an Ag-nonspecific manner. Definition of their Ag specificity will be important to allow therapeutic interventions to be targeted solely against the Tregs involved in infection, rather than indiscriminately against whole Treg populations, where treatment could also potentially disrupt self-tolerance.

In conclusion, we offer a wider perspective for the role of Tregs in chronic helminth infections, which afflict >1 billion people worldwide. Although it is not surprising that the response to infection should engender a regulatory component, our data argue that Tregs are essential to continued parasite survival. These findings provide a conceptual framework to understand helminth parasitism, in which host regulatory pathways are recruited or exploited by the pathogens to aid their own survival. This understanding, in turn, will suggest therapeutic pathways to boost host immunity (either naturally or in the context of vaccination) to ensure that effector mechanisms gain precedence over the inappropriately invoked down-regulation.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Acknowledgments
 
We are very grateful to John Tweedie and the biological support staff, Marisa Magennis for care of the life cycle, Mark Wilson for discussion and assistance with experiments, Andrea Graham for help with statistical analysis, and Adam Balic for discussion. The DTA-1 cell line was kindly provided by Shimon Sakaguchi.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by the Medical Research Council (G9901118), the European Commission (ICA4-CT-1999-10002), and the Wellcome Trust (059423). Back

2 Current address: School of Life Sciences, Napier University, 10 Colinton Road, Edinburgh EH10 5DT, U.K. Back

3 Address correspondence and reprint requests to Dr. Rick M. Maizels, Institute of Immunology and Infection Research, Ashworth Laboratories, West Mains Road, University of Edinburgh, Edinburgh EH9 3JT, U.K. E-mail address: rick.maizels{at}ed.ac.uk Back

4 Abbreviations used in this paper: Treg, regulatory T cell; GITR, glucocorticoid-induced TNF receptor family-related gene; LsAg, L. sigmodontis whole worm Ag; tLN, thoracic lymph node; TC, thoracic cavity. Back

5 M. S. Wilson, M. D. Taylor, A. Balic, C. A. M. Finney, J. R. Lamb, and R. M. Maizels. Suppression of allergic airway inflammation by helminth-induced regulatory T cells. Submitted for publication. Back

Received for publication August 17, 2004. Accepted for publication January 20, 2005.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Ottesen, E. A., P. F. Weller, L. Heck. 1977. Specific cellular immune unresponsiveness in human filariasis. Immunology 33:413.[Medline]
  2. Piessens, W. F., P. B. McGreevy, P. W. Piessens, M. McGreevy, I. Koiman, J. S. Saroso, D. T. Dennis. 1980. Immune responses in human infections with Brugia malayi: specific cellular unresponsiveness to filarial antigens. J. Clin. Invest. 65:172.
  3. Steel, C., T. B. Nutman. 1993. Regulation of IL-5 in onchocerciasis: a critical role for IL-2. J. Immunol. 150:5511.[Abstract]
  4. Sartono, E., Y. C. M. Kruize, A. Kurniawan-Atmadja, R. M. Maizels, M. Yazdanbakhsh. 1997. Depression of antigen-specific interleukin-5 and interferon-{gamma} responses in human lymphatic filariasis as a function of clinical status and age. J. Infect. Dis. 175:1276.[Medline]
  5. King, C. L., S. Mahanty, V. Kumaraswami, J. S. Abrams, J. Regunathan, K. Jayaraman, E. A. Ottesen, T. B. Nutman. 1993. Cytokine control of parasite-specific anergy in human lymphatic filariasis: preferential induction of a regulatory T helper type 2 lymphocyte subset. J. Clin. Invest. 92:1667.
