|
|
||||||||





* Department of Microbiology and Immunology, University of Maryland, Baltimore, MD 21201; and
Pediatric Infectious Diseases, Cedars-Sinai Medical Center, Los Angeles, CA 90048
| Abstract |
|---|
|
|
|---|
B and IL-6 transactivation, and IL-6 secretion. In contrast, HMEC activation by TLR2 agonists, TNF-
, or IL-1
was insensitive to mastoparan. In the murine macrophage cell line, RAW 264.7, and in primary murine macrophages, G protein dysregulation by mastoparan resulted in significant inhibition of LPS-induced signaling leading to both MyD88-dependent and MyD88-independent gene expression, while TLR2-mediated gene expression was not significantly inhibited. In addition to inhibition of TLR4-mediated MAPK phosphorylation in macrophages, mastoparan blunted IL-1R-associated kinase-1 kinase activity induced by LPS, but not by TLR2 agonists, yet failed to affect phosphorylation of Akt by phosphoinositol-3-kinase induced by either TLR2- or TLR4-mediated signaling. These data confirm the importance of heterotrimeric G proteins in TLR4-mediated responses in cells that use either soluble or membrane-associated CD14 and reveal a level of TLR and signaling pathway specificity not previously appreciated. | Introduction |
|---|
|
|
|---|
TLR4 is the principal signal-transducing receptor for bacterial LPS (3, 4), and coreceptors, such as CD-14 and Mac-1, are necessary for optimal expression of specific genes (5, 6). Although much of what we know about TLR4 signaling is based on studies of cells of monocytic lineage, LPS-induced activation and injury of endothelial cells contributes significantly to the pathogenesis of Gram-negative septic shock and the disruption of the blood brain barrier in Gram-negative meningitis (7, 8, 9). Once activated by LPS, the endothelial cells release inflammatory cytokines such as IL-1, IL-6, and IL-8 (10, 11, 12, 13, 14), which in turn, can act in an autocrine fashion on the endothelium to elicit an inflammatory surface. In contrast to monocytes and macrophages, endothelial cells lack membrane-bound CD14 (mCD14)5 (15, 16) and require the presence of soluble CD14 for LPS signaling (17, 18, 19). However, neither soluble CD14 nor mCD14, which is GPI-linked, can mediate LPS-induced signals across the cell membrane because they lack transmembrane and intracytoplasmic regions (reviewed in Ref. 20). Using fluorescent resonance energy transfer techniques, Petty and colleagues (21) first showed a physical interaction between CD14 and TLR4 in response to LPS stimulation. Subsequently, Triantafilou and coworkers (22, 23) have further provided evidence for the recruitment of TLR4 into cholesterol-rich membrane microdomains or "rafts" upon stimulation of cells with ligand that permits interaction of TLR4 with CD14, and they have identified additional components of an "LPS receptor complex" that include the chemokine receptor, CXCR4, growth differentiation factor 5, and heat shock proteins (HSP), HSP 70 and 90.
Also contained within rafts, and physically associated with the intracellular regions of G protein-coupled receptors (GPCR), are the heterotrimeric guanine nucleotide-binding proteins (G proteins) that consist of
,
, and
subunits and mediate a variety of extracellular signals by their activation and subsequent interaction with intracellular effectors, e.g., adenylyl cyclase, guanosine 3',5'-monophosphate phosphodiesterase, and phospholipase C (24, 25, 26, 27). Ligand binding of GPCRs activates the MAPKs, JNK and p38 (28, 29, 30, 31). Coimmunoprecipitation experiments have revealed that src kinases and Gi/G0 heterotrimeric G proteins also associate with CD14 in human monocyte lysates (32, 33). Lastly, some studies have found that treatment of cells with Bordetella pertussis toxin (PT), a G protein inhibitor (34), or mastoparan, a peptide derived from wasp venom that activates G proteins (35, 36), modulate LPS-induced B cell mitogenesis, and macrophage cytokine and NO production, and p38 phosphorylation (33, 37, 38, 39, 40), although in some studies, PT exerted either no effect or even enhanced LPS-mediated responses (e.g., Refs. 33 and 40).