  6. Yazdanbakhsh, M., W. A. Paxton, Y. C. M. Kruize, E. Sartono, A. Kurniawan, A. van het Wout, M. E. Selkirk, F. Partono, R. M. Maizels. 1993. T cell responsiveness correlates differentially with antibody isotype levels in clinical and asymptomatic filariasis. J. Infect. Dis. 167:925.[Medline]
  7. Cooper, P. J., T. Mancero, M. Espinel, C. Sandoval, R. Lovato, R. H. Guderian, T. B. Nutman. 2001. Early human infection with Onchocerca volvulus is associated with an enhanced parasite-specific cellular immune response. J. Infect. Dis. 183:1662.[Medline]
  8. Sakaguchi, S.. 2000. Regulatory T cells: key controllers of immunologic self-tolerance. Cell 101:455.[Medline]
  9. Maloy, K. J., F. Powrie. 2001. Regulatory T cells in the control of immune pathology. Nat. Immunol. 2:816.[Medline]
  10. Shevach, E. M.. 2002. CD4+CD25+ suppressor T cells: more questions than answers. Nat. Rev. Immunol. 2:389.[Medline]
  11. Chen, W., S. M. Wahl. 2003. TGF-{beta}: the missing link in CD4+CD25+ regulatory T cell-mediated immunosuppression. Cytokine Growth Factor Rev. 14:85.[Medline]
  12. O‘Garra, A., P. Vieira. 2004. Regulatory T cells and mechanisms of immune system control. Nat. Med. 10:801.[Medline]
  13. Sakaguchi, S.. 2004. Naturally arising CD4+ regulatory T cells for immunologic self-tolerance and negative control of immune responses. Annu. Rev. Immunol. 22:531.[Medline]
  14. Hoerauf, A., N. Brattig. 2002. Resistance and susceptibility in human onchocerciasis: beyond Th1 vs. Th2. Trends Parasitol. 18:25.[Medline]
  15. Maizels, R. M., M. Yazdanbakhsh. 2003. Regulation of the immune response by helminth parasites: cellular and molecular mechanisms. Nat. Rev. Immunol. 3:733.[Medline]
  16. Iwashiro, M., R. J. Messer, K. E. Peterson, I. M. Stromnes, T. Sugie, K. J. Hasenkrug. 2001. Immunosuppression by CD4+ regulatory T cells induced by chronic retroviral infection. Proc. Natl. Acad. Sci. USA 98:9226.[Abstract/Free Full Text]
  17. Suvas, S., U. Kumaraguru, C. D. Pack, S. Lee, B. T. Rouse. 2003. CD4+CD25+ T cells regulate virus-specific primary and memory CD8+ T cell responses. J. Exp. Med. 198:889.[Abstract/Free Full Text]
  18. Dittmer, U., H. He, R. J. Messer, S. Schimmer, A. R. M. Olbrich, C. Ohlen, P. D. Greenberg, I. M. Stromnes, M. Iwashiro, S. Sakaguchi, et al 2004. Functional impairment of CD8+ T cells by regulatory T cells during persistent retroviral infection. Immunity 20:293.[Medline]
  19. Kullberg, M. C., D. Jankovic, P. L. Gorelick, P. Caspar, J. J. Letterio, A. W. Cheever, A. Sher. 2002. Bacteria-triggered CD4+ T regulatory cells suppress Helicobacter hepaticus-induced colitis. J. Exp. Med. 196:505.[Abstract/Free Full Text]
  20. McGuirk, P., C. McCann, K. H. G. Mills. 2002. Pathogen-specific T regulatory 1 cells induced in the respiratory tract by a bacterial molecule that stimulates interleukin 10 production by dendritic cells: a novel strategy for evasion of protective T helper type 1 responses by Bordetella pertussis. J. Exp. Med. 195:221.[Abstract/Free Full Text]
  21. Lundgren, A., E. Suri-Payer, K. Enarsson, A.-M. Svennerholm, B. S. Lundin. 2003. Helicobacter pylori-specific CD4+CD25high regulatory T cells suppress memory T-cell responses to H. pylori in infected individuals. Infect. Immun. 71:1755.[Abstract/Free Full Text]
  22. Maloy, K. J., L. Salaun, R. Cahill, G. Dougan, N. J. Saunders, F. Powrie. 2003. CD4+CD25+ TR cells suppress innate immune pathology through cytokine-dependent mechanisms. J. Exp. Med. 197:111.[Abstract/Free Full Text]