In this study, we further investigated the contribution of G proteins to LPS-induced signaling in human dermal microvessel endothelial cell (HMEC) and in murine primary macrophages and the macrophage cell line, RAW 264.7. Initially, we demonstrated that LPS-induced cytokine secretion in HMECs was suppressed by the p38 MAPK inhibitor, SB203580, as well as by both the G protein uncoupling agent, PT and the G protein peptide agonist, mastoparan. Mastoparan inhibited LPS-induced cytokine mRNA synthesis and p38 kinase activity in both HMEC and in the murine macrophages, findings that were confirmed at the level of NF-
B and IL-6 promoter transactivation and IL-6 release. These results suggest that p38 MAPK pathway is regulated by G proteins and plays an important role in LPS-induced activation of both HMEC and macrophages. Moreover, IL-1R-associated kinase-1 (IRAK-1) kinase activity and ERK1/2 phosphorylation were blocked in mastoparan-pretreated macrophages within minutes of LPS stimulation, while phosphorylation of Akt was not. Finally, our data demonstrate that mastoparan preferentially targets the TLR4 signaling pathway, as this peptide blocks cellular activation by TLR4 agonists (LPS or chlamydial HSP 60), but not by IL-1
, TNF-
, or TLR2 stimulation of HMEC or murine macrophages. Thus, G proteins play a critical and early role in TLR4-mediated signaling, even in cells that lack mCD14.
| Materials and Methods |
|---|
|
|
|---|
Protein-free E. coli K235 LPS (<0.008% protein) was prepared by modification of the phenol-water extraction method (41). The synthetic lipoprotein S-[2,3-Bis(palmitoyloxy)-(2-RS)-propyl]-N-palmitoyl-(R)-Cys-(S)-Ser-Lys4-OH, trihydrochloride (Pam3Cys) was obtained from EMC Microcollections. The TLR2 ligand S-(2,3-bispalmitoyloxypropyl)-Cys-Gly-Asp-Pro-Lys-His-Pro-Lys-Ser-Phe, Pam(2)CGDPKHPKSF (FSL-1) was purchased from InvivoGen. Phenol-soluble modulin (PSM), derived from Staphylococcus epidermidis, was prepared as described elsewhere (42, 43, 44). FBS and other tissue culture media were obtained from HyClone and BioWhittaker. The specific p38 MAPK inhibitor, SB203580, was obtained from SmithKline Beecham. Mastoparan, the inactive mastoparan analog, M-17, and herbimycin A were purchased from Biomol and were resuspended in PBS without Mg2+. Kits for the measurement of p38 MAPK in vitro kinase activity were purchased from Stratagene. Recombinant human IL-1
and recombinant human TNF-
were obtained from R&D Systems.
Cell culture
Immortalized human dermal microvessel endothelial cells (HMEC) were obtained from Dr. F. J. Candal (Center for Disease Control and Prevention, Atlanta, GA) and were cultured in MCDB-131 medium supplemented with 10% inactivated FBS, 2 mM glutamine, and 100 U/ml and 100 µg/ml penicillin and streptomycin, respectively. The RAW 264.7 cell line was obtained from the American Type Culture Collection and was cultured in DMEM supplemented with 10% inactivated FBS, 2 mM glutamine, penicillin, and streptomycin. Primary murine macrophages were obtained by peritoneal lavage from 5- to 7-wk-old C57BL/6 mice (The Jackson Laboratory) 4 days after i.p. injection with sterile fluid thioglycolate as described previously and were cultured identically to the RAW 264.7 cell line (45).
Cell stimulation
Confluent HMEC were pretreated for 30 min with medium only, or inhibitors of cell signaling and then incubated with the indicated concentrations of LPS, IL-1
, or TNF-
in the presence of heat-inactivated 5% serum. Following stimulation with various stimuli for the indicated time intervals, HMEC were washed with PBS and then lysed in EB/RIPA buffer (1% Triton X-100, 5 mM EDTA, 50 mM NaCl, 50 mM NaF, 10 mM Tris (pH 7.6), 0.1% BSA, 1% aprotinin, 1/1000 phenylarsine oxide, and 1/100 sodium vanadate) for immunoprecipitation or in Laemmli buffer for immunoblotting. In the case of the RAW 264.7 macrophage cell line, cells were seeded at 6 x 106 cells/10 ml/dish (Falcon 353003; BD Biosciences). After overnight incubation, cells were stimulated with the indicated concentration of LPS, after a 30 min pretreatment with medium only or mastoparan, and were washed with ice-cold PBS twice, and finally lysed in phosphorylation lysis buffer, composed of 0.1 mM EDTA, 10 mM NaF, 1 mM Na3VO4, 1% aprotinin, and 0.1% Triton X-100 in 20 mM Tris-HCl (pH 7.5), and this lysate was used for immunoblotting.
Primary murine macrophages were cultured at a density of 2 x 106 cells/well in six-well plates. Cells were pretreated with medium only, or medium containing 25 µM mastoparan or control analog for 30 min before stimulation with LPS (10 ng/ml) or Pam3Cys (100 ng/ml). Cells were lysed at 3 h after treatment and total RNA prepared for quantitative real-time PCR analysis. Whole cell lysates for MAPK or Akt immunoblotting or the IRAK-1 kinase assay were prepared at the times indicated in the figures.