  23. Belkaid, Y., C. A. Piccirillo, S. Mendez, E. M. Shevach, D. L. Sacks. 2002. CD4+CD25+ regulatory T cells control Leishmania major persistence and immunity. Nature 420:502.[Medline]
  24. Mendez, S., S. K. Reckling, C. A. Piccirillo, D. Sacks, Y. Belkaid. 2004. Role for CD4+CD25+ regulatory T cells in reactivation of persistent leishmaniasis and control of concomitant immunity. J. Exp. Med. 200:201.[Abstract/Free Full Text]
  25. Hisaeda, H., Y. Maekawa, D. Iwakawa, H. Okada, K. Himeno, K. Kishihara, S.-i. Tsukumo, K. Yasutomo. 2004. Escape of malaria parasites from host immunity requires CD4+CD25+ regulatory T cells. Nat. Med. 10:29.[Medline]
  26. Hori, S., T. L. Carvalho, J. Demengeot. 2002. CD25+CD4+ regulatory T cells suppress CD4+ T cell-mediated pulmonary hyperinflammation driven by Pneumocystis carinii in immunodeficient mice. Eur. J. Immunol. 32:1282.[Medline]
  27. Montagnoli, C., A. Bacci, S. Bozza, R. Gaziano, P. Mosci, A. H. Sharpe, L. Romani. 2002. B7/CD28-dependent CD4+CD25+ regulatory T cells are essential components of the memory-protective immunity to Candida albicans. J. Immunol. 169:6298.[Abstract/Free Full Text]
  28. Hesse, M., C. A. Piccirillo, Y. Belkaid, J. Prufer, M. Mentink-Kane, M. Leusink, A. W. Cheever, E. M. Shevach, T. A. Wynn. 2004. The pathogenesis of schistosomiasis is controlled by cooperating IL-10-producing innate effector and regulatory T cells. J. Immunol. 172:3157.[Abstract/Free Full Text]
  29. Rouse, B. T., S. Suvas. 2004. Regulatory cells and infectious agents: detentes cordiale and contraire. J. Immunol. 173:2211.[Abstract/Free Full Text]
  30. Satoguina, J., M. Mempel, J. Larbi, M. Badusche, C. Loliger, O. Adjei, G. Gachelin, B. Fleischer, A. Hoerauf. 2002. Antigen-specific T regulatory-1 cells are associated with immunosuppression in a chronic helminth infection (onchocerciasis). Microbes Infect. 4:1291.[Medline]
  31. Steel, C., T. B. Nutman. 2003. CTLA-4 in filarial infections: implications for a role in diminished T cell reactivity. J. Immunol. 170:1930.[Abstract/Free Full Text]
  32. McKee, A. S., E. J. Pearce. 2004. CD25+CD4+ cells contribute to Th2 polarization during helminth infection by suppressing Th1 response development. J. Immunol. 173:1224.[Abstract/Free Full Text]
  33. Petit, G., M. Diagne, P. Maréchal, D. Owen, D. Taylor, O. Bain. 1992. Maturation of the filaria Litomosoides sigmodontis in BALB/c mice: comparative susceptibility of nine other inbred strains. Ann. Parasitol. Hum. Comp. 67:144.[Medline]
  34. Michael, E., D. A. P. Bundy, B. T. Grenfell. 1996. Re-assessing the global prevalence and distribution of lymphatic filariasis. Parasitology 112:409.
  35. Casiraghi, M., T. J. C. Anderson, C. Bandi, C. Bazzocchi, C. Genchi. 2001. A phylogenetic analysis of filarial nematodes: comparison with the phylogeny of Wolbachia endosymbionts. Parasitology 122:93.
  36. Le Goff, L., T. J. Lamb, A. L. Graham, Y. Harcus, J. E. Allen. 2002. IL-4 is required to prevent filarial nematode development in resistant but not susceptible strains of mice. Int. J. Parasitol. 32:1277.[Medline]
  37. Babayan, S., T. Attout, S. Specht, A. Hoerauf, G. Snounou, L. Renia, M. Korenaga, O. Bain, and C. Martin. 2004. Increased early local immune responses and altered worm development in high-dose infections of mice susceptible to the filaria Litomosoides sigmodontis. Med. Microbiol. Immunol. In press.
  38. Gomez-Escobar, N., W. F. Gregory, R. M. Maizels. 2000. Identification of Bm-tgh-2, a filarial nematode homolog of C. elegans daf-7 and human TGF-{beta}, expressed in microfilarial and adult stages of Brugia malayi. Infect. Immun. 68:6402.[Abstract/Free Full Text]
  39. Bain, O., S. Babayan. 2003. Behaviour of filariae: morphological and anatomical signatures of their life style within the arthropod and vertebrate hosts. Filaria J. 2:16.[Medline]
  40. Maréchal, P., L. Le Goff, W. Hoffman, J. Rapp, I. P. Oswald, C. Ombrouck, D. W. Taylor, O. Bain, G. Petit. 1997. Immune response to the filaria Litomosoides sigmodontis in susceptible and resistant mice. Parasite Immunol. 19:273.[Medline]
  41. Hori, S., T. Nomura, S. Sakaguchi. 2003. Control of regulatory T cell development by the transcription factor Foxp3. Science 299:1057.[Abstract/Free Full Text]
  42. Khattri, R., T. Cox, S.-A. Yasayko, F. Ramsdell. 2003. An essential role for Scurfin in CD4+CD25+ T regulatory cells. Nat. Immunol. 4:337.[Medline]
  43. Fontenot, J. D., M. A. Gavin, A. Y. Rudensky. 2003. Foxp3 programs the development and function of CD4+CD25+ regulatory T cells. Nat. Immunol. 4:330.[Medline]
  44. Fantini, M. C., C. Becker, G. Monteleone, F. Pallone, P. R. Galle, M. F. Neurath. 2004. Cutting edge: TGF-{beta} induces a regulatory phenotype in CD4+CD25 T cells through Foxp3 induction and down-regulation of Smad7. J. Immunol. 172:5149.[Abstract/Free Full Text]
  45. Chen, W., W. Jin, N. Hardegen, K. J. Lei, L. Li, N. Marinos, G. McGrady, S. M. Wahl. 2003. Conversion of peripheral CD4+CD25 naive T cells to CD4+CD25+ regulatory T cells by TGF-{beta} induction of transcription factor Foxp3. J. Exp. Med. 198:1875.[Abstract/Free Full Text]
  46. Vieira, P. L., J. R. Christensen, S. Minaee, E. J. O’Neill, F. J. Barrat, A. Boonstra, T. Barthlott, B. Stockinger, D. C. Wraith, A. O‘Garra. 2004. IL-10-secreting regulatory T cells do not express Foxp3 but have comparable regulatory function to naturally occurring CD4+CD25+ regulatory T cells. J. Immunol. 172:5986.[Abstract/Free Full Text]
  47. Babayan, S., M. N. Ungeheuer, C. Martin, T. Attout, E. Belnoue, G. Snounou, L. Renia, M. Korenaga, O. Bain. 2003. Resistance and susceptibility to filarial infection with Litomosoides sigmodontis are associated with early differences in parasite development and in localized immune reactions. Infect. Immun. 71:6820.[Abstract/Free Full Text]
  48. Ermann, J., C. G. Fathman. 2003. Costimulatory signals controlling regulatory T cells. Proc. Natl. Acad. Sci. USA 100:15292.[Free Full Text]
  49. Tone, M., Y. Tone, E. Adams, S. F. Yates, M. R. Frewin, S. P. Cobbold, H. Waldmann. 2003. Mouse glucocorticoid-induced tumor necrosis factor receptor ligand is costimulatory for T cells. Proc. Natl. Acad. Sci. USA 100:15059.[Abstract/Free Full Text]
  50. Kanamaru, F., P. Youngnak, M. Hashiguchi, T. Nishioka, T. Takahashi, S. Sakaguchi, I. Ishikawa, M. Azuma. 2004. Costimulation via glucocorticoid-induced TNF receptor in both conventional and CD25+ regulatory CD4+ T cells. J. Immunol. 172:7306.[Abstract/Free Full Text]
  51. Ronchetti, S., O. Zollo, S. Bruscoli, M. Agostini, R. Bianchini, G. Nocentini, E. Ayroldi, C. Riccardi. 2004. GITR, a member of the TNF receptor superfamily, is costimulatory to mouse T lymphocyte subpopulations. Eur. J. Immunol. 34:613.[Medline]