Western blot analysis
HMEC lysates (30 µg of protein per lane) were separated by SDS-PAGE and then electrotransferred onto nitrocellulose membranes. Nonspecific binding was blocked by overnight incubation of membranes at 4°C with 5% BSA and 1% goat serum or 5% dry milk powder (Bio-Rad), and 0.05% Tween 20 in TBS, pH 7.6. The membranes were then probed with anti-phosphotyrosine Ab (clone 4G10; Upstate Biotechnology), anti-active p38 Ab, or anti-p38 MAPK Ab, at 1/1000 dilution. As a protein loading control,
-actin was detected by Western analysis in the same samples using a rabbit polyclonal anti-
-actin Ab (Santa Cruz Biotechnology) at a 1/200 dilution. A peroxidase-labeled goat anti-mouse IgG or goat anti-rabbit Ab (Kirkegaard and Perry Laboratory) or donkey anti-rabbit Ab (Amersham) were used as a secondary Ab. Immunoreactive proteins were detected with chemiluminescent system (ECL; Amersham).
In the case of RAW 264.7 cells, 20 µg of cell lysate protein per lane was electrophoresed on a 10% SDS-PAGE gel and transferred to polyvinylidene difluoride membrane (Amersham or Millipore). The membranes were then probed with anti-ERK, anti-JNK Abs (Cell Signaling Technology), or anti-p38 Ab (New England Biolabs). Anti-active (phospho-) p38 MAPK Ab was purchased from Promega. Anti-phospho-ERK1,2 Ab and anti-phospho-Akt Ab were obtained from Cell Signaling Technology. Anti-rabbit polyclonal IgG peroxidase conjugate was purchased from Sigma-Aldrich.
p38 kinase assay
HMEC were stimulated with 100 ng/ml LPS for 30 min to obtain maximal p38 MAPK phosphorylation. Following this stimulation, cells were lysed with EB/RIPA buffer (1% Triton X-100, 5 mM EDTA, 50 mM NaCl, 50 mM NaF, 10 mM Tris pH 7.6, 0.1% BSA, 1% aprotinin, 1/1000 phenylarsine oxide, and 1/100 sodium vanadate. Phosphorylated 38 MAPK was immunoprecipitated with 2 µl of anti-p38 Ab (
CSBP2, 17.4 mg/ml; kindly provided by Dr. J. Lee, SmithKline Beecham) and Pansorbin (100 µl; Calbiochem). The pellet was either resuspended for p38 kinase assay or lysed in Laemmli buffer for Western blotting. In vitro kinase activity of p38 MAPK was measured using the protein kinase p38 assay kit, using phosphorylated heat- and acid-stable protein regulated by insulin as a substrate. The reaction mixtures were resolved with SDS-PAGE and the gels were dried and subjected to autoradiography.
IRAK-1 kinase assay
The IRAK-1 kinase assay was conducted essentially as previously described (46). Briefly, the immunoprecipitated IRAK-1 complexes were washed 4 times with lysis buffer and twice with kinase buffer (20 mM HEPES (pH 7.6), 20 mM MgCl2, 20 mM glycerophosphate, 20 mM para-nitrophenylphosphate, 1 mM EDTA, 1 mM sodium orthovanadate, and 1 mM benzamidine). Thirty microliters of kinase buffer was then added to each sample, supplemented with 5 µM ATP, 1 µg myelin basic protein (MBP; Sigma-Aldrich), and 1 µl [32P]ATP, and incubated at 37°C for 30 min. Ten microliters of Laemmli sample buffer was added, and the samples were incubated at 50°C for 10 min and subjected to SDS-PAGE analysis. The gel was dried and exposed to a PhosphoScreen (Molecular Dynamics). The intensity of the radioactive signal was quantified using PhosphorImager (Molecular Dynamics) (47, 48).