  52. Stephens, G. L., R. S. McHugh, M. J. Whitters, D. A. Young, D. Luxenberg, B. M. Carreno, M. Collins, E. M. Shevach. 2004. Engagement of glucocorticoid-induced TNFR family-related receptor on effector T cells by its ligand mediates resistance to suppression by CD4+CD25+ T cells. J. Immunol. 173:5008.[Abstract/Free Full Text]
  53. Korten, S., L. Volkmann, M. Saeftel, K. Fischer, M. Taniguchi, B. Fleischer, A. Hoerauf. 2002. Expansion of NK cells with reduction of their inhibitory Ly-49A, Ly-49C, and Ly-49G2 receptor-expressing subsets in a murine helminth infection: contribution to parasite control. J. Immunol. 168:5199.[Abstract/Free Full Text]
  54. Martin, C., L. Le Goff, M.-N. Ungeheuer, P. N. Vuong, O. Bain. 2000. Drastic reduction of a filarial infection in eosinophilic interleukin-5 transgenic mice. Infect. Immun. 68:3651.[Abstract/Free Full Text]
  55. Volkmann, L., O. Bain, M. Saeftel, S. Specht, K. Fischer, F. Brombacher, K. I. Matthaei, A. Hoerauf. 2003. Murine filariasis: interleukin 4 and interleukin 5 lead to containment of different worm developmental stages. Med. Microbiol. Immunol. 192:23.[Medline]
  56. Le Goff, L., P. Loke, H. F. Ali, D. W. Taylor, J. E. Allen. 2000. Interleukin-5 is essential for vaccine-mediated immunity but not innate resistance to a filarial parasite. Infect. Immun. 68:2513.[Abstract/Free Full Text]
  57. Cosmi, L., F. Liotta, R. Angeli, B. Mazzinghi, V. Santarlasci, R. Manetti, L. Lasagni, V. Vanini, P. Romagnani, E. Maggi, F. Annunziato, S. Romagnani. 2004. Th2 cells are less susceptible than Th1 cells to the suppressive activity of CD25+ regulatory thymocytes because of their responsiveness to different cytokines. Blood 103:3117.[Abstract/Free Full Text]
  58. Thornton, A. M., E. E. Donovan, C. A. Piccirillo, E. M. Shevach. 2004. Cutting edge: IL-2 is critically required for the in vitro activation of CD4+CD25+ T cell suppressor function. J. Immunol. 172:6519.[Abstract/Free Full Text]
  59. Doetze, A., J. Satoguina, G. Burchard, T. Rau, C. Loliger, B. Fleischer, A. Hoerauf. 2000. Antigen-specific cellular hyporesponsiveness in a chronic human helminth infection is mediated by Th3/Tr1-type cytokines IL-10 and transforming growth factor-{beta} but not by a Th1 to Th2 shift. Int. Immunol. 12:623.[Abstract/Free Full Text]
  60. Yazdanbakhsh, M., A. van den Biggelaar, R. M. Maizels. 2001. Th2 responses without atopy: immunoregulation in chronic helminth infections and reduced allergic disease. Trends Immunol. 22:372.[Medline]
  61. Beilharz, M. W., L. M. Sammels, A. Paun, K. Shaw, P. van Eeden, M. W. Watson, M. L. Ashdown. 2004. Timed ablation of regulatory CD4+ T cells can prevent murine AIDS progression. J. Immunol. 172:4917.[Abstract/Free Full Text]
  62. Takahashi, T., T. Tagami, S. Yamazaki, T. Uede, J. Shimizu, N. Sakaguchi, T. W. Mak, S. Sakaguchi. 2000. Immunologic self-tolerance maintained by CD25+CD4+ regulatory T cells constitutively expressing cytotoxic T lymphocyte-associated antigen 4. J. Exp. Med. 192:303.[Abstract/Free Full Text]
  63. Ji, H.-b., G. Liao, W. A. Faubion, A. C. Abadía-Molina, C. Cozzo, F. S. Laroux, A. Caton, C. Terhorst. 2004. The natural ligand for glucocorticoid-induced TNF receptor-related protein abrogates regulatory T cell suppression. J. Immunol. 172:5823.[Abstract/Free Full Text]
  64. Chambers, C. A., M. S. Kuhns, J. G. Egen, J. P. Allison. 2001. CTLA-4-mediated inhibition in regulation of T cell responses: mechanisms and manipulation in tumor immunotherapy. Annu. Rev. Immunol. 19:565.[Medline]
  65. Fowler, S., F. Powrie. 2002. CTLA-4 expression on antigen-specific cells but not IL-10 secretion is required for oral tolerance. Eur. J. Immunol. 32:2997.[Medline]
  66. Oosterwegel, M. A., R. J. Greenwald, D. A. Mandelbrot, R. B. Lorsbach, A. H. Sharpe. 1999. CTLA-4 and T cell activation. Curr. Opin. Immunol. 11:294.[Medline]
  67. McCoy, K., M. Camberis, G. Le Gros. 1997. Protective immunity to nematode infection is induced by CTLA-4 blockade. J. Exp. Med. 186:183.[Abstract/Free Full Text]
  68. Saeftel, M., M. Arndt, S. Specht, L. Volkmann, A. Hoerauf. 2003. Synergism of {gamma}-interferon and interleukin-5 in the control of murine filariasis. Infect. Immun. 71:6978.[Abstract/Free Full Text]
  69. Mahanty, S., S. N. Mollis, M. Ravichandran, J. S. Abrams, V. Kumaraswami, K. Jayaraman, E. A. Ottesen, T. B. Nutman. 1996. High levels of spontaneous and parasite antigen-driven interleukin-10 production are associated with antigen-specific hyporesponsiveness in human lymphatic filariasis. J. Infect. Dis. 173:769.[Medline]
  70. Specht, S., L. Volkmann, T. Wynn, A. Hoerauf. 2004. Interleukin-10 (IL-10) counterregulates IL-4-dependent effector mechanisms in murine filariasis. Infect. Immun. 72:6287.[Abstract/Free Full Text]
  71. Omer, F. M., J. B. de Souza, E. M. Riley. 2003. Differential induction of TGF-{beta} regulates proinflammatory cytokine production and determines the outcome of lethal and nonlethal Plasmodium yoelii infections. J. Immunol. 171:5430.[Abstract/Free Full Text]
  72. Mills, K. H.. 2004. Regulatory T cells: friend or foe in immunity to infection?. Nat. Rev. Immunol. 4:841.[Medline]
  73. Belkaid, Y., K. F. Hoffmann, S. Mendez, S. Kamhawi, M. C. Udey, T. A. Wynn, D. L. Sacks. 2001. The role of interleukin (IL)-10 in the persistence of Leishmania major in the skin after healing and the therapeutic potential of anti-IL-10 receptor antibody for sterile cure. J. Exp. Med. 194:1497.[Abstract/Free Full Text]
  74. Schopf, L. R., K. F. Hoffmann, A. W. Cheever, J. F. Urban, Jr, T. A. Wynn. 2002. IL-10 is critical for host resistance and survival during gastrointestinal helminth infection. J. Immunol. 168:2383.[Abstract/Free Full Text]
  75. Helmby, H., R. K. Grencis. 2003. Contrasting roles for IL-10 in protective immunity to different life cycle stages of intestinal nematode parasites. Eur. J. Immunol. 33:2382.[Medline]
  76. van der Kleij, D., E. Latz, J. F. H. M. Brouwers, Y. C. M. Kruize, M. Schmitz, E. A. Kurt-Jones, T. Espevik, E. C. de Jong, M. L. Kapsenberg, D. T. Golenbock, A. G. M. Tielens, M. Yazdanbakhsh. 2002. A novel host-parasite lipid cross talk: schistosomal lysophosphatidylserine activates Toll-like receptor 2 and affects immune polarization. J. Biol. Chem. 277:48122.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Immunol.Home page
K. N. Couper, P. A. Lanthier, G. Perona-Wright, L. W. Kummer, W. Chen, S. T. Smiley, M. Mohrs, and L. L. Johnson
Anti-CD25 Antibody-Mediated Depletion of Effector T Cell Populations Enhances Susceptibility of Mice to Acute but Not Chronic Toxoplasma gondii Infection