Measurement of steady-state mRNA by quantitative real-time PCR
PCR was performed in a Sequence Detector System (ABI Prism 7900 Sequence Detection System and software; Applied Biosystems). Amplification was performed in a final volume of 25 µl, containing 30 ng of cDNA from the reversed transcribed reaction, primer mixture (0.3 µM each of sense and antisense primers), and 12.5 µl of 2x SYBR Green Master Mix (Applied Biosystems). The oligonucleotide primers were designed using Primer Express 1.5 software (Applied Biosystems). In addition, the sense and antisense sequences of each pair of primers were designed to overlap adjacent exon boundaries to exclude detection of genomic DNA. The standard amplification program included 40 cycles of two steps each, comprised of heating to 95°C and 60°C. Fluorescent product was detected at the last step of each cycle. The final mRNA levels of the genes studied were normalized using the comparative CT method (49). Statistical significance between groups was evaluated by ANOVA and the Tukey multiple-comparison test using the Prism program (GraphPad). Differences between groups were considered significant at the level of p < 0.05. The following primers were used: IL-12 p40 sense, TCTTTGTTCGAATCCAGCG; IL-12 p40 antisense, GGAACGCACCTTTCTGGTTACA; IL-12 p35 sense, AGACGGCCAGAGAAAAACTGAA; IL-12 p35 antisense, GTTTGGTCCCGTGTGATGTCTT; IFN-
-inducible protein 10 (IP-10) sense, CCACGTGTTGAGATCATTGCC; IP-10 antisense, GCCCTTTTAGACCTTTTTTGGC; IFN-
sense, CACTTGAAGAGCTATTACTGGAGGG; IFN-
antisense, CTCGGACCACCATCCAGG; TNF-
sense, GACCCTCACACTCAGATCATCTTCT; TNF-
antisense, CCACTTGGTGGTTTGCTACGA; IL-6 sense, TGTCTATACCACTTCACAAGTCGGAG; IL-6 antisense, GCACAACTCTTTTCTCATTTCCAC; inducible NO synthase (iNOS) sense, GAAAACCCCTTGTGCTGTTCTCA; iNOS antisense, TCCAGGGATTCTGGAACATTCTGT.
Measurement of cytokine production
For measurement of LPS-induced IL-6 release, HMEC were grown to confluence in 24-well culture plates (approximate cell density, 3 x 105 cells/well) containing medium supplemented with 5% heat-inactivated FBS. After 6 h of stimulation with LPS, with or without a 30 min preincubation of cells with inhibitors, supernatants were harvested and assayed for IL-6 activity by ELISA (Genzyme). RAW 264.7 cells were seeded at 2 x 105 cells/well in a volume of 0.5 ml of culture medium onto the 24-well plates, and incubated overnight. After 4 h of incubation with LPS, without or with preincubation for 1 h with various concentrations of mastoparan, supernatants were collected, and TNF-
was measured by ELISA (R&D Systems).
Transfection of cells
A dominant-negative expression vector of p38 MAPK (AF) has been characterized previously (50). HMEC cells reaching 5080% confluence were used for transfection with FuGene 6 Transfection Reagent (Boehringer Mannheim) following manufacturers instructions. Reporter genes pCMV-
-galactosidase (0.1 µg) and endothelial leukocyte adhesion molecule-NF-
B-luciferase (1.5 µg), or human IL-6 promoter luciferase, and pcDNA3 empty vector or dominant-negative mutant of p38 MAPK (2 µg each) were used. Eighteen hours after transfection, HMEC were stimulated for 6 h with 100 ng/ml LPS. Cells were then lysed and luciferase activity was measured with a Promega kit (Promega) and a luminometer.
-Galactosidase activity was determined by calorimetric method to normalize transfection efficiency as described earlier (51, 52). Data shown are mean of three independent experiments. RAW 264.7 cells were seeded at 2 x 105 cells/well/0.5 ml. Cells were transfected the following day with 1.0 µg of endothelial leukocyte adhesion molecule-NF-
B luciferase reporter construct using FuGene 6. After overnight incubation, RAW 264.7 cells were stimulated with 50 ng/ml LPS for 6 h, luciferase activity was measured, and normalized against
-galactosidase activity.
| Results |
|---|
|
|
|---|
Previous studies have shown that tyrosine kinases, p38 MAPK, and G proteins are involved in the LPS responses of macrophages (e.g., reviewed in Refs. 53 and 54). To determine whether these same signaling pathways were also involved in LPS-induced cellular activation of HMEC, we investigated the effects of preincubation of endothelial cells with pharmacologic inhibitors that are known to block LPS-mediated IL-6 secretion in macrophages. Fig. 1 shows that LPS induced a robust secretion of IL-6 by HMEC that was sensitive to inhibition by herbimycin A, a tyrosine kinase inhibitor, SB203580, a specific inhibitor of p38 MAPK activity, PT, an inhibitor that uncouples G protein-mediated signal transduction (38), and mastoparan, a peptide that activates G proteins. An inactive mastoparan analog, M17, failed to inhibit IL-6 secretion (data not shown). Inhibition of LPS-induced IL-6 secretion in HMEC by SB203580 (Fig. 2A) and mastoparan (Fig. 2B) was dose-dependent. As a positive control, we also confirmed in the murine macrophage cell line, RAW 264.7, the previously reported inhibitory effect of mastoparan on LPS-induced cytokine release by human monocytes/PBMC (33). Fig. 2C illustrates that LPS-induced TNF-
secretion was also inhibited significantly by preincubation of this macrophage cell line with mastoparan (
10 µM), but not by the inactive M17 control peptide (data not shown). Interestingly, higher concentrations of mastoparan were required to elicit significant inhibition of cytokine release in macrophages than in HMEC. These data confirm previous studies in macrophages and implicate a requirement for both G proteins and p38 activation in LPS-induced cytokine release in HMEC as well.
|
|
Because LPS-induced IL-6 release by HMEC was strongly inhibited by p38 inhibitor, SB203580 (Fig. 1), we next examined the activation of p38 MAPK in HMEC. LPS induced tyrosine phosphorylation of p38 MAPK as detected by immunoprecipitation with anti-p38 Ab followed by Western analysis with anti-phospho-tyrosine Ab (Fig. 3A, right lane). Tyrosine phosphorylation of p38 induced by LPS was associated with a time-dependent increase between 2 and 60 min poststimulation in p38 MAPK activity (Fig. 3B). p38 MAPK activity was inhibited significantly by pretreatment of cells with SB203580 (Fig. 3B, compare lane 5 to lane 7, marked by arrows).
|
LPS activates NF-
B through G proteins and p38 MAPK for induction of cytokine release
LPS promotes nuclear translocation of NF-
B in monocytes and macrophages, and this activation of NF-
B is required for the induction of many cytokines, including IL-6 (55). We next sought to clarify the role of p38 MAPK in LPS-induced NF-
B translocation and IL-6 gene expression in HMEC. As shown in Fig. 4A, LPS induced significant NF-
B luciferase activity (filled bars) and IL-6 promoter luciferase activity (open bars), while cotransfection of HMEC with a dominant-negative form of p38 (AF) inhibited LPS-induced transactivation of both NF-
B and IL-6 promoter luciferase activities completely. These data support the hypothesis that p38 MAPK regulates activation of IL-6 gene expression HMEC through an effect on NF-
B transactivation.
|
B transactivation and IL-6 promoter reporter activity. Fig. 4B illustrates that, like the p38 dominant-negative mutant construct, mastoparan inhibited both NF-
B (filled bars) and IL-6 (open bars) reporter gene activities in HMEC in a dose-dependent fashion. This effect was also seen when a second TLR4 agonist, chlamydial HSP60 (56), was used as a stimulus (Fig. 4C). In contrast to the TLR4 agonists, NF-
B transactivation induced by the TLR2/6 agonist, PSM, or by the cytokines, TNF-
- or IL-1
, was not significantly inhibited by mastoparan (Fig. 4C). Finally, the effects of mastoparan on NF-
B transactivation was evaluated in the RAW 264.7 macrophage cell line. Fig. 4D shows that mastoparan also caused a dose-dependent inhibition of NF-
B luciferase activity in macrophages, with a similar dose dependence as seen for inhibition of TNF-
secretion (Fig. 2C), which was paralleled by inhibition of LPS-induced I
B
degradation (data not shown). Furthermore, the effects of mastoparan on TLR2-, TNF-
, and IL-1
signaling on IL-6 secretion was measured in HMEC and RAW 264.7 cells (Fig. 4E). We did not observe any inhibitory effects of mastoparan on IL-1
- and TNF-
-induced IL-6 secretion in HMEC (Fig. 4E, left panel) or Pam3Cys- and FSL-1- induced IL-6 secretion in RAW 264.7 cells (Fig. 4E, right panel). Thus, disruption of p38 MAPK activity secondary to disruption of G protein-coupled signaling by mastoparan results in decreases in both NF-
B and IL-6 reporter activities in HMEC and in a murine macrophage cell line. That this is not a generalized inhibitory effect on gene expression is shown by the failure of mastoparan to modulate cytokine- or TLR2-induced NF-
B transactivation or IL-6 secretion. Effect of mastoparan on cytokine gene expression in murine macrophages
Because mastoparan inhibited TNF-
secretion in RAW 264.7 cells (Fig. 2D), as well as reporter gene expression in HMEC and in RAW 264.7 cells (Fig. 4), quantitative real-time PCR was used to assess the effects of mastoparan on LPS-induced endogenous gene expression in RAW 264.7 cells and in primary murine macrophages. We also evaluated the effects of mastoparan on gene expression induced by the synthetic TLR2/1 agonist, Pam3Cys, in both populations of macrophages.
Fig. 5 illustrates relative steady-state mRNA expression induced in RAW 264.7 cells by LPS or by Pam3Cys and the effects of mastoparan on gene expression. Included in this analysis were genes known to be MyD88-dependent and inducible by LPS and Pam3Cys (e.g., TNF-
and IL-1
), as well as genes that are preferentially induced by LPS through the MyD88-independent pathway (e.g., IFN-
, IP-10, iNOS, IL-6) (57, 58, 59). For all genes examined, mastoparan treatment resulted in a statistically significant inhibition of steady-state gene expression induced by LPS, but not by Pam3Cys. A similar pattern of inhibition was observed in mastoparan-treated primary macrophages (Fig. 6), which unlike the RAW 264.7 cells, also respond to LPS with IL-12 p35 and IL-12 p40 gene expression. Again, for all LPS-inducible genes, mastoparan elicited a significant degree of inhibition of gene expression, while Pam3Cys-induced gene expression was not statistically different in the absence or presence of mastoparan (p > 0.05). Notably, the induction of IP-10 mRNA, although statistically inhibited by mastoparan in the LPS-stimulated primary macrophages, was less sensitive than other genes to mastoparan. Collectively, these data show that both arms of the TLR4 signaling pathway are sensitive to G protein inhibition by mastoparan and that TLR2 signaling is less sensitive to G protein inhibition than is TLR4-mediated signaling.
|
|
Fig. 3, C and D, showed the inhibitory effect of mastoparan on TLR4-mediated p38 phosphorylation and kinase activity in HMEC, consistent with previous reports in human monocytes (33). To confirm and extend these findings in murine macrophages, the RAW 264.7 cell line was also assessed for its ability to respond to LPS in the absence or presence of mastoparan by measuring IRAK-1-associated kinase activity. Fig. 7 shows that LPS-induced IRAK-1 kinase activity, measured by the phosphorylation of the substrate, MBP, is readily detected by 15 min after LPS stimulation and peaks in this cell line by 30 min post-LPS. Mastoparan treatment significantly blocked LPS-induced IRAK-1 kinase activity. In contrast, IRAK-1 kinase activity induced by Pam3Cys is more sluggish, peaking at 60 min posttreatment, and was less sensitive to mastoparan-induced inhibition.
|
secretion (Fig. 2C); in time course studies, mastoparan inhibited LPS-induced ERK1/2 phosphorylation at 15, 30, and 60 min post-LPS stimulation, while Pam3Cys-induced ERK1/2 phosphorylation was not significantly inhibited (Fig. 8A). In contrast, mastoparan did not inhibit PI3K-induced phosphorylation of Akt induced by either LPS or Pam3Cys (Fig. 8B). Taken collectively, these data support an important role for G proteins in TLR4-mediated signaling in HMEC and in macrophages, and demonstrate that inhibition of G protein signaling is both TLR-specific and targets specific kinases in the TLR4-signaling pathway.
|
| Discussion |
|---|
|
|
|---|
B activation, and others) are mimicked by G protein activation and that LPS increased GTPase activity in macrophages (reviewed in Ref. 60). Since the original observations of Jakway and DeFranco, there have been a number of papers that have confirmed and extended these findings in human and murine monocytes and macrophages, and occasionally in other cell types, using pharmacologic approaches, e.g., PT or mastoparan, to dysregulate G protein-coupled signaling. The mechanisms by which PT and mastoparan exert their inhibitory effects on G protein-mediated responses differ. PT-induces ADP-ribosylation of G
proteins, precluding their interaction with GCPRs (34); however, it does not affect the ability of G proteins to bind or hydrolyze GTP (61). In contrast, mastoparan is a G protein agonist, and has been reported to act predominantly on Gi and G0 proteins by accelerating GTP binding and promoting the dissociation of bound GDP, which, in turn, results in activation of G
and its dissociation from G
subunits (35, 36). Therefore, the mechanism by which mastoparan inhibits LPS-induced signaling is presumed to be due to a depletion of available G
proteins necessary for LPS-driven signaling. Repeated attempts to demonstrate this directly in macrophages were unsuccessful (our unpublished observations), and the use of any pharmacologic inhibitor must be viewed with caution. Nonetheless, there have been many previous studies showing that PT and mastoparan, which uncouple G protein-mediated signaling by distinct mechanisms, both modulate LPS-induced responses. However inhibition of all LPS-induced responses by PT has not been consistently observed. For example, in studies reported by Zhang and Morrison (39, 40), PT pretreatment of peritoneal exudate macrophages resulted in inhibition of LPS-induced NO release, while TNF-
secretion was augmented, an observation that we have confirmed independently (A. Lentschat, data not shown). More recently, Solomon et al. (33) failed to observe PT-induced inhibition of LPS-induced signaling in human monocytes, while mastoparan pretreatment uniformly inhibited LPS-induced responses and afforded significant protection in vivo in a model of LPS-induced shock in lead acetate-sensitized rats. Ferlito et al. (62) used Chinese hamster ovary cells stably transfected with CD14 and found that PT blocked LPS-induced p38 phosphorylation, but not I
B
degradation, while mastoparan synergized with LPS for p38 phosphorylation. In the human macrophage cell line, THP-1, this same group found that PT pretreatment of cells attenuated not only LPS-induced p38 kinase, but also JNK activation and TNF-
production, while it failed to inhibit LPS-induced IRAK-1 or NF-
B translocation (63). In the murine macrophage-like cell line, J774.1, or the human macrophage-like THP-1 cell line, PT pretreatment led to inhibition of TNF-
by two TLR2 agonists, heat-killed Staphylococcus aureus or group B streptococci (64), in contrast to our observations using mastoparan. The reasons for these inconsistent results are not obvious, but may be related to the cell type being studied, or possibly, the length of time or concentration of mastoparan or PT used. An additional line of support for the participation of G proteins in LPS signaling lies in the observations that G protein content and activity are altered in several models of endotoxin tolerance, a state of transient LPS hyporesponsiveness induced in vivo or in vitro by LPS pre-exposure (65, 66). Very recently, Fan et al. (67) dissociated constitutively activated TLR4-mediated ERK1/2 and AP-1 activation from NF-
B translocation using a transfection approach in cells that were pretreated with PT or cotransfected with dominant-negative constructs that interfere with G
i. Taken collectively, these papers support the concept that G proteins are an important component of LPS signaling.