J. Immunol., April 1, 2009; 182(7): 3985 - 3994.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. J. Mylonas, M. G. Nair, L. Prieto-Lafuente, D. Paape, and J. E. Allen
Alternatively Activated Macrophages Elicited by Helminth Infection Can Be Reprogrammed to Enable Microbial Killing
J. Immunol., March 1, 2009; 182(5): 3084 - 3094.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. D'Elia, J. M. Behnke, J. E. Bradley, and K. J. Else
Regulatory T Cells: A Role in the Control of Helminth-Driven Intestinal Pathology and Worm Survival
J. Immunol., February 15, 2009; 182(4): 2340 - 2348.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. J. McSorley, Y. M. Harcus, J. Murray, M. D. Taylor, and R. M. Maizels
Expansion of Foxp3+ Regulatory T Cells in Mice Infected with the Filarial Parasite Brugia malayi
J. Immunol., November 1, 2008; 181(9): 6456 - 6466.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
S. Rausch, J. Huehn, D. Kirchhoff, J. Rzepecka, C. Schnoeller, S. Pillai, C. Loddenkemper, A. Scheffold, A. Hamann, R. Lucius, et al.
Functional Analysis of Effector and Regulatory T Cells in a Parasitic Nematode Infection
Infect. Immun., May 1, 2008; 76(5): 1908 - 1919.
[Abstract] [Full Text] [PDF]


Home page
Clin. Microbiol. Rev.Home page
M. T. Audicana and M. W. Kennedy
Anisakis simplex: from Obscure Infectious Worm to Inducer of Immune Hypersensitivity
Clin. Microbiol. Rev., April 1, 2008; 21(2): 360 - 379.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
M. P. Hubner, B. Pasche, S. Kalaydjiev, P. T. Soboslay, A. Lengeling, H. Schulz-Key, E. Mitre, and W. H. Hoffmann
Microfilariae of the Filarial Nematode Litomosoides sigmodontis Exacerbate the Course of Lipopolysaccharide-Induced Sepsis in Mice
Infect. Immun., April 1, 2008; 76(4): 1668 - 1677.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. M. Dittrich, A. Erbacher, S. Specht, F. Diesner, M. Krokowski, A. Avagyan, P. Stock, B. Ahrens, W. H. Hoffmann, A. Hoerauf, et al.
Helminth Infection with Litomosoides sigmodontis Induces Regulatory T Cells and Inhibits Allergic Sensitization, Airway Inflammation, and Hyperreactivity in a Murine Asthma Model
J. Immunol., February 1, 2008; 180(3): 1792 - 1799.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
V. H. Nguyen, S. Shashidhar, D. S. Chang, L. Ho, N. Kambham, M. Bachmann, J. M. Brown, and R. S. Negrin
The impact of regulatory T cells on T-cell immunity following hematopoietic cell transplantation
Blood, January 15, 2008; 111(2): 945 - 953.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. D. Taylor, A. Harris, S. A. Babayan, O. Bain, A. Culshaw, J. E. Allen, and R. M. Maizels
CTLA-4 and CD4+CD25+ Regulatory T Cells Inhibit Protective Immunity to Filarial Parasites In Vivo
J. Immunol., October 1, 2007; 179(7): 4626 - 4634.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Guilliams, G. Oldenhove, W. Noel, M. Herin, L. Brys, P. Loi, V. Flamand, M. Moser, P. De Baetselier, and A. Beschin
African Trypanosomiasis: Naturally Occurring Regulatory T Cells Favor Trypanotolerance by Limiting Pathology Associated with Sustained Type 1 Inflammation
J. Immunol., September 1, 2007; 179(5): 2748 - 2757.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. M. Burke, L. M. Ganley-Leal, A. Khatri, and L. M. Wetzler
Neisseria meningitidis PorB, a TLR2 Ligand, Induces an Antigen-Specific Eosinophil Recall Response: Potential Adjuvant for Helminth Vaccines?