Our study initially focused on the role of G proteins in TLR4-mediated responses and how these might differ in cell lines that 1) fail to express CD14 or 2) in response to other agonists. The findings presented herein confirm the findings of Solomon et al. (33) and extend them in several significant ways. First, given that CD14 and G proteins were found to coimmunoprecipitate (33), one might predict that cells that lack mCD14 would not be sensitive to pharmacologic disruption of G protein signaling. However, our findings that mastoparan inhibited most facets of LPS signaling in CD14-deficient HMEC suggest that the G proteins are not physically associated with CD14. Rather, it is likely that the G proteins are coimmunoprecipitated by anti-CD14 Ab because they reside in detergent-insoluble lipid rafts that also contain GPCRs and other signaling molecules, e.g., src kinases. This hypothesis is consistent with an earlier report by Stefanova et al. (32), and later confirmed by Solomon et al. (33), showing that immunoprecipitates obtained after treatment of monocyte membrane lysates with anti-CD14 Ab also contained src kinases. Thus, one would predict that G proteins involved in LPS signaling are associated with one or more GPCR that are also found within these same microdomains, rather than CD14 per se. Previous observations of Triantafilou and coworkers (22, 23) that the chemokine receptor, CXCR4, is part of the "LPS signaling complex," provides an attractive possibility, although we have not been able to confirm the participation of CXCR4 in LPS signaling (A. Lentschat, data not shown). Our finding that LPS-induced signaling in macrophages can be inhibited within 5 min of LPS stimulation (e.g., IRAK-1) or within 15 min in HMEC or macrophages (e.g., p38 or ERK1/2) would also argue against the possibility that LPS leads to de novo synthesis of chemokine that might trigger G protein-dependent signaling through CXCR4 (or other cytokine receptors) and would be sensitive to mastoparan. It is also possible that other GPCRs, apart from CXCR4 or other chemokine receptors, may affect LPS signaling. In this regard, activation of adenosine receptors has been shown to modulate LPS-induced signaling (68). Ligand engagement of the seven transmembrane, G protein-coupled, adenosine A2 receptor was observed to synergize with TLR 2, 4, 7, and 9 agonists, but not with TLR3 or 5 agonists, resulting in an up-regulation of vascular endothelial growth factor production, while down-regulating TNF-
secretion in murine macrophages (68). For TLR4, this synergy is entirely MyD88- and IRAK-4-dependent (S. J. Leibovitch, unpublished observation) and is not seen in mice with a deletion in TLR4 (68). Thus, the role of G proteins in TLR4 signaling may depend on the association of TLR4 with multiple GPCRs found within rafts that are brought into close proximity of TLR4 upon exposure of cells to agonists that engage both the TLR4 and the GPCR.
We observed that the HMECs were consistently more sensitive to mastoparan-induced inhibition than were the murine primary macrophages or the murine macrophage cell line, RAW 264.7, although higher concentrations of mastoparan were required to inhibit LPS-induced reporter activity than cytokine secretion in these cells. Optimal inhibition of LPS-induced cytokine secretion in HMECs was observed at 10 µM, consistent with previous studies by Solomon et al. (33), in which cytokine secretion induced by 10 ng/ml LPS in either human monocytes or PBMC was inhibited maximally at 13.3 µM mastoparan. In all of the assays performed herein, the mouse macrophages and RAW 264.7 cell line required 2025 µM mastoparan to inhibit TLR4-mediated signaling optimally (e.g., cytokine secretion, gene expression, or MAPK activation). This suggests that there may be cell type and/or species differences in mastoparan sensitivity and may be related to differential G protein composition of these different cell types.
We have previously shown that the induction of IFN-
distinguishes TLR4- from TLR2-mediated signaling, and that autocrine use of IFN-
by macrophages resulted in expression of a number of STAT1-dependent genes (58). This finding, coupled with the observation that IRF-3, a transacting factor necessary for IFN-
transcription, was induced by TLR4, but not TLR2 agonists (69), strengthened the notion that TLR4 and TLR2 shared a signaling pathway that was MyD88-dependent, but that TLR4 activated a MyD88-independent pathway leading to IRF-3 activation and IFN-
induction. One of the major findings presented in our study is that mastoparan affects both MyD88-dependent and MyD88-independent signaling pathways induced by TLR4 as demonstrated by a global suppression of TLR4-inducible genes. This also suggests that the interference of TLR4 signaling by mastoparan occurs before the bifurcation leading to activation of MyD88-dependent or IRF-3-generating (MyD88-independent) signaling pathways. Again, this is supported by the fact that IRAK-1 kinase activity was detectably inhibited in the presence of mastoparan within 5 min of LPS stimulation. Furthermore, the observation that TLR2 agonists (PSM and Pam3Cys), IL-1
, and TNF-
signaling are much less sensitive to mastoparan suggests the possibility that TLR4 may be unique in its ability to interact with GPCRs in membrane microdomains. A recent paper describes CD81, a tetraspanin molecule, as a scaffold for the orphan heterotrimeric GPCR (70). Given that CD81 was also recently identified as a component of the LPS receptor complex and CD81-deficient mice are refractory to LPS in vivo,6 it is tempting to speculate that CD81 may serve as a molecular scaffold that brings together TLR4 and GPCR.
It is also interesting that while both IRAK-1 and MAPK activation induced by LPS were inhibited by mastoparan, LPS- and Pam3Cys-stimulated Akt phosphorylation was not. This indicates that the activation of phosphoinositol-3-kinase is insensitive to G protein inhibition in both TLR4- and TLR2-stimulated cells. At this time, there is little known about the upstream kinase(s) that contribute to the activation of PI3K, but apparently its activation is not dependent upon a G protein-activated effector molecule.
In summary, our understanding of the role of G proteins in LPS signaling suggests that it represents a potential target for novel therapeutic intervention, with the goal of dampening excessive inflammatory responses. However, additional studies will be needed to delineate the complex interactions between G protein-coupled responses and TLR receptor complexes and the interactions with the adapter molecules and downstream kinases.
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported by National Institutes of Health Grants AI-18797 (to S.N.V.) and HL-66436 (to M.A.). ![]()
2 A.L. and H.K. contributed equally. ![]()
3 S.N.V. and M.A. contributed equally. ![]()
4 Address correspondence and reprint requests to Dr. Moshe Arditi, Pediatric Infectious Diseases, Cedars-Sinai Medical Center, 8700 Beverly Boulevard, Room 4220 North Tower, Los Angeles, CA 90048. E-mail address: moshe.arditi{at}cshs.org ![]()
5 Abbreviations used in this paper: mCD14, membrane-bound CD14; hsp, heat shock protein; HMEC, human dermal microvessel endothelial cell; GPCR, G protein-coupled receptor; PT, pertussis toxin; PSM, phenol-soluble modulin; Pam3Cys, S-[2,3-Bis(palmitoyloxy)-(2-RS)-propyl]-N-palmitoyl-(R)-Cys-(S)-Ser-Lys4-OH, trihydrochloride; IRAK-1, IL-1R-associated kinase-1; iNOS, inducible NO synthase; IP-10, IFN-
-inducible protein 10; MBP, myelin basic protein; FSL-1, S-(2,3-bispalmitoyloxypropyl)-Cys-Gly-Asp-Pro-Lys-His-Pro-Lys-Ser-Phe, Pam(2)CGDPKHPKSF. ![]()
6 A. Malzan, C. Noetzel, Z. Orinska, N. Reiling, L. Brade, G. Schmitz, S. Bulfone-Paus, A. J. Ulmer, and H. Heine. CD81-deficient mice are protected from LPS-induced shock. Submitted for publication. ![]()
Received for publication August 26, 2004. Accepted for publication January 10, 2005.
| References |
|---|
|
|
|---|
, MCP-1, IL-10, sICAM-1 and sVCAM-1. J. Neurol. 245:727.[Medline]
B. J. Immunol. 165:3541.
-arrestins in receptor signaling and desensitization. J. Biol. Chem. 273:18677.
subunits of heterotrimeric G proteins acting on a Ras and Rac1-dependent pathway. J. Biol. Chem. 271:3963.
q/11-induced activation of c-Jun N-terminal kinase and p38 mitogen-activated protein kinase. J. Biol. Chem. 273:22892.
and nitric oxide production in mouse peritoneal macrophages. J. Immunol. 150:1011.[Abstract]
B through Toll-like receptor 4 (TLR4) in cultured human derman endothelial cells. J. Biol. Chem. 275:11058.
B through interleukin-1 signaling mediators in cultured human derman endothelial cells and mononuclear phagocytes. J. Biol. Chem. 274:7611.