J. Immunol., September 1, 2007; 179(5): 3222 - 3230.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. N. Couper, D. G. Blount, J. B. de Souza, I. Suffia, Y. Belkaid, and E. M. Riley
Incomplete Depletion and Rapid Regeneration of Foxp3+ Regulatory T Cells Following Anti-CD25 Treatment in Malaria-Infected Mice
J. Immunol., April 1, 2007; 178(7): 4136 - 4146.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. P. Beiting, L. F. Gagliardo, M. Hesse, S. K. Bliss, D. Meskill, and J. A. Appleton
Coordinated Control of Immunity to Muscle Stage Trichinella spiralis by IL-10, Regulatory T Cells, and TGF-beta
J. Immunol., January 15, 2007; 178(2): 1039 - 1047.
[Abstract] [Full Text] [PDF]


Home page
Am J Trop Med HygHome page
C. K. NFON, B. L. MAKEPEACE, L. M. NJONGMETA, V. N. TANYA, and A. J. TREES
LACK OF RESISTANCE AFTER RE-EXPOSURE OF CATTLE CURED OF ONCHOCERCA OCHENGI INFECTION WITH OXYTETRACYCLINE
Am J Trop Med Hyg, January 1, 2007; 76(1): 67 - 72.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. D. Turner, R. S. Langley, K. L. Johnston, G. Egerton, S. Wanji, and M. J. Taylor
Wolbachia Endosymbiotic Bacteria of Brugia malayi Mediate Macrophage Tolerance to TLR- and CD40-Specific Stimuli in a MyD88/TLR2-Dependent Manner
J. Immunol., July 15, 2006; 177(2): 1240 - 1249.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. Wei, I. Kryczek, and W. Zou
Regulatory T-cell compartmentalization and trafficking
Blood, July 15, 2006; 108(2): 426 - 431.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. D. Taylor, A. Harris, M. G. Nair, R. M. Maizels, and J. E. Allen
F4/80+ Alternatively Activated Macrophages Control CD4+ T Cell Hyporesponsiveness at Sites Peripheral to Filarial Infection.
J. Immunol., June 1, 2006; 176(11): 6918 - 6927.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. J. Taylor, M. Mohrs, and E. J. Pearce
Regulatory T Cell Responses Develop in Parallel to Th Responses and Control the Magnitude and Phenotype of the Th Effector Populatio
J. Immunol., May 15, 2006; 176(10): 5839 - 5847.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Baumgart, F. Tompkins, J. Leng, and M. Hesse
Naturally Occurring CD4+Foxp3+ Regulatory T Cells Are an Essential, IL-10-Independent Part of the Immunoregulatory Network in Schistosoma mansoni Egg-Induced Inflammation
J. Immunol., May 1, 2006; 176(9): 5374 - 5387.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Babu, C. P. Blauvelt, V. Kumaraswami, and T. B. Nutman
Regulatory networks induced by live parasites impair both Th1 and th2 pathways in patent lymphatic filariasis: implications for parasite persistence.
J. Immunol., March 1, 2006; 176(5): 3248 - 3256.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
M. S. Wilson, M. D. Taylor, A. Balic, C. A.M. Finney, J. R. Lamb, and R. M. Maizels
Suppression of allergic airway inflammation by helminth-induced regulatory T cells
J. Exp. Med., November 7, 2005; 202(9): 1199 - 1212.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
M. Agostini, E. Cenci, E. Pericolini, G. Nocentini, G. Bistoni, A. Vecchiarelli, and C. Riccardi
The Glucocorticoid-Induced Tumor Necrosis Factor Receptor-Related Gene Modulates the Response to Candida albicans Infection
Infect. Immun., November 1, 2005; 73(11): 7502 - 7508.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Taylor, M. D.
Right arrow Articles by Maizels, R. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Taylor, M. D.
Right arrow Articles by Maizels, R. M.
Right arrowPubmed/NCBI databases
*Substance via MeSH


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS